CN116103262A

CN116103262A - Cotton silk/threonine protein phosphatase GhTOPP4, encoding gene and application thereof

Info

Publication number: CN116103262A
Application number: CN202211099398.XA
Authority: CN
Inventors: 李召虎; 李芳军; 周琳; 王玉贤; 田晓莉
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2022-09-08
Filing date: 2022-09-08
Publication date: 2023-05-12

Abstract

The invention discloses cotton silk/threonine protein phosphatase GhTOPP4, and a coding gene and application thereof. The GhTOPP4 is a protein shown in the following a) or b) or c) or d): a) A protein consisting of the amino acid sequence shown in SEQ ID No. 1; b) A fusion protein obtained by connecting a tag to the N end and/or the C end of the protein shown in SEQ ID No. 1; c) A protein with the same function, wherein the amino acid sequence shown in SEQ ID No.1 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues; d) A protein having 80% or more homology with the amino acid sequence defined in any one of a) to c) and having the same function. The invention discovers that the cotton GhTOPP4 protein can regulate and control the stress tolerance of plants, and lays a good molecular foundation for effectively improving the salt tolerance, drought tolerance and ABA stress tolerance of plants.

Description

Cotton silk/threonine protein phosphatase GhTOPP4, encoding gene and application thereof

Technical Field

The invention relates to the field of plant genetic engineering, in particular to cotton silk/threonine protein phosphatase GhTOPP4, and a coding gene and application thereof.

Background

About 20% of irrigated land worldwide (producing one third of the world's food) is threatened by salt damage. In about 1 hundred million hectares of farmland in China, saline-alkali soil occupies 666 ten thousand hectares, and in addition, nearly 2 hundred million hectares of saline-alkali barren lands exist, and salinization and secondary salinization land areas still continue to expand. Soil salinization has become one of the major problems in agricultural production. As important cash crops, cotton is gradually transferred to northwest inland regions with higher soil salinization degree due to factors such as requirements of growth on photo-heat, cotton grain competition, labor cost increase and the like, but excessive salt in the soil can seriously affect the yield and quality of the cotton. With the continuous development of biotechnology means, cultivation of salt-tolerant drought-resistant cotton varieties through gene expression or editing becomes one of important means for stress-tolerant cultivation. The cloning of the cotton stress resistance gene and the research on the stress resistance mechanism thereof are still slow compared with grain crops such as rice, corn, wheat and the like due to the limitation of genetic transformation efficiency.

The main forms of posttranslational modification of eukaryotic proteins are reversible phosphorylation and dephosphorylation, which affect protein activity, stability and its localization and interaction, and cell activities such as stress response are also regulated by reversible phosphorylation. Protein phosphatases are mainly three major classes of serine/threonine protein phosphatases (PPP), tyrosine protein phosphatases, and bispecific protein phosphatases. In eukaryotes, more than 90% of protein dephosphorylation reactions are catalyzed by members of the PPP protein phosphatase family. The PPP family of protein phosphatases is subdivided into PP1, PP2A, PP4-7, and the Shewanella phosphatase rhizobia/rhodobacter/spirulina family of phosphatases, kelch domain-like protein phosphatases. The family protein phosphatase has a small number and a relatively conservative catalytic subunit, but has a large number of regulating subunits, so that the dephosphorylation process of thousands of substrate proteins can be regulated and controlled, and thus, the family protein phosphatase participates in regulating various biological processes.

Disclosure of Invention

The invention aims to solve the technical problem of how to regulate and control the stress tolerance of plants.

In order to solve the above technical problems, the present invention provides a protein named as serine/threonine protein phosphatase GhTOPP4, abbreviated as GhTOPP4 protein, derived from cotton (Gossypium hirsutum), which is any one of the following proteins:

a) A protein consisting of an amino acid sequence shown as SEQ ID No.1 in a sequence table;

b) A fusion protein obtained by connecting a tag with the N end and/or the C end of the protein shown in SEQ ID No.1 in a sequence table;

c) A protein with the same function, which is obtained by substituting and/or deleting and/or adding one or more amino acid residues for the amino acid sequence shown in SEQ ID No.1 in the sequence table;

d) A protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of a) to c) and having the same function.

Wherein SEQ ID No.1 consists of 316 amino acid residues.

The protein can be synthesized artificially or obtained by synthesizing the coding gene and then biologically expressing.

Among the above proteins, the tag (protein-tag) refers to a polypeptide or protein that is fusion expressed together with a target protein by using a DNA in vitro recombination technique, so as to facilitate the expression, detection, tracing or purification of the target protein. The tag may be a Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag, and/or SUMO tag, etc.

In the above protein, the substitution and/or deletion and/or addition of one or several amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

In the above protein, the term "identity" refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, per residue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating, and then obtaining the value (%) of the identity.

In the above protein, the 90% or more identity may be at least 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

Biological materials related to the above-mentioned GhTOPP4 protein are also included in the scope of the present invention.

The biological material is any one of the following C1) -C10):

c1 Nucleic acid molecules encoding the above-mentioned GhTOPP4 proteins;

c2 An expression cassette comprising C1) said nucleic acid molecule;

c3 A recombinant vector comprising C1) said nucleic acid molecule, or a recombinant vector comprising C2) said expression cassette;

c4 A recombinant microorganism comprising C1) said nucleic acid molecule, or a recombinant microorganism comprising C2) said expression cassette, or a recombinant microorganism comprising C3) said recombinant vector;

C5 A transgenic plant cell line comprising C1) said nucleic acid molecule, or a transgenic plant cell line comprising C2) said expression cassette, or a transgenic plant cell line comprising C3) said recombinant vector;

c6 A) a transgenic plant tissue comprising C1) said nucleic acid molecule, or a transgenic plant tissue comprising C2) said expression cassette, or a transgenic plant tissue comprising C3) said recombinant vector;

c7 A transgenic plant organ comprising C1) said nucleic acid molecule, or a transgenic plant organ comprising C2) said expression cassette, or a transgenic plant organ comprising C3) said recombinant vector;

c8 A transgenic plant containing the nucleic acid molecule of C1), or a transgenic plant containing the expression cassette of C2), or a transgenic plant containing the recombinant vector of C3);

c9 A tissue culture produced by regenerable cells of the transgenic plant of C8);

c10 Protoplasts produced from the tissue culture of C9).

In the above biological material, C1) the nucleic acid molecule may be DNA such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc. The nucleic acid molecule is specifically any one of the following 1) -3):

1) The coding sequence is a DNA molecule shown as SEQ ID No. 2;

2) A DNA molecule which has 75% or more identity with the nucleotide sequence defined in 1) and which encodes the above GhTOPP4 protein;

3) A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in 1) or 2) and which encodes the above-mentioned GhTOPP4 protein.

Wherein, SEQ ID No.2 is composed of 951 nucleotides, which codes for the protein shown in SEQ ID No. 1.

By identity is meant sequence similarity to the native nucleic acid sequence. "identity" includes a nucleotide sequence having 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the protein consisting of the amino acid sequence shown in SEQ ID No.1 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

The stringent conditions are hybridization and washing of the membrane 2 times at 68℃in a solution of 2 XSSC, 0.1% SDS for 5min each time, and hybridization and washing of the membrane 2 times at 68℃in a solution of 0.5 XSSC, 0.1% SDS for 15min each time.

In the above biological material, C2) the expression cassette refers to DNA capable of expressing GhTOPP4 in a host cell, and the DNA may include not only a promoter for initiating transcription of GhTOPP4 gene but also a terminator for terminating transcription of GhTOPP 4. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: promoters of the GhTOPP4 gene itself, constitutive promoters, tissue, organ and development specific promoters and inducible promoters. Examples of promoters Sub-includes, but is not limited to: a constitutive promoter of cauliflower mosaic virus 35S; wound-inducible promoters from tomato, leucine aminopeptidase ("LAP", chao et al (1999) Plant Physiol 120:979-992); a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR 1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester); tomato protease inhibitor II promoter (PIN 2) or LAP promoter (both inducible with jasmonic acid ester); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed specific promoters such as the millet seed specific promoter pF128 (CN 101063139B (China patent 2007 1 0099169.7)), seed storage protein specific promoters (e.g., phaseolin, napin, oleosin and soybean beta glucose promoters (Beachy et al (1985) EMBO J.4:3047-3053) which may be used alone or in combination with other plant promoters all references cited herein are incorporated by reference in their entirety suitable transcription terminators include, but are not limited to, the GhTOPP4 gene terminator itself, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, tml terminator, the pea rbcS E9 terminator and the nopaline and octopine synthase terminator (see, e.g., odell et al (I) ⁹⁸⁵ ) Nature 313:810; rosenberg et al (1987) Gene,56:125; guerineau et al (1991) mol. Gen. Genet,262:141; proudroot (1991) Cell,64:671; sanfacon et al Genes Dev.,5:141; mogen et al (1990) Plant Cell,2:1261; munroe et al (1990) Gene,91:151; ballad et al (1989) Nucleic Acids Res.17:7891; joshi et al (1987) Nucleic Acid Res., 15:9627).

In the above biological material, C3) the recombinant vector may contain a DNA molecule shown in SEQ ID No.2 for encoding GhTOPP4 protein.

Recombinant vectors containing the gene of the GhTOPP4 protein or the gene expression cassette of the GhTOPP4 protein can be constructed by using existing plant expression vectors. The plant expression vector may be a Gateway system vector or a binary expression vector, etc., such as pMDC32, super1300, pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb. When the GhTOPP4 is used for constructing a recombinant vector, any one of enhanced, constitutive, tissue-specific or inducible promoters such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin promoter (pUbi) and the like can be added before transcription initiation nucleotide thereof, and can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a plant expression vector, enhancers, including translational enhancers or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin markers, kanamycin markers, etc.), or marker genes against chemical agents (e.g., herbicide genes), etc., which can be expressed in plants.

In the above biological material, the recombinant microorganism may specifically be yeast, bacteria, algae and fungi; the bacterium may be Agrobacterium GV3101 as described.

In the above biological material, the transgenic plant organ may be the root, stem, leaf, flower, fruit and seed of the transgenic plant.

In the above biological material, the tissue culture may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

In the above biological materials, none of the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs include propagation material.

In order to solve the technical problems, the invention also provides a new application of GhTOPP4 or a biological material related to the GhTOPP 4.

The invention provides application of GhTOPP4 protein or biological material related to the GhTOPP4 protein in regulating plant stress tolerance or cultivating transgenic plants with reduced stress tolerance or plant breeding. Further, the regulation may be reduced, and is specifically shown as follows: when the content of GhTOPP4 protein in the plant is increased or the expression level of the GhTOPP4 protein coding gene is increased, the seed germination rate of the plant under salt stress is reduced, the green-turning rate of cotyledons under ABA stress is increased, and the root length is increased.

In order to solve the technical problems, the invention also provides a new application of the substance shown in b1 or b 2;

b1, substances which inhibit or reduce the activity and/or the content of the GhTOPP4 protein in plants;

b2, inhibiting or reducing expression of a gene encoding a GhTOPP4 protein in the plant or knocking out a gene encoding a GhTOPP4 protein in the plant.

The invention provides application of the substance shown in b1 or b2 in transgenic plants or plant breeding for improving plant stress tolerance or cultivating stress tolerance. Further, the object of the breeding is to cultivate a plant variety with improved stress tolerance, and specifically, a plant containing the GhTOPP4 protein or a biological material related thereto (e.g., a gene encoding the GhTOPP4 protein) may be crossed with other plants for plant breeding.

Still further, the substance that inhibits or reduces the expression of the gene encoding the GhTOPP4 protein in the plant may be a vector or a helper vector that inhibits the expression of the GhTOPP4 gene in the plant. The vector for inhibiting the GhTOPP4 gene expression in the plant can be a pYL156 vector containing DNA molecules shown in the 1 st-367 th positions of SEQ ID No. 2; the helper vector may specifically be a pTRV-RNA1 vector.

In order to solve the technical problems, the invention also provides a method for cultivating transgenic plants with improved stress tolerance.

The method for cultivating transgenic plants with improved stress tolerance comprises the steps of reducing the activity and/or the content of GhTOPP4 protein in a receptor plant to obtain transgenic plants; the transgenic plant is stress tolerant higher than the recipient plant.

Further, the transgenic plant has a stress tolerance higher than that of the recipient plant and is represented by at least one of the following M1) -M3):

m1) under salt stress, the transgenic plant has a greater number of leaves than the recipient plant;

m2) the transgenic plant has a lower wilting degree than the recipient plant under drought stress;

m3) the transgenic plant has a lower water loss rate than the recipient plant under drought stress.

The method for reducing the activity and/or content of GhTOPP4 protein in the receptor plant is realized by knocking out or inhibiting or silencing the gene encoding the GhTOPP4 protein in the receptor plant. The method of inhibiting the expression of the gene encoding the GhTOPP4 protein in the recipient plant may be by introducing a substance inhibiting the expression of the gene encoding the GhTOPP4 protein into the recipient plant.

Further, the substances for inhibiting the expression of the GhTOPP4 protein coding gene are a vector for inhibiting the expression of the GhTOPP4 gene and an auxiliary vector.

In a specific embodiment of the present invention, the vector for inhibiting the expression of the GhTOPP4 gene in the plant is a pYL156 vector containing the DNA molecule shown in SEQ ID No.2 at positions 1-367; the auxiliary vector is pTRV-RNA1 vector.

In order to solve the technical problems, the invention finally provides a method for cultivating transgenic plants with reduced stress tolerance.

The method for cultivating transgenic plants with reduced stress tolerance comprises the steps of improving the content and/or activity of GhTOPP4 protein in a receptor plant to obtain transgenic plants; the transgenic plant has a stress tolerance lower than the recipient plant.

Further, the transgenic plant has a stress tolerance lower than that of the recipient plant and is represented by at least one of the following N1) -N3):

n1) the cotyledon greening rate of the transgenic plant is lower than that of the recipient plant under salt stress;

n2) the cotyledon green-turning rate of the transgenic plant is higher than that of the recipient plant under ABA stress;

n3) the root length of the transgenic plant is longer than the recipient plant under ABA stress.

The method for increasing the content and/or activity of the GhTOPP4 protein in the receptor plant is to over-express the GhTOPP4 protein in the receptor plant.

Further, the over-expression method is to introduce the gene encoding the GhTOPP4 protein into a recipient plant.

In a specific embodiment of the invention, the nucleotide sequence of the encoding gene of the GhTOPP4 protein is shown as SEQ ID No. 2. The encoding gene of the GhTOPP4 protein is introduced into a receptor plant through a 35 S:GhTOPP 4-HA recombinant vector. The 35S is that the GhTOPP4-HA recombinant vector is obtained by replacing a DNA fragment between BamHI and StuI enzyme cutting sites of the pMDC32 vector with a DNA molecule shown in SEQ ID No.2 and keeping other sequences of the pMDC32 vector unchanged.

In any of the above applications or methods, the stress tolerance is salt tolerance and/or drought tolerance and/or ABA stress resistance (ABA sensitivity).

In any one of the above applications or methods, the plant is a monocot or dicot; the dicotyledonous plant may be Arabidopsis thaliana or cotton.

The substances indicated by b1 or b2 mentioned above are also within the scope of the invention.

The invention provides a cotton GhTOPP4 gene, constructs transgenic Arabidopsis through transgenic technology, constructs GhTOPP4 silent plant through VIGS technology, and performs functional verification on GhTOPP4, which makes sure that after the gene GhTOPP4 is inhibited and expressed in plants, the stress tolerance of plants can be improved, especially the drought tolerance, salt tolerance and ABA stress resistance of plants are improved, thus being beneficial to deeply researching the response mechanism of plants to abiotic stress signals such as salt, drought and the like, laying a good molecular foundation for effectively improving the salt tolerance and drought resistance of plants, and having great value for exploring the signal regulation network of plants under stress.

Drawings

FIG. 1 shows agarose gel electrophoresis of the amplified products of GhTOPP4 gene.

FIG. 2 is a schematic structural diagram of 35S: ghTOPP4-GFP recombinant vector and GhTOPP4 subcellular localization map.

Wherein A is 35S, the structural diagram of GhTOPP4-GFP recombinant vector; b is GhTOPP4 subcellular localization map.

FIG. 3 is a schematic structural diagram of GST-GhTOPP4 recombinant vector, a coomassie brilliant blue staining gel diagram of GST-GhTOPP4 recombinant protein and detection of GhTOPP4 phosphatase activity. Wherein A is a structural schematic diagram of GST-GhTOPP4 recombinant vector; b is a coomassie brilliant blue staining gum chart of GST-GhTOPP4 recombinant protein; c is GhTOPP4 phosphatase activity assay.

FIG. 4 is a construction of a VIGS-GhTOPP4 silent plant and stress tolerance analysis. Wherein A is an agarose gel electrophoresis chart of an amplified product of a VIGS silencing fragment (nucleotides 1 to 367) of the GhTOPP4 gene; b is identification of cotton GhTOPP4 gene silencing efficiency; c is the salt stress phenotype of the VIGS-GhTOPP4 silent plant; d is the drought stress phenotype of the VIGS-GhTOPP4 silent plant; e is the water loss rate of VIGS-GhTOPP4 silenced plants in vitro.

FIG. 5 shows the expression level change of cotton GhTOPP4 gene under abiotic stress.

FIG. 6 shows construction and stress tolerance analysis of GhTOPP4 over-expressed transgenic Arabidopsis lines. Wherein A is a structural schematic diagram of 35S: ghTOPP4-HA recombinant vector; b is a GhTOPP4 over-expression transgenic arabidopsis strain Western Blot identification chart; c is the germination condition comparison of GhTOPP4 over-expression transgenic arabidopsis homozygous strains OE1, OE2 and OE3 under different stress conditions; d is the statistical result of the green-turning rate of cotyledons of the GhTOPP4 over-expression transgenic arabidopsis homozygous strains OE1, OE2 and OE3 under different stress conditions; e is root growth of GhTOPP4 over-expressed transgenic arabidopsis homozygous strains OE1, OE2 and OE3 under the condition of ABA stress; f is root length statistical result of GhTOPP4 over-expression transgenic arabidopsis homozygous strains OE1, OE2 and OE3 under ABA stress condition.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Example 1, discovery and cloning of GhTOPP4 protein and Gene encoding same

1. GhTOPP4 protein and discovery of coding gene thereof

The invention screens the relevant genes of the VIGS cDNA library salt (the function of the cotton stress-resistant gene is researched by using the VIGS technology, li Fangjun, chinese agricultural university, 2014) and searches by using a cotton database, and finally a new protein is obtained from a cotton variety Guoxin No. 3 (the variety is recorded in the patent literature Guoxin No. 3 insect-resistant cotton cultivation technology, feng Sulian, hebei agriculture, 2011, 06'), and is named as GhTOPP4 protein, wherein the amino acid sequence of the GhTOPP4 protein is shown as sequence 1 and consists of 316 amino acid residues; the gene encoding GhTOPP4 protein is named as GhTOPP4 gene, and the open reading frame of the GhTOPP4 gene is shown as SEQ ID No.2 and consists of 951 nucleotides.

2. Cloning of GhTOPP4 Gene

1. RNA extraction

Leaf and root RNA of cotton (Guoxin No. 3) are extracted by using an Edley kit (the kit is purchased from Beijing Jiukang source biotechnology Co., ltd.) and the extraction method is operated according to the specification of the kit.

2. cDNA acquisition

First strand cDNA was synthesized using M-MLV reverse transcription kit (purchased from Promega corporation) and the obtained first strand cDNA was used as a template for amplifying the full length of GhTOPP4 gene.

3. PCR amplification

Two specific primers (upstream primer F1: ATGGCGGCTGCGACGGCGC and downstream primer R1: TTACATTTTAGTGGGCATGA) were designed according to the GhTOPP4 gene sequence for PCR amplification to obtain PCR products.

The PCR reaction system (20. Mu.L) was as follows: template 10 XBuffer 2. Mu.L, 10mmol/L dNTPs 2. Mu. L, mgSO ₄ 1.4. Mu. L, cDNA 1.2. Mu. L, KOD-Plus enzyme 0.4. Mu.L, upstream primer (10. Mu.M) 0.3. Mu.L, downstream primer (10. Mu.M) 0.3. Mu. L, ddH ₂ O 12.4μL。

The PCR amplification procedure was as follows: 94 ℃ for 2min; the procedure for 30 cycles was 94℃for 15s;56 ℃ for 30s;68 ℃ for 3min; finally, the extension is carried out at 68 ℃ for 10min.

4. Sequencing of PCR products

1) The PCR products were taken and electrophoresed on a 1% agarose gel (FIG. 1). And cutting off a target band after electrophoresis under an ultraviolet lamp, recovering by using an agarose gel DNA recovery kit (purchased from Tiangen Biochemical technology Co., ltd.), and purifying to obtain a purified fragment.

2) And adding A to the tail end of the purified fragment to obtain the fragment added with A. Wherein, 10. Mu.L of the reaction system is as follows: 10 XBuffer 1. Mu. L, dATP 1. Mu. L, taq enzyme 0.5. Mu.L, purified fragment 7.5. Mu.L, and reacted at 72℃for half an hour.

3) The fragment after A addition was ligated with a PMD18-T vector (purchased from TaKaRa) and the ligation was performed according to the kit instructions to obtain a ligation product. Wherein, 10. Mu.L of the reaction system is as follows: the fragment 4.5. Mu. L, PMD 18-T0.5. Mu.L after A addition and Solution I5. Mu.L were ligated overnight at 16 ℃.

4) And (3) taking 5 mu L of the connection product, translating the connection product by adopting a thermal shock method (refer to J. Sambrook, et al, huang Peitang and the like, translating a molecular cloning experiment guide (third edition), scientific press, 2002 edition), screening positive clones in an LB solid plate containing 50mg/L of ampicillin, picking up 5 clones for sequencing, and sending the 5 clones to Shanghai in vitro company for sequencing to obtain the full-length cDNA of the required gene, thus obtaining the GhTOPP4 gene. Sequencing results show that the cDNA sequence of the gene is 951bp in full length, the nucleotide sequence of the gene is shown as SEQ ID No.2, and the gene codes GhTOPP4 protein shown as SEQ ID No.1 consisting of 316 amino acid residues.

EXAMPLE 2 GhTOPP4 protein characterization

1. GhTOPP4 subcellular localization

The invention utilizes protoplasts to study subcellular localization of GhTOPP4 protein. The method comprises the following specific steps:

1. 35S construction of GhTOPP4-GFP recombinant vector

The forward and reverse primers for amplifying The entire coding region of The GhTOPP4 gene were designed based on The multiple cloning site of The expression vector pHBT-GFP (this vector was obtained from Libo Shan laboratory, university of agricultural chemical, texas, described in The literature "The chip Wall-Associated Kinase GhWAK A Mediates Responses to Fungal Wilt Pathogens by Complexing with The Chitin Sensory Receptors. Ping Wang et al., the Plant Cell, 2020"), and The coding region sequence of The GhTOPP4 gene, to give a 35S: ghTOPP4-GFP recombinant vector. The method comprises the following specific steps:

1) PCR amplification was performed using the GhTOPP4 gene obtained in example 1 as a template and using the upstream primer F2 and the downstream primer R2 to obtain a product containing the GhTOPP4 gene. Wherein, the primer sequence is as follows:

the upstream primer F2:5' -CGGGATCCATGGCGGCTGCGACGGCGC-3' (underlined as BamHI cleavage site);

downstream primer R3:5' -AAGGCCTCATTTTAGTGGGCATGAACT-3' (underlined as StuI cleavage site).

2) The product containing GhTOPP4 gene and the expression vector pHBT-GFP were digested with BamHI and StuI, respectively, to obtain digested product and vector frame, which were recovered.

3) The cleavage product was ligated to the vector frame to give a 35S: ghTOPP4-GFP recombinant vector (structure schematic shown in FIG. 2A).

The 35S is that the GhTOPP4-GFP recombinant vector is obtained by replacing a DNA fragment between BamHI and StuI enzyme cutting sites of an expression vector pHBT-GFP with a GhTOPP4 gene with a sequence 2 and keeping other sequences of the pHBT-GFP unchanged.

2. Isolation and transformation of Arabidopsis protoplasts

1) The following solutions were prepared:

enzymolysis liquid (10 mL): 1%Cellulase R10,0.2%Macerozyme R10,0.4M mannitol,20mM KCl,20mM MES (pH 5.7), 10mM CaCl ₂ 。

WI solution: 20mM KCl,0.5M mannitol,4mM MES (pH 5.7).

W5 solution: 125mM CaCl ₂ ，154mM NaCl，5mM KCl，2mM MES(pH 5.7)。

MMg solution: 0.4M mannitol,15mM MgCl ₂ ，4mM MES(pH 5.7)。

40% (w/v) PEG conversion solution: 0.2M mannitol,100mM CaCl ₂ ，4g PEG 4000。

Cellulase R10 and Macerozyme R10 were purchased from Onozuka and other reagents from Sigma-Aldrich as referred to in the above solutions.

2) Cutting tender rosette leaves of arabidopsis thaliana of four sides into long strips with the width of about 1mm and the length of about 1cm by using a blade, rapidly transferring the cut strip-shaped leaves into enzymolysis liquid, vacuumizing for 30min in a dark place, and standing in the dark place for enzymolysis for 2-3h; then adding the W5 solution with the same volume as the enzymolysis solution, filtering the enzymolysis solution by using a 200-mesh nylon membrane to remove residues which are not subjected to enzymolysis, wherein the filtrate is the protoplast of the arabidopsis thaliana. Centrifuge at 90g for 2min and discard supernatant. The protoplasts were resuspended in W5 solution and centrifuged at 90g for 2min, the supernatant was discarded, the protoplasts were resuspended in W5 solution and placed on ice for 30min. The W5 solution was aspirated and the protoplasts were resuspended by adding MMg solution to adjust the final protoplast concentration to 2X 10 ⁵ And one/mL was used for transformation.

3) mu.L of protoplasts were pipetted into a 2mL round bottom centrifuge tube and 5. Mu.L of 35S: ghTOPP4-GFP recombinant plasmid and 5. Mu.L of nuclear localization NLS-RFP marker plasmid with red fluorescent protein RFP (this plasmid was obtained from Libo Shan laboratories, texas university, described in document "Noncanonical mono (ADP-ribosyl) ation of zinc finger SZF proteins counteracts ubiquitination for protein homeostasis in plant immunoy.Liang et al, molecular Cell, 2021") were added and gently flicked to mix. Then, 110. Mu.L of 40% PEG solution was added to the tube, and the tube was flicked rapidly to mix, and allowed to stand at room temperature for 5min. The reaction was stopped by adding 800. Mu.L of W5 solution to the tube. The protoplasts were resuspended in WI solution by centrifugation at 90g for 2min and the supernatant discarded. Finally transferring the protoplast into a culture plate for culturing at room temperature under weak light, centrifuging for 2min at 90g after culturing for 10-12h, sucking out WI solution, adding 110 mu L of WI solution into the solution, and mixing the solution evenly by flicking.

4) A small amount of protoplast was sucked up by a tip-cut gun and dropped onto a glass slide, and the expression of GFP and RFP was observed under a confocal laser microscope.

The results showed that GFP green fluorescence signal was observed in the cytoplasm of protoplasts, GFP green fluorescence signal was observed in the nucleus and overlapped with RFP red fluorescence signal observed in the nucleus, ghTOPP4 was localized to the cytoplasm and nucleus (shown in fig. 2B).

2. GhTOPP4 protein induced expression and purification

1. Construction of recombinant expression vectors

PCR amplification was performed using the GhTOPP4 gene obtained in example 1 as a template and the upstream primer F2 and the downstream primer R2 to obtain a product containing the GhTOPP4 gene. The product containing The GhTOPP4 gene and The vector pGEX4T-1 (The vector was obtained from Libo Shan laboratory, university of Texas, described in The literature "The Cotton Wall-Associated Kinase GhWAK7A Mediates Responses to Fungal Wilt Pathogens by Complexing with The Chitin Sensory Receptors. Ping Wang et al, the Plant Cell 2020"), were digested with BamH I and Stu I, respectively, and The digested product was recovered to obtain a gene fragment and a linear vector. The gene fragment and the linear vector are connected to obtain GST-GhTOPP4 recombinant plasmid (the structure schematic diagram of the GST-GhTOPP4 recombinant plasmid is shown in figure 3A).

The GST-GhTOPP4 recombinant plasmid is obtained by replacing the DNA fragment between BamHI and StuI cleavage sites of the vector pGEX4T-1 with the GhTOPP4 gene of SEQ ID No.2 and keeping other sequences of the vector pGEX4T-1 unchanged. The GST-GhTOPP4 recombinant plasmid expresses GST-GhTOPP4 recombinant protein.

2. Inducible expression of GhTOPP4 protein

GST-GhTOPP4 recombinant plasmid was transferred into E.coli BL21 (purchased from Beijing full-scale gold biotechnology Co., ltd.) by heat shock transformation, cultured overnight at 37℃and then inoculated with positive monoclonal to 5mL of LB liquid medium containing antibiotics, cultured overnight at 37℃and 180 rpm. Then inoculating the bacterial liquid into 500mL LB liquid medium containing antibiotics, culturing at 37 ℃ and 180rpm for about 3h to OD _600nm Between 0.6 and 1.0. The bacterial solution was transferred to a 16℃shaker, cooled for about 15min, and then IPTG was added at a final concentration of 0.25mM, and induced overnight at 16℃and 160 rpm.

3. Purification of GhTOPP4 protein

1) Collecting bacterial liquid, centrifuging at 4000rpm at 4deg.C for 20min, discarding supernatant, collecting bacterial cells, adding protein lysis buffer (10 mM NaH) ₂ PO ₄ ，1.8mM K ₂ HPO ₄ 2.7mM KCl,140mM NaCl) 30mL, re-suspending the bacterial cells, adding a lyase with a final concentration of 300 mug/mL, uniformly mixing, and carrying out ice bath for 15min to obtain a lysate.

2) Transferring the lysate to a glass beaker, placing the beaker in an ice box to facilitate heat conduction during ultrasonic crushing, and setting an ultrasonic crusher program: 300W,10min, and 3s ultrasound (the ultrasound crushing time is adjusted according to whether the lysate becomes clear) at intervals of 3s to obtain the bacteria liquid after ultrasound crushing.

3) Transferring the bacteria liquid after ultrasonic disruption to a 50mL centrifuge tube, centrifuging at 4 ℃ at 12000rpm for 20min, collecting supernatant, transferring the supernatant to a clean 50mL BD tube, adding 100 mu L of GST-beads balanced by protein lysis buffer, adding Triton X-100 with a final concentration of 0.5%, mixing uniformly, and incubating for 2-3h by a rotary instrument at 4 ℃.

4) After incubation 500g was centrifuged for 5min, the supernatant was discarded and the beads were washed 3 times with PBS buffer. The collected beads were transferred to a clean 1.5mL EP tube, an appropriate amount of elution buffer (50 mM Tris-HCl pH8.0, 150mM NaCl,10mM reduced glutathione) was added, elution was performed for 2-3 hours at room temperature of 10-15min or 4℃and then centrifuged, and the supernatant was collected to obtain a purified protein solution, which was transferred to a clean 1.5mL EP tube. 2 mu L of supernatant is taken for protein electrophoresis and coomassie brilliant blue staining (GST-GhTOPP 4 protein coomassie brilliant blue staining chart is shown in figure 3B), and other purified proteins are added with glycerol with the final concentration of 10%, and are packaged into centrifuge tubes after being mixed uniformly, and are preserved at-80 ℃.

3. Identification of GhTOPP4 protein phosphatase Activity

The GhTOPP4 protein phosphatase activity assay was performed using nitrophenyl pyrophosphate (pNPP) as a substrate. The protein with phosphatase activity can rapidly hydrolyze pNPP into p-nitrophenol, which is a chromogenic product with absorbance at 405 nm. The method comprises the following specific steps:

pNPP reaction buffer (50 mM Tris-HCl pH 7.0,2mM DTT,1mM pNPP) was prepared, 5. Mu.g of GST-GhTOPP4 recombinant protein (GST-TOPP 4 group) or GST empty protein control (GST group) was added to the reaction buffer, the reaction system was 100. Mu.L, and after mixing, incubation was carried out at room temperature, and the reaction was terminated by adding NaOH according to the time point, and the absorbance of the reaction solution at 405nm was measured and recorded by an ultraviolet/visible spectrophotometer.

The results show that the absorbance increases with the reaction time in the reaction system with GST-GhTOPP4 recombinant protein, the hydrolysis of pNPP increases proportionally, while the absorbance does not increase with the reaction time in the reaction system with GST empty protein. The GhTOPP4 protein was shown to have protein phosphatase activity (FIG. 3C).

EXAMPLE 3 construction of VIGS-GhTOPP4 silenced plants and stress tolerance analysis thereof

1. Construction of VIGS-GhTOPP4 silencing vector

1. Total RNA of leaves of cotton variety Guoxin No. 3 is extracted and reverse transcribed into cDNA.

2. And (2) performing PCR amplification by using the cDNA obtained in the step (1) as a template and adopting a primer pair consisting of an upstream primer F3 and a downstream primer R3 to obtain a PCR amplification product (FIG. 4A). The PCR amplified product is the VIGS silencing fragment of GhTOPP4 gene, and is nucleotide 1-367 of GhTOPP4 gene.

Upstream primer F3:5' -GGAATTCATGGCGGCTGCGACGGCGC-3' (underlined as EcoRI cleavage site);

downstream primer R3:5' -GGGGTACCAGTTCTCTGGGTACTTAAT-3' (underlined as KpnI cleavage site).

3. And (3) cutting the PCR amplification product obtained in the step (2) by using restriction enzymes EcoRI and KpnI, and recovering the cut product.

4. Vector backbone was recovered by double digestion of vector pYL (pTRV 2: RNA 2) with restriction enzymes EcoRI and KpnI (this vector is described in the document "Gao X,2013,Functional genomic analysis of cotton genes with agrobacterium-mediated virus-reduced gene cloning").

5. And (3) connecting the enzyme digestion product obtained in the step (3) with the vector skeleton obtained in the step (4) to obtain the recombinant plasmid pYL-GhTOPP 4.

Sequencing verification is carried out on the recombinant plasmid pYL-GhTOPP 4, and the result shows that: the recombinant plasmid pYL-GhTOPP 4 is obtained by replacing the DNA fragment between EcoRI and KpnI cleavage sites of the vector pYL156 with a partial GhTOPP4 gene fragment shown in the 1 st-367 th sites of the sequence 2, and keeping other sequences of the vector pYL156 unchanged.

2. Acquisition of VIGS-GhTOPP 4-silenced plants

1. Recombinant plasmids pYL-GhTOPP 4, pYL-GFP, pTRV-RNA1 and pYL-GhCLA 1 (pYL-GFP, pTRV-RNA 1) and pYL-GhCLA 1 constructed in the first step are described in the literature "Gao X,2013,Functional genomic analysis of cotton genes with agrobacterium-treated virus-induced gene cloning", respectively, and were subjected to electric shock transformation into Agrobacterium GV3101 (available from Beijing full-scale gold biotechnology Co., ltd.) to obtain recombinant bacteria pYL-GhTOPP 4/GV3101, recombinant bacteria pYL-156-GFP/GV 3101, recombinant bacteria pTRV1/GV3101 and recombinant bacteria pYL-GhCLA 1/GVCA 3101, respectively. Culturing in LB liquid medium (containing 50. Mu.g/mL kanamycin, 25. Mu.g/mL gentamicin, 10mM MES pH5.6-5.7, 20. Mu.M acetosyringone) at 28deg.C for 12-14h, and collecting the cells.

2. With a solution of VIGS (10 mM MES pH5.6, 10mM MgCl) ₂ 200 mu M acetosyringone, water as solvent) were used to individually re-suspend the bacterial cells and the bacterial liquid concentration was adjusted to OD _600nm =1.5, and then the recombinant pYL-GhTOPP 4/GV3101 bacterial solution, pYL-GFP/GV 3101 bacterial solution and pYL-GhCLA 1/GV3101 bacterial solution were mixed with the recombinant pTRV1/GV3101 bacterial solution in a ratio of 1:1, respectively, to obtain a mixed solution 1, a mixed solution 2 and a mixed solution 3.

3. Mix 1 was filled with the lower surface of different cotton "Guoxin 3" cotyledons using a 1mL needleless syringe to obtain VIGS-GhTOPP4 silenced plants (VIGS-TOPP 4).

Mix 2 was filled with the lower surface of different cotton "Guoxin 3" cotyledons using a 1mL needleless syringe to obtain VIGS-GFP control plants (VIGS-Ctrl).

The mixture 3 was filled with the lower surfaces of different cotton "Guoxin 3" cotyledons using a 1mL needleless syringe to obtain VIGS-GhCLA1 indicator plants.

4. After the albino phenotype of the plants injected with the mixture 3 appeared for about two weeks, leaf site RNAs were extracted (cotton RNA was extracted using the Edley kit, which was operated according to the kit instructions) and cDNA was obtained by reverse transcription (M-MLV reverse transcription kit, available from Promega company, which was operated according to the kit instructions) on the plants injected with the mixture 1 and the mixture 2, respectively. Gene silencing efficacy was analyzed by fluorescent real-time quantitative PCR using the obtained cDNA as a template (analytical Methods reference "Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-. DELTA.CT method.Kenneth J.Livak et al Methods, 2001"). Primer pairs for fluorescent real-time quantitative PCR were used for the procedures 5'-TGTGGAGGATGGTTACGAA-3' and 5'-CTCTGCTGGCTTGAGAATC-3', PCR as follows: denaturation at 94℃for 30s; denaturation at 94℃for 5s, annealing at 60℃for 35s, 40 cycles. The cotton GhACin 9 gene was used as a control (primer pair for identifying cotton GhACin 9 gene: 5'-GCCTTGGACTATGAGCAGGA-3' and 5'-AAGAGATGGCTGGAAGAGGA-3'), and the relative expression level was 2 ^-ΔΔCt And (5) calculating a method.

The results showed that the GhTOPP4 gene expression level was significantly lower in the plants injected with mixture 1 (containing pYL-GhTOPP 4/GV3101 and pTRV1/GV 3101) than in the plants injected with mixture 2 (containing pYL-GFP/GV 3101 and pTRV1/GV 3101) (FIG. 4B). VIGS-GhTOPP4 silencing plants (plants injected with mixture 1) and VIGS-GFP control plants (plants injected with mixture 2) were obtained by the above method. The GhTOPP4 gene silencing efficiency in the VIGS-GhTOPP4 silencing plants was 75%.

3. Salt-resistant phenotype of VIGS-GhTOPP 4-silenced plants

The VIGS-GhTOPP4 silenced plant (TOPP 4), VIGS-GFP control plant (Ctrl) and wild-type plant (national element number 3) of the silenced GhTOPP4 gene obtained in step two were subjected to NaCl stress treatment. The method comprises the following specific steps: when the plant grows to the two-leaf stage under the water culture condition, the improved Hoagland nutrient solution (macroelement component: 20 mu M H) ₃ BO ₃ ，1μM ZnSO ₄ ·7H ₂ O，0.1μM CuSO ₄ ·5H ₂ O，1μM MnSO ₄ ·H ₂ O，5nM(NH ₄ ) ₆ Mo ₇ O ₂₄ The method comprises the steps of carrying out a first treatment on the surface of the Trace element component 0.1mM EDTA-FeNa, 2.5mM Ca (NO) ₃ ) ₂ ·4H ₂ O，0.5mM NH ₄ H ₂ PO ₄ ，1mM MgSO ₄ ·7H ₂ O，2.5mM KNO ₃ ) NaCl was added to a final concentration of 200mM and allowed to dissolve sufficiently, and the phenotype of the plants was observed 10 days after the treatment, while the control group was treated without NaCl.

The results show that in the experimental group treated with 200mM NaCl stress, compared with the VIGS-GFP control plants, the growth of the VIGS-GhTOPP4 silencing plants is less inhibited, the number of leaves is more, and the salt damage characteristics such as wilting and curling at the leaf edges are lighter and more tolerant to salt stress. In the control group without NaCl treatment, there was no difference in the growth characteristics between the VIGS-GhTOPP 4-silenced plants and the VIGS-GFP control plants (FIG. 4C). The phenotype of the wild type plant ("Guoxin No. 3") was not significantly different from that of the VIGS-GFP control plant.

4. Drought resistant phenotype of VIGS-GhTOPP 4-silenced plants

1. And (3) carrying out drought stress treatment on the VIGS-GhTOPP4 silencing plant (GhTOPP 4), the VIGS-GFP control plant (Ctrl) and the wild plant (Guoxin No. 3) of the GhTOPP4 gene obtained in the step two. The method comprises the following specific steps: and stopping watering when the plants grow to a two-leaf period under the soil culture condition, observing the phenotype of the plants and counting the water loss rate. And normal watering culture is used as a control group.

The results show that cotton plants show phenotypes such as growth resistance, leaf wilting and the like after drought treatment for one week. Wherein the VIGS-GFP control plants developed leaf wilting phenotype earlier and the degree of wilting was more pronounced than VIGS-GhTOPP4 silenced plants (fig. 4D). The phenotype of the wild type plant ("Guoxin No. 3") was not significantly different from that of the VIGS-GFP control plant.

2. And (3) carrying out in vitro drought treatment on the VIGS-GhTOPP4 silencing plant (GhTOPP 4), the VIGS-GFP control plant (Ctrl) and the wild plant (Guoxin No. 3) of the GhTOPP4 gene obtained in the step two. The method comprises the following specific steps: and taking the overground part of the plant, placing the overground part of the plant under the conditions of normal growth temperature and illumination of cotton plants, weighing fresh weight of the plant at different time points, and detecting the change of the water loss rate.

The results showed a reduced rate of water loss in VIGS-GhTOPP 4-silenced plants compared to VIGS-GFP control plants (fig. 4E). The water loss rate of wild type plants ("Guoxin No. 3") was not significantly different from that of VIGS-GFP control plants.

5. Expression level variation of GhTOPP4 gene under abiotic stress condition

Cotton plants grown to the trefoil stage under normal growth conditions ("Guoxin 3") were divided into three groups, 10 plants of each group were treated with 150mM NaCl and 5% PEG, respectively, leaf site RNAs at different time points (0 h, 6h, 12h, 24h, 48 h) were extracted and reverse transcribed into cDNAs, and GhTOPP4 gene expression levels were detected by fluorescent real-time quantitative PCR. Primer pairs for fluorescent real-time quantitative PCR were used for the procedures 5'-TGTGGAGGATGGTTACGAA-3' and 5'-CTCTGCTGGCTTGAGAATC-3', PCR as follows: denaturation at 94℃for 30s; denaturation at 94℃for 5s, annealing at 60℃for 35s, 40 cycles. The cotton Actin9 gene is used as a control (primer pairs for identifying the cotton Actin9 gene are 5'-GCCTTGGACTATGAGCAGGA-3' and 5'-AAGAGATGGCTGGAAGAGGA-3'), and the relative expression quantity is 2 ^-ΔΔCt And (5) calculating a method.

The results showed that each stress condition (150 mM NaCl,5% PEG treatment) induced an up-regulation of GhTOPP4 expression (FIG. 5).

By combining the test results, the expression quantity of the GhTOPP4 gene is obviously reduced by utilizing a VIGS gene silencing technology in cotton, and a VIGS-GhTOPP4 silencing plant is obtained, wherein the GhTOPP4 gene silencing efficiency reaches 75%. In the salt stress treatment test, compared with a VIGS-GFP control plant, the VIGS-GhTOPP4 silent plant is less in growth inhibition, and salt damage characteristics such as wilting, salt spots and the like are lighter and more tolerant to salt stress; in drought stress treatment experiments, VIGS-GhTOPP4 silenced plants were more tolerant compared to VIGS-GFP control plants, and the rate of water loss of in vitro plants was slowed down compared to controls; and the expression of GhTOPP4 can be induced by NaCl or PEG stress treatment, which shows that the GhTOPP4 gene plays a negative regulation role in abiotic stress such as cotton salt stress, drought stress and the like.

Example 4 construction of GhTOPP4 overexpressing plants and stress tolerance analysis thereof

1. Construction of GhTOPP4 overexpressing plants

1. The GhTOPP4-GFP recombinant vector and the pMDC32-HA vector (obtained from Libo Shan laboratories, texas university, described in the literature "A trimeric CrRLK1L-LLG1 complex genetically modulates SUMM-mediated autoimmunity. Yanylan Huang et al Nature Communication, 2020") were digested respectively to obtain the GhTOPP4 fragment and the pMDC32-HA linearized vector using restriction enzymes BamHI and StuI, and the digested products were recovered. Then, the T4 ligase is used for connection to obtain a 35 S:GhTOPP 4-HA recombinant vector (the structure schematic diagram of the recombinant vector is shown in figure 6A). The recombinant vector 35S:: ghTOPP4-HA is introduced into the agrobacterium strain GV3101 to obtain recombinant agrobacterium 35S:: ghTOPP4-HA/GV3101.

2. The recombinant Agrobacterium 35S obtained in step 1, ghTOPP4-HA/GV3101 was shake cultured in LB liquid medium containing 50. Mu.g/mL kanamycin and 25. Mu.g/mL gentamicin at 28℃for 24h, centrifuged at 4000rpm for 10min, and recombinant Agrobacterium cells were collected. Resuspension with heavy suspension (heavy suspension: 50mM MES pH 5.6,5% sucrose) and adjust the concentration of the heavy suspension to OD _600nm =0.8, then silwet L-77 was added to give a final concentration of 500 μl/L. Dipping the bacterial suspension in wet arabidopsis Col-0 inflorescences without white exposure, wrapping arabidopsis with black plastic bags to maintain humidity, keeping flat, dark culturing at 20deg.C for 24 hr, removing plastic bags, recovering illumination, culturing plants to be firm by conventional method, and harvesting mature T ₀ Seed generation.

3. Culturing T with 1/2MS medium containing 50mg/L hygromycin ₀ Seeds were replaced and positive plants were selected from (positive plants were shown as true She Jiankang dark green with roots extending into the medium).

4. Selfing the positive plant obtained in the step 3 to obtain T ₁ Seed generation.

5. Culturing T with 1/2MS medium containing 25mg/L hygromycin ₁ Seeds were replaced and positive plants were selected from (screening criteria were positive plant ratio greater than 3:1).

6. Selfing the positive plant obtained in the step 5 to obtain T ₂ Seed generation.

7. Culturing T with 1/2MS medium containing 25mg/L hygromycin ₂ Seeds were replaced and positive plants were selected from (the screening criteria were that the lines were all positive plants).

8. Selfing the positive plant obtained in the step 7 to obtain T ₃ Seed generation. Cultivation T ₃ Seed substitution to obtain T ₃ And replacing GhTOPP4 Arabidopsis plants.

9. For T ₃ Total protein is extracted from the transgenic GhTOPP4 Arabidopsis plant, and molecular identification is carried out by using Western Blot (FIG. 6B), so as to obtain the transgenic homozygous line of GhTOPP4 overexpression. The method comprises the following specific steps:

1) And taking leaf samples by using a puncher when plants grow to the fourth week, grinding leaf tissues by using liquid nitrogen, adding an SDS plant total protein extracting solution (250 mM Tris-HCl pH 6.8,4% SDS,40% glycerol, 0.1% bromophenol blue and 4% beta-mercaptoethanol), uniformly mixing, denaturing for 10 minutes at a temperature above 95 ℃, centrifuging, and taking supernatant to obtain denatured total protein, and performing SDS-PAGE detection.

2) The electrophoresis apparatus was set up with a 10% SDS-PAGE gel, the electrophoresis solution was poured, a protein sample and a pre-dye marker were added, and constant pressure electrophoresis separation was performed at a set voltage of 90-120V (SDS-PAGE gel was purchased from BIO-RAD, using an instrument from Bio-Rad Mini-PROTEAN) ^R Tetra System, prefabricated markers were purchased from Thermo Fisher,10 XTris-glycine running buffer: 30.3g/L Tris base,144g/L glycine, 10g/L SDS, diluted to 1 Xusing distilled water before use, and stopping electrophoresis when the dye line is 1-2cm from the bottom of the gel.

3) Taking down SDS-PAGE gel, soaking in a transfer buffer (2.9 g/L glycine, 5.8g/L Tris base,0.37g/L SDS,20% methanol) for balancing for 10min, cutting the PVDF membrane to a proper size, soaking in methanol for 10-15s, transferring into the transfer buffer for balancing for 20-30 min, fully soaking the transfer membrane in the transfer buffer by using filter paper, and placing the transfer membrane on a transfer membrane instrument (BIO-RAD TRANS-BLOTSD SEMI-DRY TRANSFER CELL) from the positive electrode to the negative electrode in the order of filter paper, PVDF membrane, SDS-PAGE gel and filter paper, and performing constant flow membrane for 1h at 60 mA.

4) After completion of transfer, PVDF membranes were placed in TBST solutions of 2% (m/v) BSA or 3-5% skim milk powder (10×tbs solution: 80g/L NaCl,30g/L Tris-base,2g/L KCL, adjusting the pH to 7.5, diluting to 1X with distilled water when in use, adding Tween 20 according to the ratio of 1:500-1:1000, namely TBST solution), and sealing for 1-2h.

5) According to 1:1500 ratio antibody anti-HA (purchased from Sigma-Aldrich) was added to the blocking solution, hybridized overnight at 4℃and washed 3 times with TBST solution for 10min each time, developed after washing the membrane once with TBS solution (developer BIO-RAD Clarity ^TM Western ECL Substrate the imaging system is BIO-RAD Chemidoc ^TM XRS+)。

6) After development, PVDF membranes were immersed in ponceau staining solution (ponceau solution: 0.2% (w/v) ponceau, 3% (v/v) acetic acid), shaking for 2-5min or more, taking out, rinsing with distilled water for 2-3 times, and recording the result after clear bands appear.

Finally, the GhTOPP4 over-expression transgene homozygous strains OE1, OE2 and OE3 are selected for stress tolerance analysis.

2. Stress tolerance analysis of different GhTOPP4 over-expressed transgenic lines

1. And (3) performing stress treatment on the arabidopsis GhTOPP4 over-expression transgenic homozygous strain obtained in the step (A), and performing germination rate analysis 10 days after the stress treatment. The method comprises the following specific steps: three independent GhTOPP4 over-expressed transgenic homozygous lines OE1, OE2, OE3 and wild type Arabidopsis thaliana (Col-0) seeds were grown in normal 1/2MS medium, 1/2MS medium containing 100mM NaCl and 1/2MS medium containing 0.5. Mu.M ABA, respectively, and were spring-treated at 4℃for 72 hours, then transferred into a 20℃greenhouse, and irradiated for 16h light/8 h dark at a light intensity of 60. Mu. Mol/M ² And/s, culturing for 10 days under the condition of 60-70% humidity, observing germination conditions, and counting the green-turning rate of cotyledons.

The results show that under the stress of 100mM NaCl, the seed germination conditions of the GhTOPP4 over-expression transgenic homozygous strain OE1 and the GhTOPP4 over-expression transgenic homozygous strain OE2 and the GhTOPP4 over-expression transgenic homozygous strain OE3 are worse than those of wild arabidopsis thaliana Col-0, and the cotyledon greening rate of the transgenic strain is obviously lower than that of the wild arabidopsis thaliana Col-0 (figure 6C). It is shown that the overexpression of GhTOPP4 protein in Arabidopsis weakens the tolerance of the plant to NaCl stress and inhibits the germination of seeds under salt stress. ABA promotes seed dormancy and inhibits germination, and under the condition of 0.5 mu M ABA, the green turning rate of cotyledons of the GhTOPP4 over-expression transgenic homozygous strain OE1 and the GhTOPP4 over-expression transgenic homozygous strain OE2 and the GhTOPP4 over-expression transgenic homozygous strain OE3 is obviously higher than that of Col-0 Arabidopsis (figure 6D). The over-expression of GhTOPP4 protein in Arabidopsis is proved to make the plant insensitive to ABA and the green turning rate of cotyledon is improved.

2. And (3) performing ABA stress treatment on the arabidopsis GhTOPP4 over-expression transgenic homozygous strain obtained in the step (A), and performing root growth analysis after the ABA stress treatment. The method comprises the following specific steps: three independent GhTOPP4 overexpressing transgenic homozygous lines OE1, OE2, OE3 and wild-type Arabidopsis thaliana (Col-0) seeds were vernalized at 4℃for 72 hours and then vertically cultured on normal 1/2MS medium under the following conditions: the temperature is 20 ℃, the illumination time is 16h light/8 h dark, and the light intensity is 60 mu mol/m ² And/s, the humidity is 60-70%. On day 5 of cultivation, plants with consistent root length were picked and transferred to 1/2MS medium containing 10. Mu.M ABA for continuous vertical cultivation, while plants with consistent root length were picked and transferred to 1/2MS medium for continuous vertical cultivation as control. Plant root length was counted on day 10 of culture.

The results showed that the root growth length of the GhTOPP4 overexpressing transgenic homozygous line and Col-0 Arabidopsis were not significantly different in the 1/2MS medium, whereas in the ABA-containing medium, the root growth of the GhTOPP4 overexpressing line was superior to that of the Col-0 Arabidopsis (FIGS. 6E and 6F). Inhibition of arabidopsis root growth by ABA treatment is alleviated in GhTOPP4 overexpressing plants, where GhTOPP4 may be involved in ABA signaling pathways, regulating plant salt and drought stress.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims

1. A protein represented by the following a) or b) or c) or d):

2. A biological material associated with the protein of claim 1, said biological material being any one of the following C1) -C10):

c1 A nucleic acid molecule encoding the protein of claim 1;

c2 An expression cassette comprising C1) said nucleic acid molecule;

c10 Protoplasts produced from the tissue culture of C9).

3. The biomaterial according to claim 2, characterized in that: c1 The nucleic acid molecule is a gene as shown in the following 1), 2) or 3):

1) The coding sequence is a DNA molecule shown as SEQ ID No. 2;

2) A cDNA molecule or a genomic DNA molecule having 75% or more identity to the nucleotide sequence defined in 1) and encoding the protein of claim 1;

3) A cDNA molecule or a genomic DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in 1) or 2) and which encodes the protein of claim 1.

4. Use of a protein according to claim 1 or a biomaterial according to claim 2 or 3 for regulating plant stress tolerance or for breeding transgenic plants or plant breeding with reduced stress tolerance.

Use of a substance as set forth in b1 or b2 for increasing stress tolerance in plants or for breeding transgenic plants with increased stress tolerance or plant breeding:

b1, substances which inhibit or reduce the activity and/or the content of the proteins according to claim 1 in plants;

b2, a substance which inhibits or reduces the expression of a gene encoding a protein according to claim 1 in plants or a substance which knocks out a gene encoding a protein according to claim 1 in plants.

6. A method of growing a transgenic plant with increased stress tolerance comprising the step of reducing the activity and/or content of the protein of claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant is stress tolerant higher than the recipient plant.

7. The method according to claim 6, wherein: the method of reducing the activity and/or amount of the protein of claim 1 in a recipient plant is achieved by knocking out or inhibiting or silencing a gene encoding the protein of claim 1 in the recipient plant.

8. A method of growing a transgenic plant with reduced stress tolerance comprising the step of increasing the content and/or activity of the protein of claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has a stress tolerance lower than the recipient plant.

9. The use according to claim 4 or 5 or the method according to any one of claims 6-8, characterized in that: the stress tolerance is salt tolerance and/or drought tolerance and/or ABA stress tolerance;

or, the plant is a monocot or dicot;

or, the dicotyledonous plant is Arabidopsis thaliana or cotton.

10. The substance as set forth in claim 6.