CN116063431B

CN116063431B - Plant insect-resistant protein and application thereof

Info

Publication number: CN116063431B
Application number: CN202211147709.5A
Authority: CN
Inventors: 李晓娇; 马小伟; 贾志伟; 邸萌亮; 梅方明; 杨蒙迪; 王建海
Original assignee: Longping Biotechnology Hainan Co ltd
Current assignee: Longping Biotechnology Hainan Co ltd
Priority date: 2022-09-19
Filing date: 2022-09-19
Publication date: 2023-11-10
Anticipated expiration: 2042-09-19
Also published as: CN116063431A

Abstract

The application discloses a plant insect-resistant protein, the amino acid sequence of which is shown as SEQ ID NO. 1. The application is modified byCry1B.868‑Dv1Insecticidal proteins expressed by the genes relative toCry1B.868The Cry1B.868-Dv1 insecticidal protein has better insecticidal effect, particularly has higher expression quantity and stability in corn, and has good resistance to spodoptera frugiperda.

Description

Plant insect-resistant protein and application thereof

Technical Field

The application relates to the technical field of biological control of genetic engineering, in particular to a plant insect-resistant protein and application thereof.

Background

At present, biotic stress (such as diseases, insect pests and the like) and abiotic stress (such as drought damage, cold damage, salt damage and the like) facing agricultural production cause weakening of crop growth vigor, reduce yield and pose a great threat to global grain safety. Among these, insect pests are one of the major biotic stress factors affecting agriculture and forestry productivity. As environmental problems caused by pest control using chemical pesticides become more serious, the use of biopesticides is gradually coming into the field of view of people.

Bacillus thuringiensis @Bacillus thuringiensisBt) is a gram-positive bacterium capable of producing different types of insecticidal proteins, such as insecticidal crystal proteins (Insecticidal crystal proteins, ICPs) and vegetative insecticidal proteins (Vegetativeinsecticidal proteins, vips). Among these, cry proteins are a class of insecticidal crystal proteins that form in spores during the period of spore formation, and have good resistance to most lepidopteran pests.

Proved in Chinese patent CN201980049875.1Cry1B.868AndCry1Da_7the co-expression of the genes may exhibit resistance to lepidopteran pests fall armyworm, corn earworm, southwest corn borer, and sugarcane borer. In 2019, wang et al have studied to find that the Cry1B.868 protein has significant insecticidal activity against Spodoptera frugiperda, but does not reach high resistance (Wang et al Bacillus thuringiensis Cry Da_7 and Cry1B.868 Protein Interactions with NovelReceptors Allow Control of Resistant Fall Armyworms, spodoptera frugiperda (J.E. Smith)). At present, no pair is seenCry1B.868Genes were engineered to increase relevant reports of resistance to target pests. Therefore, in order to make the gene have stronger insect-resistant effect, reasonable modification is needed to be carried out on the gene, and the resistance to lepidoptera pests is further improved.

Disclosure of Invention

The application provides a plant insect-resistant protein, the amino acid sequence of which is shown as SEQ ID NO. 1.

The application also provides a plant insect-resistant gene for encoding the plant insect-resistant protein, and the nucleotide sequence of the insect-resistant gene is shown as SEQ ID NO. 2.

The application also provides a recombinant expression vector, which comprises the insect-resistant gene.

Specifically, the recombinant expression vector sequentially comprises the following components: a promoter from a maize ubiquitin gene, the insect-resistant gene of claim 2, a terminator for nopaline synthase, a promoter from a maize ubiquitin gene, a gene encoding phosphinothricin acetyl transferase; terminator from cauliflower mosaic virus.

The application also provides application of the plant insect-resistant protein, the plant insect-resistant gene or the recombinant expression vector, wherein the application is to culture transgenic plants with lepidoptera pest resistance; or preparing a medicament for inhibiting or killing lepidopteran pests.

In particular, the lepidopteran pest is spodoptera frugiperda.

The plant is selected from monocotyledonous or dicotyledonous plants, preferably, the plant is maize.

The application also provides a method for inhibiting or killing spodoptera frugiperda, which adopts the plant insect-resistant protein to feed spodoptera frugiperda; or the plant insect-resistant gene is introduced into the plant, so that spodoptera frugiperda can eat the plant, and the aim of inhibiting or killing spodoptera frugiperda can be achieved.

The beneficial effects of the application include: the application is modified byCry1B.868-Dv1Insecticidal proteins expressed by the genes relative toCry1B.868The Cry1B.868-Dv1 insecticidal protein has better insecticidal effect, particularly has higher expression quantity and stability in corn, and has good resistance to spodoptera frugiperda.

Drawings

FIG. 1 is a construction flow of a recombinant cloning vector LP13-T of the present application;

FIG. 2 is a construction flow of the recombinant expression vector LP-PT13 of the present application;

FIG. 3 shows a transfer according to the present applicationCry1B.868-Dv1Leaf damage of genetic corn plant inoculated spodoptera frugiperdaThe figure, where CK is the wild-type plant, NGM is the maize plant that was non-transgenic as detected by PCR,Cry1B.868dv1 is a transgenic maize plant.

Detailed Description

The present application is further illustrated and described below with reference to the following examples, which are but some, but not all, examples of the application. All other applications and embodiments, based on this application and described herein, which would be apparent to one of ordinary skill in the art without undue burden are within the scope of this application.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Example 1,Cry1B.868-Dv1Gene acquisition and Synthesis

1. Obtaining Cry1B.868-Dv1 nucleotide sequence

The pair of the applicationCry1B.868The gene is modified to obtainCry1B.868-Dv1The amino acid sequence (659 amino acids) of the gene Cry1B.868-Dv1 insecticidal protein is shown as SEQ ID NO. 1 in a sequence table; and a Cry1B.868-Dv1 nucleotide sequence (1980 nucleotides) which codes for an amino acid sequence corresponding to said Cry1B.868-Dv1 insecticidal protein, as shown in SEQ ID NO. 2 of the sequence Listing.

2. Synthesis of the Cry1B.868-Dv1 nucleotide sequence

The Cry1B.868-Dv1 nucleotide sequence (shown as SEQ ID NO:2 in the sequence Listing) is synthesized by Nanjing Jinsri biotechnology company; the 5 'end of the synthesized Cry1B.868-Dv1 nucleotide sequence (SEQ ID NO: 2) is connected with an NcoI enzyme cutting site, and the 3' end is connected with an EcoRI enzyme cutting site.

Example 2 vector construction

1. Construction of cloning vectors

The nucleotide sequence of Cry1B.868-Dv1 synthesized in example 1 was ligated into cloning vector pEASY-T5 (Transgen, beijing, china, CAT: CT 501-01), and the procedure was carried out according to the specification of the vector pEASY-T5 from the company of Transgen, to obtain recombinant cloning vector LP13-T, the construction flow of which is shown in FIG. 1, wherein Kan represents kanamycin resistance gene; amp represents an ampicillin resistance gene; pUC origin represents the replication sequence of plasmid pUC, which can guide the double-stranded DNA replication process; lacZ is LacZ initiation codon; cry1B.868-Dv1 is the nucleotide sequence of Cry1B.868-Dv1 (SEQ ID NO: 2)).

The recombinant cloning vector LP13-T was then transformed into E.coli T1 competent cells by heat shock (Transgen, beijing, china; cat. No. CD 501). The conversion process is as follows: 50. mu.l of E.coli T1 competent cells and 10. Mu.l of plasmid DNA (recombinant cloning vector LP 13-T) were mixed, then subjected to a water bath at 42℃for 30 s and 37℃for 45 min, after transformation, shaken on a 200 rpm shaker for 1 h, then spread on LB plates (tryptone 10 g/L, yeast extract 5 g/L, naCl 10 g/L, agar 15 g/L, pH adjusted to 7.5) containing ampicillin (100 mg/L) and grown overnight with NaOH. White colonies were picked and cultured overnight on a shaker in LB liquid medium (tryptone 10 g/L, yeast extract 5 g/L, naCl 10 g/L, ampicillin 100 mg/L, pH adjusted to 7.5 with NaOH) at 37 ℃. The plasmid is extracted by an alkaline method, and the specific steps are as follows: the bacterial solution was centrifuged at 12000 rpm for 1 min, the supernatant was discarded, and the precipitated bacterial cells were suspended with 100. Mu.l of solution I (25 mM Tris-HCl,10 mM EDTA (ethylenediamine tetraacetic acid), 50 mM glucose, pH adjusted to 8.0) pre-chilled with ice; 150 μl of freshly prepared solution II (0.2M NaOH,1% SDS (sodium dodecyl sulfate)) was added, the centrifuge tube was inverted 4 times up and down, mixed, and placed on ice for 3-5 min; adding 150 μl ice-cold solution III (4M potassium acetate, 2M acetic acid), immediately mixing, and standing on ice for 5-10 min; centrifuging at 4deg.C and 12000 rpm for 5 min, adding 2 times volume of absolute ethanol into the supernatant, mixing, and standing at room temperature for 5 min; centrifuging at 4deg.C and 12000 rpm for 5 min, removing supernatant, washing the precipitate with 70% ethanol, and air drying; mu.l of TE (10 mM Tris-HCl,1 mM EDTA,PH adjusted to 8.0) containing RNase (20. Mu.g/ml) was added to dissolve the precipitate; 37. digesting RNA in water bath at the temperature of 30 min; finally, the mixture is stored in a refrigerator at the temperature of minus 20 ℃ for standby.

After the extracted plasmid is subjected to NcoI and EcoRI digestion identification, the positive clone is subjected to sequencing verification, and the result shows that the nucleotide sequence of Cry1B.868-Dv1 inserted in the recombinant cloning vector LP13-T is the nucleotide sequence shown in SEQ ID NO. 2 in the sequence table, namely, the nucleotide sequence of Cry1B.868-Dv1 is correctly inserted.

2. Construction of the inclusionCry1B.868-Dv1Recombinant expression vector for gene

The recombinant cloning vector LP13-T and the expression vector LP-BB1 (vector backbone: pCAMBIA3301 (supplied by CAMBIA mechanism)) were digested with restriction enzymes NcoI and EcoRI, respectively, and the cut-out Cry1B.868-Dv1 nucleotide sequence fragment was inserted between the NcoI and EcoRI sites of the expression vector LP-BB1, and the construction procedure for constructing the recombinant expression vector LP-PT13 by conventional digestion methods was as shown in FIG. 2 (Kan: kanamycin gene; RB: right border; ubiquit: maize Ubiquitin gene promoter (SEQ ID NO: 5); cry1B.868-Dv1: cry1B.868-Dv1 nucleotide sequence (SEQ ID NO: 2)), the terminator of the Nos: nopaline synthase (SEQ ID NO: 3), ubiquitin (SEQ ID NO: 5); the gene promoter encoding phosphinothricin acetyl transferase gene (LB: 4: caubiquitin) and the gene promoter (SEQ ID NO: 35: caubiquitin) from the left border of Caubiquitin (SEQ ID NO: 6).

The recombinant expression vector LP-PT13 is transformed into competent cells of the escherichia coli T1 by a heat shock method. The conversion process is as follows: 50. mu.l of E.coli T1 competent cells and 10. Mu.l of plasmid DNA (recombinant expression vector LP-PT 13) were mixed, then subjected to a water bath at 42℃for 30 s and a water bath at 37℃for 45 min, after transformation, shaken on a shaker at 200 rpm for 1 h, and then spread on LB plates (tryptone 10 g/L, yeast extract 5 g/L, naCl 10 g/L, agar 15 g/L, pH adjusted to 7.5) containing ampicillin (100 mg/L) and grown overnight with NaOH. White colonies were picked and grown overnight on a shaker at 37℃in LB liquid medium (tryptone 10 g/L, yeast extract 5 g/L, naCl 10 g/L, kanamycin 50 mg/L, pH adjusted to 7.5 with NaOH). Extracting the plasmid by alkali method, and extracting method is the same as above. The extracted plasmid is identified after restriction enzyme NcoI and EcoRI are used for enzyme digestion, and positive clone is sequenced, so that the result shows that the nucleotide sequence of the recombinant expression vector LP-PT13 between the NcoI site and the EcoRI site is the nucleotide sequence shown in SEQ ID NO. 2 in a sequence table, namely the nucleotide sequence Cry1B.868-Dv 1.

Example 3 recombinant expression vector transformation of Agrobacterium and detection

Recombinant expression vector for transforming agrobacterium

The recombinant expression vector LP-PT13 which has been constructed correctly is transformed into Agrobacterium LBA4404 (Invitrogen, chicago, USA; cat. No. 18313-015) by liquid nitrogen method under the following transformation conditions: 100. mu.L of Agrobacterium LBA4404 and 3. Mu.L of plasmid DNA (recombinant expression vector) were frozen in liquid nitrogen for 10 min, and water-bath at 37℃for 10 min; the transformed agrobacterium LBA4404 is inoculated in a centrifuge tube filled with LB liquid culture medium, cultured on a shaking table at 28 ℃ and 200 rpm for 2 h, coated on LB solid culture medium containing 50 mg/L Rifampicin (Rifampicin) and 50 mg/L Kanamycin (Kanamycin) until positive monoclonal is grown, the monoclonal culture is selected and plasmids thereof are extracted, restriction enzymes NotI and SalI are used for enzyme digestion of the recombinant expression vector LP-PT13, and the result shows that the structure of the recombinant expression vector LP-PT13 is completely correct.

The specific steps of the transformation are as follows:

1. preparation of maize young embryo

Corn inbred line AX808 was planted in a field or greenhouse, and 8-10 days (summer)/10-13 days (autumn) of corn after artificial pollination was taken as the source of young embryos.

2. Preparation of Agrobacterium

(1) Streaking transformed and identified agrobacterium glycerinogenes on a YEP solid medium containing 100 mg/L kan and 12 mg/L tet, and performing dark culture at 28 ℃ for 2-3 days;

(2) Adding 1 ml of infection culture medium into a sterilized 2 ml centrifuge tube, putting the agrobacterium of the step 1 into the infection culture medium, and fully blowing and uniformly mixing by using a pipetting gun;

(3) Another sterilized 2 ml centrifuge tube was used to adjust the bacterial concentration with the infection medium to an OD 660 of 0.5-0.7.

3. Co-culture of maize young embryo and agrobacterium

(1) Removing the infection culture medium in the centrifuge tube for filling the young embryo, and adding 1.5. 1.5 ml fresh infection culture medium to clean the embryo once;

(2) Removing the infection culture medium, and adding the prepared agrobacterium tumefaciens bacteria solution;

(3) Placing in a shaking table at maximum rotation speed for shaking 30 s, and placing at room temperature for 5 min;

(4) Pouring the embryo onto a co-culture medium, and sucking the liquid;

(5) Placing the embryo with the plane upward and the shield downward;

(6) The embryos are dark cultured for 2-3 days at 22 ℃.

4. Callus induction and screening

(1) Transferring the co-cultured embryo onto an induction callus culture medium, and performing dark culture in a 28 ℃ incubator for 7-10 days;

(2) Transferring the induced callus to a screening culture medium for screening culture, wherein the screening pressure is 5.0 mM glyphosate, and the callus is subjected to dark culture at 28 ℃ for 2-3 weeks;

(3) The surviving calli from the first screening were taken for the second screening, with a screening pressure of 2.0 mM glyphosate.

5. Regeneration and cultivation of transformant lines

(1) Placing the embryogenic callus which grows out after screening on a pre-differentiation culture medium, and culturing in dark at 28 ℃ for 10-14 days;

(2) Taking embryogenic callus onto a differentiation medium, and culturing at 28 ℃ for 10-14 days until seedlings are differentiated;

(3) Transferring the differentiated seedlings to a rooting culture medium, and performing light culture at 28 ℃ until the roots are completely developed;

(4) Transplanting the seedlings with good growth vigor into a greenhouse matrix for growth.

And (5) seed collection is carried out after the transgenic plants bloom and fruit. Sowing the harvested seeds in a greenhouse, and carrying out expression analysis and detection by adopting a PCR technology when the plants grow to 4-6 leaf periods.

Detection of transgenic maize

1. Transfer was verified by conventional PCR using the full gold company 2X EasyTaq PCR SuperMix (China, beijin, cat: AS 111-11)Cry1B.868-Dv1Maize of geneAnd (5) a plant.

The primers used for PCR detection are:

primer 1 (CF 1): atccagcgttactacgagcg (SEQ ID NO: 7)

Primer 2 (CR 1): ggatgttaatgcccgcgaac (SEQ ID NO: 8)

Fragment size: 580 bp

Conditions of PCR reaction: 95. 30 times at 30 deg.C s, 58 deg.C 30 s, 72 deg.C 40 s.

2. Transfer was verified by qRT-PCRCry1B.868-Dv1Maize plants of the genes

Detection ofCry1B.868-Dv1The specific method for gene copy number is as follows:

(1) Respectively taking 100 mg leaves of a corn plant and a wild corn plant which are transferred with Cry1B.868-Dv1 nucleotide sequences, grinding the corn plant and the wild corn plant into homogenates in a mortar by liquid nitrogen, and taking 3 repeats of each sample;

(2) Genomic DNA of the above samples was extracted using EasyPure Plant Genomic DNA Kit (RNase A-containing) (Transgen, beijing, china, cat: EE 111-01) and the specific method was referred to the product specifications;

(3) The genomic DNA concentration of the above samples was determined using a NanoDrop 2000 (Thermo Scientific, USA);

(4) Adjusting the concentration of the genomic DNA of the sample to the same concentration value, wherein the concentration value ranges from 80 to 100 ng/. Mu.l;

(5) The copy number of the sample is identified by using a TransStart Green fluorescence quantitative PCR method, and the sample with the identified known copy number is used as a standard substance. Samples of wild-type maize plants were also used as controls, 3 replicates per sample, and their average was taken.

The following primers were used to detect Cry1B.868-Dv1 nucleotide sequences:

primer 3 (CF 2): gctacagggcctgggaaac (SEQ ID NO: 9);

primer 4 (CR 2): gtcatccctgttctccaacca (SEQ ID NO: 10);

probe 1 (CP 1): cctttcgggcataccagcagtcactg (SEQ ID NO: 11).

The following primers were used to detect the 18S nucleotide sequence for internal control leveling.

Primer 5 (CF 3): ggatcagcgggtgttactaatagg (SEQ ID NO: 12);

primer 6 (CR 3): ccccggaacccaaagact (SEQ ID NO: 13);

probe 2 (CP 2): ccccgctggcaccttatgagaaatc (SEQ ID NO: 14).

The PCR reaction system is as follows:

2*TransStart Green qPCR SuperMix（Transgen） 10 μl

10. mu.M Forward primer 1. Mu.l

10. Mu M Reverse primer 1. Mu.l

Passive Reference Dye I (50X) 0.4 μl

2 μl of genomic DNA

Water (ddH) ₂ O） 5.6 μl

The PCR reaction conditions were:

step temperature time

1 95 ℃ 5 min

2 95 ℃ 30 s

3 60 ℃ 1 min

Repeating the steps 2-3 and 40 times.

The data were analyzed using SDS 2.3 software (Applied Biosystems).

Experimental results show that Cry1B.868-Dv1 nucleotide sequence is integrated into the detected corn plant chromosome set, and corn plants transformed with Cry1B.868-Dv1 nucleotide sequence all obtain corn plants containing single copyCry1B.868-Dv1Transgenic maize plants of the gene.

Example 4 insecticidal protein detection of transgenic maize plants

1. Insecticidal protein content detection of transgenic corn plants

The solutions involved in this experiment were as follows:

extraction buffer: 8 g/L NaCl,0.2 g/L KH ₂ PO ₄ ，2.9 g/L Na ₂ HPO ₄ •12H ₂ O, 0.2. 0.2 g/L KCl, 5.5. 5.5 ml/L Tween 20 (Tween-20), pH 7.4;

wash buffer PBST:8 g/L NaCl,0.2 g/L KH ₂ PO ₄ ，2.9 g/L Na ₂ HPO ₄ •12H ₂ O, 0.2. 0.2 g/L KCl, 0.5. 0.5 ml/L Tween 20 (Tween-20), pH 7.4;

stop solution: 1M HCl.

Fresh leaves of a maize plant, 3 mg of which was turned into the Cry1B.868-Dv1 nucleotide sequence, were taken as samples, after liquid nitrogen milling, 800. Mu.l of the extraction buffer was added, centrifugation was carried out at 4000 rpm for 10 min, the supernatant was diluted 40-fold with the extraction buffer, and 80. Mu.l of the diluted supernatant was taken for ELISA detection. The proportion of the insecticidal protein (Cry1B.868-Dv 1 protein) in the sample to the fresh weight of the leaf blade is detected and analyzed by ELISA (enzyme-linked immunosorbent assay) kit (ENVIRLOGIX company), and the specific method is referred to the product instruction book.

Meanwhile, a corn transgenic line transferred with Cry1B.868 nucleotide sequence, a wild corn plant and a corn plant identified as non-transgenic by fluorescent quantitative PCR are used as controls, and detection and analysis are carried out according to the method. A total of 3 lines (S1, S2 and S3) into which Cry1B.868-Dv1 nucleotide sequences are transferred, a total of 1 line (S) into which Cry1B.868 nucleotide sequences are transferred, a total of 1 line (S) which is identified as non-transgenic (NGM) by fluorescent quantitative PCR, and a total of 1 line (S) of wild type (CK); 3 strains were selected from each strain for testing, each strain being repeated 6 times.

The results of the insecticidal protein (Cry1B.868-Dv 1 protein) content determination of transgenic maize plants are shown in Table 1. The average expression quantity of insecticidal protein (Cry1B.868-Dv 1 protein) in fresh leaves of corn plants transferred with Cry1B.868-Dv1 nucleotide sequences is measured to be 3212.93 in proportion (ng/g) of fresh weight of the leaves, and the result shows that the Cry1B.868-Dv1 protein has higher expression quantity and stability in corn.

TABLE 1 insecticidal protein expression level determination results in maize plants

Example 5 detection of the insect-repellent Effect of transgenic maize plants

Corn plants with Cry1B.868-Dv1 nucleotide sequences, corn transgenic lines with Cry1B.868 nucleotide sequences, wild corn plants and corn plants identified as non-transgenic by PCR are subjected to insect resistance effect detection on spodoptera frugiperda, and the specific steps are as follows:

the method comprises the steps of respectively taking fresh leaves of corn plants transferred with Cry1B.868-Dv1 nucleotide sequences, corn plants transferred with Cry1B.868 nucleotide sequences, wild corn plants and corn plants identified as non-transgenic by PCR (V3-V4 stage), washing the fresh leaves with sterile water, sucking the water on the leaves to dryness by using filter paper, removing veins, cutting the leaves into strips with the size of about 3 cm multiplied by 1 cm, putting 2 pieces of cut strip-shaped leaves on filter paper at the bottom of a circular plastic culture dish, wetting the filter paper by distilled water, inoculating 1 head of artificially raised spodoptera frugiperda (two-instar larvae) into each culture dish, repeating for 10 times, covering the insect test culture dishes, standing for 3 days under the conditions of temperature of 22-26 ℃ and relative humidity of 70% -80% and light cycle 16 h/8 h darkness, and counting the death rate. As shown in Table 2 and FIG. 3, the maize transgenic lines transformed with the Cry1B.868-Dv1 nucleotide sequence were more resistant to Spodoptera frugiperda than the maize transgenic lines transformed with the Cry1B.868 nucleotide sequence.

TABLE 2 corn in vitro leaf insect resistance bioassay results

Note that: 1 spodoptera frugiperda (two-year old) was artificially inoculated on each dish, 10 replicates and 10 heads in total. And (3) injection: data in the table are mean ± standard error; different lower case letters following the same row of numbers indicate significant differences (P < 0.05).

Claims

1. A plant insect-resistant protein is characterized in that the amino acid sequence of the protein is shown as SEQ ID NO. 1.

2. The plant insect-resistant gene is characterized in that the nucleotide sequence of the insect-resistant gene is shown as SEQ ID NO. 2.

3. A recombinant expression vector comprising the insect-resistant gene of claim 2.

4. A recombinant expression vector according to claim 3, characterized in that it comprises, in order, the following elements: a promoter from a maize ubiquitin gene, the insect-resistant gene of claim 2, a terminator for nopaline synthase, a promoter from a maize ubiquitin gene, a gene encoding phosphinothricin acetyl transferase; terminator from cauliflower mosaic virus.

5. Use of the plant pest-resistant protein of claim 1 or the plant pest-resistant gene of claim 2 or the recombinant expression vector of claims 3-4 for growing transgenic plants that are lepidopteran pest resistant; or preparing an agent for inhibiting or killing lepidoptera pests, wherein the lepidoptera pests are spodoptera frugiperda, and the plants are corn.

6. A method of inhibiting or killing spodoptera frugiperda, comprising feeding spodoptera frugiperda with the plant insect-resistant protein of claim 1; or introducing the plant insect-resistant gene of claim 2 into a plant, which is maize, so that spodoptera frugiperda ingests the plant.