CN109536511A - One cotton actin gene mutant and its application - Google Patents

Abstract

One cotton actin gene mutant and its application, belong to gene engineering technology field.The nucleotide sequence of mutant gene cDNA ORF is as shown in SEQ ID NO:1.The mode of appearance of gene mutation physical efficiency remodeling arabidopsis and cotton of the invention, and the transgenic plant obtained can normally yield positive results, transformed gene can stablize heredity to the next generation, therefore the gene can further apply to the plastotype of gardening ornamental plant, the different new varieties of posture are cultivated, is moulded for horticulture and flower kenel and another approach is provided；The bush type cultures such as crops, fruit tree can reduce unnecessary nutrient consumption, be conducive to output increased, convenient for harvesting and picking；The present invention provides theoretical foundation for the research of plant kenel and cytoskeleton regulation；Transgene cotton in the present invention will become the useful materials of PLANT CYTOSKELETON research.

Description

One cotton actin gene mutant and its application

Technical field

The invention belongs to gene engineering technology fields, and in particular to a cotton actin gene mutant and its answer With.

Background technique

Actin is a kind of single polypeptide chain globular protein, is made of 375-377 amino acid residue, and molecular weight is 42KD is the raw material of cytoskeleton building.Actin is present in all eucaryotes, and participates in Eukaryotic several All vital movements.Microfilament is the fibril aggregated by actin molecular spiral, i.e. actin filament, is cytoskeleton One of main component.Actin monomers (G-actin) have ATP-binding site, when two actin monomers all combine When ATP, mutually it polymerize since affinity increases；When ATP is hydrolyzed to ADP, affinity declines and mutual depolymerization between monomer. The assembling of microfilament and go assembling dynamic process and cytoplasm in matter transportation, cell migration, form occur and differentiation etc. it is more Kind cell movement is closely related.

In higher plant, actin gene (Actin) is to belong to multigene family gene.Actin gene and quilt Referred to as house-keeping gene, the conservative with height, can be used as reference gene.Currently, the Actin base of many higher plants Because being cloned and having studied.David is equal to the sequence for nineteen ninety separating and having parsed the Actin gene Racl of rice for the first time And its structure feature, rice Actin gene family is then reported again, it is determined that the structure of four rice actin genes, And the introne for disclosing rice Actin gene all has conservative in the sum number amount of position, but compares discovery plant Actin base Cause has the characteristics that in kind in sequence and inter-species high diversity.In addition, researches show that the transcriptional expression modes of this four genes Difference shows that the transcriptional control of these genes and cell function may be different.There are 10 members in the Actin family of arabidopsis, can It is divided into 6 evolutionary branchings, and there are 5 kinds of different expression patterns.ACT1, ACT3, ACT4, ACT11, ACT12 are gonotype flesh Filamentous actin, ACT2, ACT7, ACT8 are auxotype actins.ACT1 mainly mature pollen, the pollen tube extended, It is expressed in ovule, when its false demonstration in nutrition organs, plant can be made short and small and organ morphology changes；And ACT2 in addition to There is expression in all nutrition organs other than pollen.The Actin family of poplar includes 8 member genes, they are in maturation Xylem in expression quantity all obviously increase, thus it is speculated that its expression may be related with the formation of secondary tissue.There are also many high Plant such as pea, sunflower and peanut etc. are all cloned into Actin gene in succession, but in these plants Actin gene each The period expression of each organ is all more stable.In cotton, the Actin gene being cloned into has 15 (GhACT1- GhACT15), 9 branches can be divided into, research shows that GhACT1 has played important function in the development of cotton fiber.

In order to investigate effect of actin cytoskeleton during Fibre Development, Li et al. people in upland cotton to having found 15 Actin genes (GhACT) are cloned and have been studied.RNA trace and quantitative PCR are the results show that GhACT1 mainly exists It is expressed in fibrocyte.RNA interference GhACT1 gene, can significantly reduce its mRNA and protein level, and lead to the flesh in fiber Filamentous actin cytoskeleton network is corrupted such that cotton fiber elongation is slow, fiber filament is few and misaligned, this shows GhACT1 Important function has been played in elongate fiber.In addition, using comparative proteome method, by comparison Li1 mutant and accordingly The cytoskeleton related protein of wild type cotton, as the result is shown in the fiber of mutant Li1, the abundance of these albumen is wilder Type is remarkably decreased, and so as to cause the malformation of actin cytoskeleton, micro-pipe tissue is changed, and seriously destroys vesica fortune It is defeated.

In conclusion actin plays an important role to each organ morphology aspect of maintenance plant.

Summary of the invention

In view of the problems of the existing technology, prominent it is an object of the invention to design one cotton actin gene of offer Variant and its technical solution of application.

The cotton actin gene mutant GhACT17DM, it is characterised in that the gene mutation body with GhACT17D gene is compared, and the 194th base is mutated into T by G, the nucleotide sequence such as SEQ of mutant gene cDNA ORF Shown in ID NO:1.

The protein of the cotton actin gene mutant GhACT17DM translation, it is characterised in that the protein Compared with the protein of GhACT17D gene translation, the 65th amino acid is by glycine mutation at valine, the ammonia of the protein Base acid sequence is as shown in SEQ ID NO:2.

Application of the gene in arabidopsis or cotton plastotype are cultivated.

The present invention is based on bioinformatic analysis and existing Protocols in Molecular Biology, are mutated in upland cotton Li Shi superbhort fiber Body (Ligon lintless-1,Li1) newcomer for belonging to actin gene family is cloned into material, it is named as GhACT17.The mutant (GhACT17DM) of the gene can make the kenel of the plants such as arabidopsis and cotton show as distortion and it is short Change.

The beneficial effects of the present invention are: 1, GhACT17DM gene can remold the mode of appearance of arabidopsis and cotton, and obtain Transgenic plant can normally yield positive results, transformed gene can stablize heredity to the next generation, therefore the gene can be further The plastotype for applying to gardening ornamental plant cultivates the different new varieties of posture, moulds for horticulture and flower kenel and provides another Approach；2, the bush type cultures such as crops, fruit tree can reduce unnecessary nutrient consumption, be conducive to output increased, convenient for harvesting And picking.Therefore, GhACT17DM also provides new gene and approach for the cultivation of agricultural dwarfing fruit trees；3, the present invention is plant Kenel research and cytoskeleton regulation provide theoretical foundation；4, the transgene cotton in the present invention will be ground as PLANT CYTOSKELETON The useful materials studied carefully.

Detailed description of the invention

Fig. 1 is target gene PCR identification in positive transgenic arabidopsis；

Fig. 2 is transgenic arabidopsis phenotypic evaluation；

Fig. 3 is the gene relative expression quantity in all types of transgenic arabidopsis；

Fig. 4 is that southern blot verifies transgene cotton；

Fig. 5 is the phenotype of transgene cotton, N in figure: indicates the negative plant being separated in transgenosis heterozygote, character is the same as wild Type；

Fig. 6 a, 6b and 6c are gene expression dose in transgene cotton, N in figure: indicate the yin being separated in transgenosis heterozygote Property plant, the same wild type of character；4-2,4-3 and 4-5 carry out a group EM-4；10-2,10-4 and 10-5 carry out a group EM-10； 24-1, 24-3 and 24-4 carrys out a group EM-24.

Specific embodiment

Further illustrate the present invention with reference to the accompanying drawings and detailed description.

Embodiment 1:GhACT17DM gene cDNA obtains and plant expression vector construction

1) design of primers

It according to the reported cotton gene group sequence of NCBI, is compared, is determined by bioinformaticsGhACT17Gene DNA sequence Column, according to the primer of sequence design encoder block (ORF) full length sequence, the estimated size of ORF sequence is 1134 bp.Primer sequence It is as follows:

DHQ-ACT-F2:5'ATGGCAGAAAACGAAGACA 3'(is as shown in SEQ ID NO:3)；

DHQ-ACT-R2:5'CTAGAAGCATTTCCTGTGCA 3'(is as shown in SEQ ID NO:4).

2)Li1Twisted shape cotton leaf Total RNAs extraction

Take young leaflet tablet liquid feeding nitrogen to be ground to powdered, then using kit RNAprep pure Plant Kit (Tiangeng, China) extract blade total serum IgE.RNA concentration is detected through spectrophotometer and quality, concentration are about 500ng/ul, OD260/ OD280=2.0, OD260/OD230=2.0 can be used for testing in next step.The total serum IgE of extraction is immediately available for testing in next step, remaining Sample is saved in -80 degree.

3) the first chain of cDNA synthesizes

A) in 0.2 ml centrifuge tube, following reagent is added

In 65 DEG C of 10 min of water-bath, it is immediately placed on ice, rear dislocation cools down rapidly on ice.

B) it is sequentially added in centrifuge tube:

C) 3sec, 42 DEG C of 1 hr of incubation are centrifuged after reaction mixture mixes gently；

D) 75 DEG C of 15 min terminates reaction, is placed at once on ice.

4) cDNA is expanded

A) PCR amplification is carried out using high fidelity enzyme.PCR reaction system is as follows:

B) it is centrifuged 3sec after reaction mixture mixes gently, carries out PCR amplification, condition is as follows:

C) after reaction stops, 5 μ l PCR products are taken, 1.0% agarose gel electrophoresis detects amplification.

5) PCR product purifies

Using AxyPrep PCR cleaning agents box (Axygen), full name is operated by operation instructions, and recovery product concentration is 30ng/ul, clip size are about 1100 bp.

6) PCR product adds A tail

72 degree of extension 30min of the above mixed liquor.

7) cDNA segment connects plant over-express vector

CDNA is attached with the plant over-express vector pCXSN-CaMV35S through XcmI digestion and is reacted, i.e., in 0.2 ml Centrifuge tube in sequentially add following reagent:

3sec is centrifuged after mixing gently, 16 DEG C of connections are overnight.

8) recombinant plasmid transformed and identification

A) 50 μ L are takenE.coli the connection product of 5 μ L is added in competent cell, after mixing gently, stands 30 min on ice；

B) above-mentioned centrifuge tube is transferred to 60 s of thermal shock in 42 DEG C of waters bath with thermostatic control, sets 2 min on ice immediately；

C) LB liquid medium of 500 μ L is added；

D) 37 DEG C, 200 rpm, 1 hr of shaking table culture;

E) bacterium solution after taking 50 μ L to convert is spread evenly across the LB solid plate containing Kan (50 μ g/ml) in super quiet On, 16 hr are cultivated in 37 DEG C of inversions；

F) LB liquid medium that single spot contains Kan (50 μ g/ml) in 600 μ L is chosen, in 37 DEG C of shaking tables, 250 rpm, culture 6 hr；

G) bacterium solution PCR is identified.Carry out PCR amplification using cultured bacterium solution as template, positive list spot be added glycerol to after 15% in- 20 degree of preservations；

H) sequencing identification.Positive list spot send sequencing company sequencing identification, obtains accurateGhACT17DM ORF sequence, such as SEQ Shown in ID NO:1, protein sequence is translated as shown in SEQ ID NO:2, so far,GhACT17DMPlant expression vector PCaMV35S::GhACT17DM building is completed.Wild type is constructed simultaneouslyGhACT17Expression vector as negative control: pCaMV35S::GhACT17。

9) recombinant plasmid extracts

Positive plasmid is extracted using AxyPrep Plasmid DNA small volume of reagent box (Axygen), 1.0% agarose gel electrophoresis detects ,- 20 degree save backup, and plasmid concentration is about 200ng/ul.

10) recombinant plasmid transformed Agrobacterium

A) it takes 100 μ L GV3101 competent cells that the purpose carrier of 5 μ L (1ug) is added, after mixing gently, stands on ice 30 min；

B) liquid nitrogen is quickly cooled down 37 DEG C of water-bath 2min of transposition after 1min；

C) LB liquid medium of 250 μ L is added；

D) 28 DEG C, 150 rpm, shaking table culture 2hr;

E) whole bacterium solutions is taken to be spread evenly across the g/ml of μ containing Rif(25 in super quiet) and Kan (50 μ g/ml) LB solid On plate, in 28 DEG C of culture carton upside down cultures r for 24 hours；

F) single spot is chosen in LB culture medium of the 600 μ L containing Rif and Kan, and in 28 DEG C of shaking tables, 200 rpm cultivate 16 hr；

G) bacterium solution PCR is identified.Carry out PCR amplification using cultured bacterium solution as template, positive list spot be added glycerol to after 15% in- 80 degree of preservations.

Embodiment 2: the acquisition of transgenic arabidopsis

1) arabidopsis is planted

A) seed sows pre-treatment: take suitable arabidopsis seed to be placed in 1.5ml centrifuge tube, aseptic water washing 1 time, 70% Ethanol postincubation 90s, aseptic water washing 4 times, 2% sodium hypochlorite handles 10min, sterile water process 4 times；

B) it sows: drawing the arabidopsis seed handled well in right amount with pipette tips, directly in piping and druming to MS solid medium, then use nothing Seed drawout is sucked extra sterile water by bacterium water, with sealed membrane closed petridish；

C) vernalization: the culture dish sowed is placed 4 DEG C, after being protected from light vernalization 2-3 days, culture dish is placed in 16 h illumination, and 8 h are black Secretly, 22 DEG C, illumination mean intensity is cultivated under conditions of being 4,000 lx；

D) transplant seedlings: growing 4 true leaves to arabidopsis seed can transplant (about two weeks), and 4 seedling are transplanted in each small basin, small Soil in basin is Nutrition Soil: generic media=1:3, can be used to plant after being uniformly mixed sterilizing.

2) titbit infestation method arabidopsis thaliana transformation

A) arabidopsis plants one month or so beginning bolting, cuts off stem of blooming, and inhibits apical dominance, about one Zhou Yihou, weight Newly extract a large amount of side shoots out, at this time side shoot has a large amount of petals, one day before conversion, cuts off the flower opened and fruit pod, and be watered with Water；

B) take the identified positive 200 μ l of Agrobacterium in 3mlYEP+Rif+Kan culture medium, 28 DEG C, 200rpm shaken cultivation mistake Night takes 1ml bacterium solution to expand culture in the corresponding culture medium of 50ml, and 28 DEG C, 200rpm shaken cultivation 6h, 5000g, 10min are received Collect bacterium solution, suspension bacteria liquid, OD600 are adjusted to 1.2-1.6, finally add 10ml 1/4MS+6% sucrose (PH:5.3-5.4) again 0.02% Silwetl-77；

C) configured infected liquid is inverted in culture dish, makes arabidopsis titbit soaking 1min in infected liquid, converts completion Arabidopsis plant traverse is protected from light culture 2 days；

D) after arabidopsis is solid, seed, resistance screening transgenic plant are collected；

E) pCaMV35S::GhACT17 and negative control pCaMV35S::GhACT17It converts simultaneously and obtains T0 for seed.

3) screening and identification of positive plant

The transgenic arabidopsis T0 of acquisition is uniformly sown in MS for seed, contains hygromycin B (50mg/l) culture medium.In resistance The plant of normal growth primarily determines as positive plant in culture medium, and the positive plant filtered out is numbered and transplanted.Resistance sieve The positive plant culture selected one month or so, CTAB method extracts each plant of resistance arabidopsis DNA, and carries out target gene PCR It identifies (Fig. 1), acquires GhACT17DM T1 for totally 19 strains, wherein (distortion type is denoted as the right side DM-II: Fig. 2 b to 4, distortion type With figure c;Normal type is denoted as in DM-I: Fig. 2 b), GhACT17 T1 is for totally 14 strains, and wherein (Fig. 2 a is right, returns for 2, distortion type For D-II type), remaining be normal type (in Fig. 2 a and 2e, be classified as D-I type) with wild arabidopsis (Fig. 2 d) without obvious poor It is different.

All there is serious growth inhibition, stalk performance in either control group or mutant group, the strain of distortion type It is bent out not straight, titbit is loose, and silique obviously shortens, so that the flowers are in blossom, direction is different (Fig. 2 c) for anthocaulus curling.But compared to pair According to a group GhACT17 transgenic line (Fig. 2 a), it is more tight that GhACT17DM transgenosis distortion type strain grows suppressed state Weight (Fig. 2 b, c).As shown, the average height of GhACT17 transgenosis distortion type strain strain (Fig. 2 a is right, DII type) For 21.8cm, silique average length is 0.8cm, and GhACT17DM transgenosis distortion type strain strain (Fig. 2 b, c) is averaged Height is 10.5cm, and silique average length is 0.3cm.In addition, having in 4 distortion type strains of GhACT17DM transgenosis Two can stablize hereditary (number MT-16, MT-18) and obtain F3 generation, and isolate infertility suicide system (Fig. 2 in generation behind G), this is the half of the about fertile strain (Fig. 2 f) of plant shoots phase leaf dish size, and rearwardly serious volume is presented in blade Song, plant are dead before flowering.We analyze the expression quantity situation (figure of transformed gene in inhomogeneity transgenic plant parts simultaneously 3), the expression quantity of GhACT17DM is especially low in infertility suicide system as the result is shown.

Actin is the constituent of cytoskeleton, its heterogenous expression may make new host itself generate cell bone The change of component and rearrangement of frame, to influence the exophenotype of new host.Although the torsion of mutant transgenic line in this experiment Qu Chengdu is more serious than control group more, but distortion also occurs in control group.Based on the above theory and as a result, GhACT17DM The above results that actin as cotton is expressed in arabidopsis seem lack of evidence.Therefore, we are in cotton into one Step conversion GhACT17DM and control group, the influence in the form of deep annotation mutated gene is to cotton, specifically see implementation column 3.

Implementation column 3: the acquisition of transgene cotton

1) vector construction and conversion

A) respectively by two kinds of cDNA sequence GhACT17DM and GhACT17 and pGWB408-CaMV35s(CaMV35s promoter) Or pGWB407-GbEXPA2 (specific fiber expresses promoter PGbEXPA2) connection, acquisition pCaMV35s::GhACT17, Tetra- kinds of recombinant expression carriers of pCaMV35s::GhACT17DM, pGbEXPA2::GhACT17, pGbEXPA2::GhACT17DM.

B) recombinant vector built above is converted into Agrobacterium (EHA105), receptor cotton is entered by agrobacterium mediation convertedG. hirsutum YZ1。

2) transgene cotton identification and phenotypic evaluation

A) after resistance primary dcreening operation, Southern blotting(Fig. 4 is carried out using digoxin labelled probe), verifying obtains low copy Shellfish strain: being 3 independent strains (EM4, EM10 and EM24) for turning pGbEXPA2::GhACT17DM respectively；2 turn The independent strain (3M3-1 and 3M3-6) of pCaMV35s::GhACT17DM；3 turn pCaMV35s::GhACT17D (3W7,3W13 And 3W46) independent strain.

B) transgenic line phenotype situation

It is overexpressed using specific fiber expression promoter (pGbEXPA2), the strain of conversion GhACT17DM gene becomes Reveal normal plant shape, but its fiber is short and hard-pressed bale wraps up in seed, it is consistent with the fibre phenotype of mutant Li1, and from miscellaneous The negative plant being separated in zygote and wild plant indistinction (Fig. 5 a and b)；It is carried out using constitutive promoter (CaMV35S) It is overexpressed, the strain of conversion GhACT17DM gene cashes out stalk and leaf curling, plant are downgraded, and the surface of the seed fiber is short And seed is wrapped tightly, it is almost consistent with the phenotype of mutant Li1, and the character and wild plant of negative control group (conversion GhACT17) Object indistinction (Fig. 5 c and d).

1 transgene cotton strain list of table

3) transgenic line GhACT17DM expression conditions

We carry out the quantitative detection of target gene expression to the above transgenic line.In transformed plant, GhACT17 gene table Up to significant, but its plant is still acted normally, and illustrating that wild type GhACT17 does not have leads to similar Li1 mutation type surface Function (Fig. 6 c)；In GhACT17DM transformed plant, GhACT17DM gene expression is significant, illustrates that GhACT17DM is to cause The main reason for plant Li1 mutant phenotype (Fig. 6 a and b).

GhACT17DM gene can remold the mode of appearance of arabidopsis and cotton, and the transgenic plant obtained can be normal It yields positive results, transformed gene can stablize heredity to the next generation, therefore the gene can be further with for gardening ornamental plant Plastotype cultivates the different new varieties of posture.Disappear in addition, the bush type cultures such as crops, fruit tree can reduce unnecessary nutrient Consumption, is conducive to output increased, convenient for harvesting and picking.Therefore, GhACT17DM also hopes the utilization in agricultural cultivation of fruit tree direction.

Sequence table

<110>Zhejiang A & F University

<120>cotton actin gene mutant and its an applications

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1134

<212> DNA

<213>cotton (cotton)

<400> 1

atggcagaaa acgaagacat tcagcctctt gtttgtgaca atgggactgg aatggtcaag 60

gctggatttg ctggagatga tgctccaaga gctgtattcc ctagcattgt tggtcgccca 120

cgtcacactg gtgtgatggt cggtatgggc caaaaggatg cttatgtggg agatgaagct 180

caatcgaaaa gagttatttt gactttaaag tacccaattg agcatggtat tgttagcaat 240

tgggatgaca tggagaaaat ctggcatcat accttctaca atgagcttcg agttgcccct 300

gaggaacatc cggttctcct cacagaagct cctcttaacc caaaggccaa tcgtgaaaaa 360

atgactcaaa ttatgtttga gacattcaat gcccctgcta tgtatgttgc tatccaagct 420

gttctttcct tgtatgccag tggccgtaca accggtattg ttttggactc tggggatggt 480

gtgagccaca cagtccctat ctatgaaggc tatgctcttc cacatgccat cttgcgtctc 540

gacctagctg gtcgtgatct cactgatgct ctcatgaaaa tattaacgga gcgtggttat 600

tctttcacaa ctacggctga gcgggaaatt gtgagagaca tgaaggagaa actagcttac 660

attgctcttg actatgaaca agagttggag acagcaaaaa ccagctctgc cgttgagaaa 720

agctatgagc tacctgatgg acaggttatt accattgggg ctgaacgatt ccgttgtcca 780

gaagtcctct tccagccatc catgatcggg atggaagctg ctggcattca tgaaacgaca 840

tacaactcaa tcatgaagtg tgatgtggat attaggaagg atctctacgg aaacattgtc 900

ctcagtggtg gcaccactat gttccctgga atcgctgaca ggatgagcaa ggaaatcaca 960

gcattagccc caagcagcat gaagattaaa gtggttgcac caccagagag gaagtatagt 1020

gtttggatag gaggctccat tttggcatcc ctgagcacct tccagcagat gtggatttca 1080

aaggcagagt acgacgagtc tgggccatca attgtgcaca ggaaatgctt ctag 1134

<210> 2

<211> 377

<212> PRT

<213>cotton (cotton)

<400> 2

Met Ala Glu Asn Glu Asp Ile Gln Pro Leu Val Cys Asp Asn Gly Thr

1 5 10 15

Gly Met Val Lys Ala Gly Phe Ala Gly Asp Asp Ala Pro Arg Ala Val

20 25 30

Phe Pro Ser Ile Val Gly Arg Pro Arg His Thr Gly Val Met Val Gly

35 40 45

Met Gly Gln Lys Asp Ala Tyr Val Gly Asp Glu Ala Gln Ser Lys Arg

50 55 60

Val Ile Leu Thr Leu Lys Tyr Pro Ile Glu His Gly Ile Val Ser Asn

65 70 75 80

Trp Asp Asp Met Glu Lys Ile Trp His His Thr Phe Tyr Asn Glu Leu

85 90 95

Arg Val Ala Pro Glu Glu His Pro Val Leu Leu Thr Glu Ala Pro Leu

100 105 110

Asn Pro Lys Ala Asn Arg Glu Lys Met Thr Gln Ile Met Phe Glu Thr

115 120 125

Phe Asn Ala Pro Ala Met Tyr Val Ala Ile Gln Ala Val Leu Ser Leu

130 135 140

Tyr Ala Ser Gly Arg Thr Thr Gly Ile Val Leu Asp Ser Gly Asp Gly

145 150 155 160

Val Ser His Thr Val Pro Ile Tyr Glu Gly Tyr Ala Leu Pro His Ala

165 170 175

Ile Leu Arg Leu Asp Leu Ala Gly Arg Asp Leu Thr Asp Ala Leu Met

180 185 190

Lys Ile Leu Thr Glu Arg Gly Tyr Ser Phe Thr Thr Thr Ala Glu Arg

195 200 205

Glu Ile Val Arg Asp Met Lys Glu Lys Leu Ala Tyr Ile Ala Leu Asp

210 215 220

Tyr Glu Gln Glu Leu Glu Thr Ala Lys Thr Ser Ser Ala Val Glu Lys

225 230 235 240

Ser Tyr Glu Leu Pro Asp Gly Gln Val Ile Thr Ile Gly Ala Glu Arg

245 250 255

Phe Arg Cys Pro Glu Val Leu Phe Gln Pro Ser Met Ile Gly Met Glu

260 265 270

Ala Ala Gly Ile His Glu Thr Thr Tyr Asn Ser Ile Met Lys Cys Asp

275 280 285

Val Asp Ile Arg Lys Asp Leu Tyr Gly Asn Ile Val Leu Ser Gly Gly

290 295 300

Thr Thr Met Phe Pro Gly Ile Ala Asp Arg Met Ser Lys Glu Ile Thr

305 310 315 320

Ala Leu Ala Pro Ser Ser Met Lys Ile Lys Val Val Ala Pro Pro Glu

325 330 335

Arg Lys Tyr Ser Val Trp Ile Gly Gly Ser Ile Leu Ala Ser Leu Ser

340 345 350

Thr Phe Gln Gln Met Trp Ile Ser Lys Ala Glu Tyr Asp Glu Ser Gly

355 360 365

Pro Ser Ile Val His Arg Lys Cys Phe

370 375

<210> 3

<211> 19

<212> DNA

<213>primer (primer)

<400> 3

atggcagaaa acgaagaca 19

<210> 4

<211> 20

<212> DNA

<213>primer (primer)

<400> 4

ctagaagcat ttcctgtgca 20

Claims (3)

1. cotton actin gene mutant GhACT17DM, it is characterised in that the gene mutation body and GhACT17D gene phase Than the 194th base is mutated into T by G, and the nucleotide sequence of mutant gene cDNA ORF is as shown in SEQ ID NO:1.

2. the protein of cotton actin gene mutant GhACT17DM translation as described in claim 1, it is characterised in that The protein is compared with the protein of GhACT17D gene translation, and the 65th amino acid is by glycine mutation at valine, the egg The amino acid sequence of white matter is as shown in SEQ ID NO:2.

3. application of the gene as described in claim 1 in arabidopsis or cotton plastotype are cultivated.