CN108165557A - Application of the wheat TaZCCT2 genes in the flowering of plant time is regulated and controled - Google Patents

Abstract

The invention discloses a kind of application of wheat TaZCCT2 genes in the flowering of plant time is regulated and controled；The wheat TaZCCT2 genes include：TaZCCT2 A2, TaZCCT2 B2 and TaZCCT2 D2；The nucleotide sequence of the TaZCCT2 A2 is as shown in SEQ ID NO.4 in sequence table, and the nucleotide sequence of TaZCCT2 B2 is as shown in SEQ ID NO.5, and the nucleotide sequence of TaZCCT2 D2 is as shown in SEQ ID NO.6.Research is found the present invention for the first time, under conditions of TaZCCT2 gene overexpressions, plant shows as not flowering phenotype under long-day conditions, can not bloom under the conditions of saturation vernalization, extending the vernalization time cannot still bloom, and belong to the new discovery on wheat TaZCCT2 gene functions.

Description

Application of the wheat TaZCCT2 genes in the flowering of plant time is regulated and controled

Technical field

The present invention relates to field of plant genetic, and in particular to a kind of wheat TaZCCT2 genes are in regulation and control plant Application in flowering time.

Background technology

Flowering time is of crucial importance to the formation of crop yield：Crop needs suitable flowering time and blooms, ties to meet Real process to conditions such as temperature, illumination and rainwater requirement (Distelfeld et al., 2009；Jung et al.,2009). It is current research shows that, there are six approach of blooming in plant：Vernalization approach, autonomous pathway, Photoperiod pathway, gibberellin (GA) Approach, age approach and environment temperature approach (Fornara et al., 2010).Vernalization approach refers to need before flowering of plant It can blossom and bear fruit through low temperature after a period of time, clone and reflected in different plants at present by years of researches Make multiple vernalization correlation function genes and tentatively specify its regulated and control network (Kim et al., 2009；Fornara et al.,2010)。

1. using arabidopsis as the dicotyledon vernalization approach of representative

Arabidopsis is the type material for studying the flowering of plant time.Most important vernalization demand related gene is in arabidopsis FRIGIDA (FRI), the expression of the gene can effectively inhibit to bloom, only by the low temperature induction of a period of time, can solve Except the depression effect that the gene pairs is bloomed, plant is made to have the ability of blooming under long-day conditions；Missing FRI activity to intend south Mustard no longer has vernalization demand, can bloom as long as temperature and the suitable arabidopsis of sunshine condition, it is no longer necessary to low before blooming Temperature processing (Kim et al., 2009；Scarcelli et al.,2009；Choi et al.,2011).Koornneef etc. (1994) it finds, FRI needs that by FLC (FLOWERING LOCUS C) vernalization could be responded.FLC is that an inhibition is bloomed MADS-box transcription regulatory factors, FRI inhibit to bloom by raising the expression of FLC；In the case of FRI, FLC high levels Expression inhibiting is bloomed, and FLC expressions continuously decrease during vernalization, the inhibiting effect of plant blossom is released so that plant Can bloom (Michaels et al., 1999) under long-day conditions.Florigen of the FT as the various flowering signals of integration, Expression is moved to bud apical meristem and FD interactions in blade bast companion cell cell along screen casing, induce downstream AP1, The expression of SOC1 etc. promotes the development (Amasino et al., 2010) of inflorescence；In blade bast and bud apical meristem In, FLC inhibits to bloom (Searle et al., 2006) by inhibiting the isogenic expression of FT, SOC1.The expression of FLC genes By epigenetic regulation, chromatinic modify of FLC changes during vernalization, the H3K27Me3 modifications of inhibition of gene expression Level is gradually increasing, the expression of FLC by stabilization checking (De Lucia et al., 2008；Angel et al.,2011).

The approach 2. the tropical grass using rice as representative blooms

Rice is different from the Regulation Mechanism of blooming of arabidopsis, because it is the short day crop for not needing to carry out vernalization.Water Rice Hd3a (Heading date 3a) gene be arabidopsis FT homologous gene (Kojima et al., 2002；Doi et al.,2004).Originally Hd3a is expressed in blade, coding albumen is transferred to apical meristem from blade, and then induction is related Floral genes promote the development of floral organ, exercise the function identical with FT (Fornara et al., 2010).However, intend south The FT genes of mustard are expressed in the long-day rather than short-day, and rice Hd3a only under short-day expression (Jaeger et al., 2007；Mathieu et al.,2007；Tamaki et al.,2007).Rice Hd1 genes are the homologous of arabidopsis CO genes Gene, have daily rhythmicity identical with CO genes and reach at noon highest expression peak (Yano et al., 2000).One albumen for including CCT structural domains of Ghd7 gene codes can inhibit the expression of Hd3a to postpone to ear in the long-day, In the rice mutant of missing Ghd7 genes, expression of the Hd3a in the long-day significantly rise (Xue et al., 2008；André s et al.,2012).In addition to Hd1 is to other than blooming and playing a driving role, another QTL site Ehd1 also functions to one to heading stage Fixed effect, Ehd1 promote Rice Flowering by inducing the gene of Hd3a FT similar with other, and this process independently of Hd1 genes Accelerate bloom (Doi et al., 2004).

3. using wheat, barley as the temperate zone grass of representative vernalization approach

VERNALZATION (VRN) genes, which bloom for temperate zone grass, to play an important role.In wheat crops Do not find typical FLC homologous genes, up to the present find VERNALZATION1, VERNALZATION2 and VERNALZATION3/FT is important vernalization-related genes (Yan et al., 2006).VRN1 is MADS-box transcription factors, It with arabidopsis AP1 DNA homologs, is induced by vernalization, promotes flowering transition (Andr é s et al., 2012).Yan etc. (2003) is first Secondary to be cloned from one grained wheat and detach TmVRN1, in wheat crops winter variety, before vernalization, the expression of VRN1 is very low, Expression quantity significantly rises after vernalization, and the vernalization time is longer, and expression quantity is higher；And spring varieties need not move through vernalization, Before vernalization the expression quantity of VRN1 just very it is high (Oliver et al., 2009；Sasani et al.,2009).Vernalization is held Continuous time, the expression quantity of VRN1 and prematurity be in apparent positive correlation (Danyluk et al., 2003；Jung et al., 2009；Trevaskis et al.,2010).The vernalization that winter habit material once undergoes 2 weeks or more, in blade and apical meristem There is VRN1 expression, even if the material after vernalization is transferred to greenhouse, also remain to detect the expression of VRN1, therefore, VRN1's Expression and development also have certain relationship (Dubcovsky et al., 2006；Li et al.,2008；Takumi et al., 2011；Mohammadi et al.,2013).Research shows that VRN1 participates in vernalization induced flowering process independence in wheat crops In the approach of photoperiod, wheat crops, the code area of VRN1 genes is very conservative, and the difference of promoter and First Intron determines Expression and function of genes (Trevaskis et al., 2007；Shimada et al.,2009；Ergon et al.,2013). Yan etc. (2003) has found that promoter variation leads to the change of habit, the VRN1 carried with winter variety in one grained wheat It compares, the VRN1 promoter CAr G-box of spring varieties and other cis-regulatory regions are lacked comprising small fragment, and code area does not have It is found apparent difference (Yan et al., 2004a；Alonso-Peral et al.,2011).To different habits Barley and wheat breed carry out the First Intron of the structural analysis discovery of vernalization gene VRN1, barley HvVRN1 and wheat VRN1 Very conservative section comprising a length of 2.8kb, wherein " core section " is highly relevant with the habit of barley and wheat, the core Section is included shows as spring habit (Fu with development, low temperature and the relevant element of illumination, the barley variety for lacking the core section et al.,2005；von Zitzewitz et al.,2005；Casao et al.,2011a).

In the grass of temperate zone, necessary to active VRN2 allele is vernalization, strong inhibition is opened before vernalization Flower (Yan et al., 2004b).Yan etc. (2004b) from one grained wheat clones and is isolated to TmVRN2 genes, VRN2 bases Because the unnamed gene that seat includes two tandem sequence repeats is ZCCT1 and ZCCT2,1 zinc finger (Zinc-finger) of the gene code With CCT (CONSTANS,CONSTANS-LIKE,TOC1) structural domain, this structure is similar with CO the and CO-like genes of arabidopsis, It is referred to as ZCCT genes.Spring wheat and spring barley kind do not need to vernalization, are primarily due to lack VRN2 or VRN2 mutation (Dubcovsky et al.,2005；Karsai et al.,2005；Von Zitzewitz et al., 2005), it is also possible to With composing type active allelic VRN1 or VRN3/FT (Yan et al., 2003；Fu et al.,2005).Such as two times The dominant VRN2 of body wheat assigns winter wheat winter growth habit with its allele, and recessiveness vrn2 assigns spring habit habit (Yan et al.,2004b).Any one hexaploid winter wheat variety is in tri- locus of VRN-A2, VRN-B2 and VRN-D2 At least one advantage allele just can guarantee its vernalization demand in position, but required for reaching different vernalization demand saturation points The vernalization time be controlled by VRN1 (Liet al., 2013；Tan et al.,2016).Lack and wheat class in arabidopsis Gene directly homologous VRN2.The Ghd7 genes of rice are similar to the structure and function of VRN2, inhibit to open under long-day conditions Flower (Xue et al., 2008).Winter wheat VRN2 genes can prevent autumn and winter from blooming, and enable wheat with the state of nourishing and growing degree Spend winter, can ear and bloom until spring temperatures warmed and long-day arrive, but VRN2 be not by low temperature it is direct under The gene of tune, the expression quantity of VRN1 increases, the expression inhibiting VRN2 of VRN1 with continuing for vernalization time during vernalization Expression, so as to cause VRN3/FT genes expression (Trevaskis et al., 2006；Casao et al.,2011b； Chen al.,2012；Muterko et al.,2015；Tan et al.,2016).

The researchs of wheat ZCCT1 functionally are relatively adequately, it is considered to be form the gene of vernalization demand；ZCCT2 is only Have that the Genetic evidence in tetraploid is related with flowering time, lack the positive evidence in terms of molecule.Accordingly, with respect to wheat The function of ZCCT2 genes still needs to further study.

Invention content

For the above-mentioned prior art, the object of the present invention is to provide a kind of wheat TaZCCT2 genes in regulation and control flowering of plant Application in time.

The present invention has cloned the cDNA of the VRN2 genes of cultivated wheat from 15 wheat of tobacco grower, and is named as TaZCCT1- A1, TaZCCT1-B1, TaZCCT1-D1, TaZCCT2-A2, TaZCCT2-B2 and TaZCCT2-D2.By the cDNA of this six genes It is connected respectively on pPZP211 expression vectors, infects conversion two fringe false bromegrass Immature embryo calli using Agrobacterium, find TaZCCT1-A1, TaZCCT1-B1, TaZCCT1-D1 are overexpressed plant and there is apparent evening flower phenotype under long-day conditions, and Evening flower phenotype can be reversed by vernalization treatment.And TaZCCT2-A2, TaZCCT2-B2, TaZCCT2-D2 are overexpressed plant in long day Not flowering phenotype is shown as according under the conditions of, saturation vernalization can not bloom under the conditions of (8 weeks), extend the vernalization time to 14 weeks, TaZCCT2-B2 still cannot bloom.Based on this：

The first aspect of the present invention provides following application of any substance in the flowering of plant time is regulated and controled；

(1) wheat TaZCCT2 genes；

(2) protein of wheat TaZCCT2 gene codes；

(3) recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the wheat TaZCCT2 genes；

The regulation and control flowering of plant time is embodied in：Plant shows as not flowering phenotype and/or warp under long-day conditions Saturation vernalization treatment cannot still bloom.

The wheat TaZCCT2 genes, including：TaZCCT2-A2, TaZCCT2-B2 and TaZCCT2-D2；It is described The nucleotide sequence of TaZCCT2-A2 is as shown in SEQ ID NO.4 in sequence table, the nucleotide sequence such as SEQ of TaZCCT2-B2 Shown in ID NO.5, the nucleotide sequence of TaZCCT2-D2 is as shown in SEQ ID NO.6.

The protein of the wheat TaZCCT2 gene codes, amino acid sequence is respectively such as SEQ ID NO.10, SEQ ID Shown in NO.11 and SEQ ID NO.12.

Preferably, the plant is herbaceous plant or energy-source plant；More preferably, the plant is two fringe false bromegrass.

It does not bloom under long-day conditions since wheat TaZCCT2 genes can result in plant under conditions of overexpression, It cannot still bloom through vernalization treatment, this is for the plant for needing nutrient growth, late blooming or not bloom be to have very much Profit, based on this, the second aspect of the present invention provides the egg of above-mentioned wheat TaZCCT2 genes, wheat TaZCCT2 gene codes White matter, recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing above-mentioned wheat TaZCCT2 genes are given birth in turfgrass Application in production and/or bioenergy preparation.

The third aspect of the present invention provides a kind of method for cultivating genetically modified plants, includes the following steps：By above-mentioned wheat TaZCCT2 channel genes set out in plant, obtain genetically modified plants；Compared with the plant that sets out, genetically modified plants are in long-day item It does not bloom under part, does not bloom under the conditions of saturation vernalization, the extension vernalization time does not bloom still.

Preferably, the wheat TaZCCT2 genes are to infect conversion by Agrobacterium to import.

Preferably, the plant that sets out is herbaceous plant or energy-source plant.

It is also this hair by application of the genetically modified plants that the above method is cultivated in turfgrass produces or prepared by bioenergy Bright protection domain.

Beneficial effects of the present invention：

The present invention isolates the gene TaZCCT2-A2 of TaVRN2 gene locis on wheat A, B, D genome from wheat, TaZCCT2-B2 and TaZCCT2-D2, and for the first time the study found that TaZCCT2 genes (TaZCCT2-A2, TaZCCT2-B2 and TaZCCT2-D2) under conditions of overexpression, plant shows as not flowering phenotype under long-day conditions, under the conditions of saturation vernalization It can not bloom, the extension vernalization time cannot still bloom；It is the new discovery on wheat TaZCCT2 gene functions.The discovery for For the plant for needing nutrient growth, its late blooming is made by TaZCCT2 gene overexpressions or is not bloomed advantageously, such as me The lawn grassland industry and Biomass Energy Industry of state north Temperate Region in China have active demand to late flower/character of not blooming. Wheat TaZCCT2 gene overexpressions lead to the characteristic and its be utilized as solving such that the extreme evening after vernalization treatment spend/do not bloom Demand provides a kind of new selection.

Description of the drawings

Fig. 1：Phylogenetic analysis figure；According to the graph：In wheat, barley (9), rice (1) and arabidopsis (17) There is CCT-domain albumen, be CCT-domain protein sequences in rectangle frame；Wheat (1), barley (9), rice (1) Tetra- groups of I, II, III and IV is divided into the CO- albuminoids of arabidopsis (17).The Protein Information being related to is as follows：CO- class eggs It is wheat TaHd1-3, barley HvCO1 (AF490467), HvCO2 (AF490469), HvCO3 (AF490473), HvCO4 in vain (AF490474), HvCO5 (AY082958), HvCO6 (AY082960), HvCO7 (AY082963), HvCO8 (AY082964) and HvCO9 (AY082965), rice Os Hd1 (AB041840), arabidopsis AtCO (X94937), AtCOL1 (Y10555), AtCOL2 (L81120)、AtCOL3(NM_128038)、AtCOL4(NM_122402)、AtCOL5(AY114006)、AtCOL6 (AY081541)、AtCOL7(NM_106047)、AtCOL8(NM_103803)、AtCOL9(NM_111644)、AtCOL10(NM_ 124200)、AtCOL11(NM_001341021)、AtCOL12(NM_113084)、AtCOL13(NM_130356)、AtCOL14 (NM_179880), AtCOL15 (NM_102570) and AtCOL16 (NM_102355).Chadogram the result shows that wheat TaVRN2 with The affiliation of its barley homologous protein HvZCCT-ha and HvZCCT-hb are nearest, and HvCO9 takes second place, they belong to IV branches.Mark Ruler is observation dispersion.

Fig. 2：The several ZCCT protein amino acid sequences comparison charts of wheat class；It can be seen that wheat TaVRN2 contain there are one zinc fingers and One CCT-domain region being typically made of 43 amino acid.The amino acid residue of very high homology sequence relatively in plus It is black.On lined out the structure feature of albumen, i.e. a zinc fingers and highly conserved 43 amino acid composition CCT-domain regions.The sequence being related to is wheat ZCCT-A1, ZCCT-B1, ZCCT-D1, ZCCT-A2, ZCCT-B1 and ZCCT- D2 and barley HvZCCT-Ha (AY485977) and HvZCCT-Hb (AY485978).

Fig. 3：The schematic diagram and restriction enzyme site of the expression vector of structure.

Fig. 4：The identification of transgenic line positive seedling；No. 1 swimming lane is wild type WT, remaining swimming lane is respectively from left to right Ubi::TaZCCT1-A1-OX、Ubi::TaZCCT1-B1-OX、Ubi::TaZCCT1-D1-OX、Ubi::TaZCCT2-A2-OX、 Ubi::TaZCCT2-B2-OX、Ubi::TaZCCT2-D2-OX transgenic lines.Identification marking gene is NPT II.

Fig. 5：It is overexpressed the analysis of plant gene expression amount；Respectively primer measure is quantified with TaZCCT1, TaZCCT2.

Fig. 6：It is overexpressed wheat TaZCCT1 and TaZCCT2 gene two fringe false bromegrass plant T0 generations non-vernalization phenotype schematic diagram； It is respectively WT phenotypes, Ubi from left to right::TaZCCT1-A1-OX、Ubi::TaZCCT1-B1-OX、Ubi::TaZCCT1-D1- OX、Ubi::TaZCCT2-A2-OX、Ubi::TaZCCT2-B2-OX、Ubi::TaZCCT2-D2-OX transgenic line phenotypes.

Fig. 7：Wheat TaZCCT1 and TaZCCT2 gene two fringe false bromegrass plant T0 is overexpressed for vernalization phenotype schematic diagram；By From left to right is respectively WT phenotypes, Ubi::TaZCCT1-A1-OX、Ubi::TaZCCT1-B1-OX、Ubi::TaZCCT1-D1-OX、 Ubi::TaZCCT2-A2-OX、Ubi::TaZCCT2-B2-OX、Ubi::TaZCCT2-D2-OX transgenic line phenotypes.

Fig. 8：The gene TaZCCT2-B2 gene two fringe false bromegrass plant for being overexpressed wheat TaZCCT2 in two fringe false bromegrass prolong Phenotype schematic diagram after long vernalization (ten surroundings)；The left side is compareed for WT, and the right is is overexpressed plant.

Fig. 9 A：It is overexpressed wheat Ubi::TaZCCT1-D1-OX and Ubi::TaZCCT2-D2-OX genes two fringe false bromegrass is planted Strain T0 is for the qRT testing results of floral genes related before vernalization；VRN1 and FT in plant is overexpressed hardly to express.

Fig. 9 B：It is overexpressed wheat Ubi::TaZCCT1-D1-OX and Ubi::TaZCCT2-D2-OX genes two fringe false bromegrass is planted Strain T0 is for the qRT testing results of floral genes related after vernalization；Ubi::It is several that TaZCCT1-D1-OX is overexpressed plant VRN1 and FT Recovery WT expressions, and Ubi::It is extremely low that TaZCCT2-D2-OX is overexpressed plant VRN1 and FT expression quantity.

Specific embodiment

It is noted that following detailed description is all illustrative, it is intended to provide further instruction to the application.It is unless another It indicates, all technical and scientific terms used herein has usual with the application person of an ordinary skill in the technical field The identical meanings of understanding.

As described in background technology, VRN1, VRN2 and VRN3 gene are in Photoperiod pathway and vernalization approach It is had been a concern in the problem of blooming of the cereal plants of regulation and control, the upstream-downstream relationship of three is also always bone of contention. Wherein, VRN2 genes copy as two in situ by an ancestral gene, are named as ZCCT1 and ZCCT2.It is one small from diploid Wheat research shows that, ZCCT1 genes are functional VRN2 genes, and ZCCT2 may not have correlation function.And about ZCCT2 work( The further research of energy is not yet reported.Based on this, the present invention has cloned the VRN2 of cultivated wheat from 15 wheat of tobacco grower The cDNA of gene, and be named as TaZCCT1-A1, TaZCCT1-B1, TaZCCT1-D1, TaZCCT2-A2, TaZCCT2-B2 and TaZCCT2-D2.The cDNA of this six genes is connected respectively on pPZP211 expression vectors, infects conversion two using Agrobacterium Fringe false bromegrass Immature embryo calli, finds TaZCCT1-A1, and TaZCCT1-B1, TaZCCT1-D1 are overexpressed plant in long-day item There is apparent evening flower phenotype under part, and evening flower phenotype can be reversed by vernalization treatment.And TaZCCT2-A2, TaZCCT2-B2, TaZCCT2-D2 is overexpressed plant and not flowering phenotype is shown as under long-day conditions, can not under the conditions of saturation vernalization (8 weeks) It blooms, extends the vernalization time to 14 weeks, TaZCCT2-B2 still cannot bloom.

(code area is the 68th of its complementary strand to the to TaZCCT1-A1 gene cDNAs overall length as shown in SEQ ID NO.1 688 nucleotide), TaZCCT1-B1 gene cDNAs overall length as shown in SEQ ID NO.2 (in sequence, the 13rd to the 654th core Thuja acid is code area), TaZCCT1-D1 gene cDNAs overall length as shown in SEQ ID NO.3 (in sequence, the 57th to the 695th Nucleotide is code area), TaZCCT2-A2 gene cDNAs overall length as shown in SEQ ID NO.4 (code area for its complementary strand the 56 to the 694th nucleotide), TaZCCT2-B2 gene cDNAs overall length as shown in SEQ ID NO.5 (in sequence, the 7th to 660 nucleotide are code area), (in sequence, the 10th is extremely as shown in SEQ ID NO.6 for TaZCCT2-D2 gene cDNAs overall length 648th nucleotide is code area)；The amino acid sequence of its protein encoded is respectively such as sequence table SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, shown in SEQ ID NO.12.

The present invention obtains total serum IgE from 15 wheat of tobacco grower first, and reverse transcription obtains the first chains of cDNA, utilizes it as later Template carries out Phusion high-fidelity enzymatic amplifications, wherein used with the corresponding specific primers of TaVRN2 to the cDNA of acquisition Primer is as follows：

TaVRN2 primer sequences：

TaZCCT1-A1 sense primers：TTTTCTGCTGTGGTCTGGTGCGTGGATCC；(SEQ ID NO.13)

TaZCCT1-A1 downstream primers:GGACTAGTACGGGTGGATCAATCAGAAGGAA；(SEQ ID NO.14)

TaZCCT1-B1 sense primers：AAGTTAGGATCCATGTCCATGTCATGCGAT；(SEQ ID NO.15)

TaZCCT1-B1 downstream primers：TAACTTACTAGTTTACCGGAACCATCCGAGG；(SEQ ID NO.16)

TaZCCT1-D1 sense primers：GGGGATCCACACCAGGAAAAAACAAACAAGC；(SEQ ID NO.17)

TaZCCT1-D1 downstream primers：GGACTAGTACAGGTGGATCAATCAAAAGTAA；(SEQ ID NO.18)

TaZCCT2-A2 sense primers：GGGGATCCACACCAGAAGCAAACAAGCAA；(SEQ ID NO.19)

TaZCCT2-A2 downstream primers：GGACTAGTACTCCTCCCATCGGTCAAACAA；(SEQ ID NO.20)

TaZCCT2-B2 sense primers：GGATCCATGTCCATGTCATGCGGTTTGTGCGGCGCCAGCAACTGCCC； (SEQ ID NO.21)

TaZCCT2-B2 downstream primers：ACTAGTCTACCGGAACCATTCGAGGTTAAGTTTACT；(SEQ ID NO.22)

TaZCCT2-D2 sense primers：GGGGATCCACACCAGAAACGAACAAGCAA；(SEQ ID NO.23)

TaZCCT2-D2 downstream primers：GGACTAGTACTCCTCCAACCGGTCAATCAA；(SEQ ID NO.24)

For restriction enzyme site wherein at scribing line, the restriction enzyme sites of all sense primers is BamH1, the digestion position of downstream primer Point is Spe1；The product obtained is expanded respectively with BamH1 and Spe1 digestions, is connected respectively to PZP211 clones later and carried Body.

It is in conclusion of the invention by TaZCCT1-A1, TaZCCT1-B1, TaZCCT1-D1, TaZCCT2-A2, TaZCCT2- The full-length cDNA of B2, TaZCCT2-D2 are connected on the expression vector of Ubi startups and can result in two fringe false bromegrass transfer-gen plant Evening flower or never bloom.Build Ubi::TaZCCT1-A1-OX、Ubi::TaZCCT1-B1-OX、Ubi::TaZCCT1-D1- OX、Ubi::TaZCCT2-A2-OX、Ubi::TaZCCT2-B2-OX、Ubi::TaZCCT2-D2-OX over-express vectors, are transferred to In EHA105 agrobacterium strains, two fringe false bromegrass rataria callus is infected using agriculture bacillus mediated method, screening, which obtains to have, to be resisted The transgenic seedling of property, and pass through qRT-PCR and its expression quantity is analyzed, transfer-gen plant corresponding gene expression quantity significantly rises It is high.Quantitative primer sequence is as follows：

Ta-Actin sense primers：ATGTTCCTGCCATGTACGTC；(SEQ ID NO.25)

Ta-Actin downstream primers：TGAGGGAGTCCGTGAGATCC；(SEQ ID NO.26)

TaZCCT1 sense primers：ATCACCTTCGCTGCTCTCTC；(SEQ ID NO.27)

TaZCCT1 downstream primers：CCCACATCGTGCCATTTTAC；(SEQ ID NO.28)

TaZCCT2 sense primers：CCACCATCGTGCCATTCT；(SEQ ID NO.29)

TaZCCT2 downstream primers：CCCACCATCATCTCTGTATCAA；(SEQ ID NO.30)

It is significantly late that TaZCCT1-A1, TaZCCT1-B1, TaZCCT1-D1 are overexpressed plant phenotype under long-day conditions Flower phenotype, and evening flower phenotype can be reversed by vernalization.TaZCCT2-A2, TaZCCT2-B2, TaZCCT2-D2 are overexpressed plant in length It is showed under sunshine condition and never spends phenotype, phenotype is not reversed under saturation vernalization (vernalization in 8 weeks), under the conditions of vernalization is extended (14 weeks) TaZCCT2-B2 is not also reversed.It can be seen that the gene that the present invention obtains can be such that two fringe false bromegrass occurs extremely The character that evening spend/never blooms, and may be directly applied in agricultural production based on this.

In above-mentioned steps, the extraction and purifying of 15 wheat RNA of tobacco grower can directly use prior art, and the present invention can also be used In recorded technique；The synthesis of the first chains of cDNA is also identical situation, can also use existing technique or reagent Box, but the above-mentioned concrete technology both preferably used recorded in the present invention.

In order to enable those skilled in the art can clearly understand the technical solution of the application, below with reference to tool The technical solution of the application is described in detail in the embodiment of body.

Test material used in the embodiment of the present invention is the test material of this field routine, can pass through commercial channel It is commercially available.

Wherein the present invention by above-mentioned expression vector import plant cell in, introduction method be all it is well known in the art, These methods include but are not limited to：Agrobacterium-medialed transformation method, particle bombardment, electrization, Ovary injection etc..The present invention Selectable marker gene used be neomycin phosphotransferase gene (NPTII), can further comprise other selectable marker genes and Reporter gene.The screening antibiotic that the present invention selects is G418, selects the antibiotic such as kanamycins and paromomycin that can also play Identical screening effect.What is do not elaborated in the method applied in the present invention is state of the art.

Embodiment 1：Sequence analysis, clone and the vector construction of wheat TaVRN2 genes

By bioinformatic analysis, the present invention has found the TaVRN2 genomes of wheat, and structure Ubi over-express vectors turn Change two fringe false bromegrass and obtain transfer-gen plant.

The amino acid sequence of TaVRN2 this gene code in Gremene is retrieved, is sent out by phylogenetic analysis This existing gene has higher homology with barley HvZCCT-Ha and HvZCCT-Hb, belongs to a Ge Ya branches (such as Fig. 1 institutes Show).Amino acid Multiple Sequence Alignment shows that the CCT-domain albumen heights of TaVRN2 and barley are homologous, i.e., there are one zinc finger knots for tool The CCT-domain regions (as shown in Figure 2) of structure and a conservative 43 AA composition.

Primer is designed according to the TaVRN2 gene orders of the wheat found, is cloned, cloning process is as follows：

(1) extraction of RNA：The total serum IgE of 15 wheat of tobacco grower is extracted for century TRIzon using health.

1) fresh plant tissue material is taken to be fully ground in liquid nitrogen, tissue adds in 1mlTRIzon per 30-50mg, and suction is beaten Mixing, being placed at room temperature for 5min is kept completely separate protein nucleic acid compound.

2) 200 μ L chloroforms are added in into above-mentioned centrifuge tube, 15s is acutely shaken, is placed at room temperature for 2-3min.

3) 4 DEG C, 12000g is centrifuged 15 minutes, and top layer's colourless aqueous phase is transferred to a new RNase-Free by liquid layered In centrifuge tube.

4) isometric isopropanol is added in, mixing is overturned, is placed at room temperature for 10min.

5) 4 DEG C, 12000g is centrifuged 10 minutes, abandons supernatant.

6) 75% ethyl alcohol (matching while using) that 1mL RNase-Free water is prepared, washing precipitation are added in.

7) 4 DEG C, 12000g is centrifuged 5 minutes, abandons supernatant (as possible all blotting supernatant), drying at room temperature 5-10 minutes adds Enter water dissolution precipitations of the 30-100 μ L without RNase, can be placed in -80 DEG C of refrigerators after precipitation dissolving and preserve for a long time.

(2) synthesis of the first chains of reverse transcription cDNA：RNA concentration is measured after the RNA of extraction is dissolved, is then used TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix reverse transcription reagent box carries out Reverse transcription.

5 μ g total serum IgEs are taken, add in 2 × reaction buffer 10 μ L, primer oligo dT (0.5 μ g/ μ L) 1 μ L, 1 μ of reverse transcriptase L removes 1 μ L of genome enzyme, and moisturizing to 20 μ L is incubated 30 minutes at 42 DEG C, and 85 DEG C of enzymes inactivate 5 minutes.

(3) clone of TaVRN2 genes：

The TaVRN2 primer sequences of design are respectively as shown in SEQ ID NO.13-SEQ ID NO.24.

It is expanded using pfu high-fidelity enzymes, reaction system is：2.5 μ L of reaction buffer, DNA (dNTP) 2 μ L, 1 μ L of sense primer, 1 μ L, pfu high-fidelities enzyme of downstream primer, 0.5 0.75 μ L, cDNA template of μ L, DMSO, 1 μ L, water polishing arrive 25μL。

PCR reaction conditions are：95 DEG C 5 minutes, 95 DEG C 25 seconds, 58 DEG C 30 seconds, 72 DEG C 1 point 30 seconds, totally 35 cycle, 72 DEG C 5 minutes, 15 DEG C of heat preservations.

After reaction, it into row agarose gel electrophoresis, after detecting purpose band, cuts glue and carries out glue recycling, glue returns Receiving method is carried out according to the fast-type Ago-Gel DNA QIAquick Gel Extraction Kits (Cat#DP1722) of BioTeke companies.

The product end of high-fidelity enzymatic amplification is flat end, needs that after adding poly-A TA clones, reactant could be carried out System is as follows：1.5 μ L of reaction buffer, 1.2 μ L, Easy Taq enzyme of DNA (dNTP), 0.15 μ L, glue recovery product are mended Neat 15 μ L.72 DEG C of reactions in 30 minutes again later.

(4) above-mentioned 4 μ L tailings products is taken to be attached with pEASY-T1 cloning vectors, operating procedure is according to Quan Shi King Companies Product pEASY-T1 specifications carry out.Then connection product converts e.colistraindh5α using heat shock method, is containing ammonia It is grown overnight on the LB tablets of parasiticin.Picking white single bacterium colony is in the flat lining outs of LB, progress bacterium colony PCR, reactant System as above, chooses positive bacterium colony and is stayed overnight in LB fluid nutrient mediums.

(5) extraction of Plasmid DNA：Using health plasmid is extracted for the century small extracts kit of high-purity plasmid (CW0500A) DNA。

(6) sequencing：Originally it is operated in Beijing Liuhe Huada Genomics Technology Co., Ltd's progress.

(7) structure of expression vector：The plasmid and band of TaVRN2 genes are correctly carried with BamH1 and Spe1 digestions sequencing There are the PZP211 empty carriers of Ubi, after one hour of 37 DEG C of digestions, into row agarose gel electrophoresis, cut off correct item and bring into Row glue recycles, and the glue recovery product T4 DNA ligases of Thermo companies are connected, connection product conversion DH5 α bacterial strains, containing Have and grown overnight on the LB tablets of spectinomycin.Picking white single bacterium colony is chosen in the flat lining outs of LB, progress bacterium colony PCR Positive bacterium colony is stayed overnight in LB fluid nutrient mediums.The extraction of Plasmid DNA：The use of health is the century small extracts kit of high-purity plasmid Plasmid DNA is extracted, builds Ubi::TaZCCT1-A1-OX、Ubi::TaZCCT1-B1-OX、Ubi::TaZCCT1-D1-OX、 Ubi::TaZCCT2-A2-OX、Ubi::TaZCCT2-B2-OX、Ubi::TaZCCT2-D2-OX over-express vectors.Structure expression carries The schematic diagram and restriction enzyme site of body are as shown in Figure 3.

The over-express vector conversion Agrobacterium EHA105 that 2.5 μ L are built is taken, two fringe false bromegrass callus is infected in preparation.

Embodiment 2：The acquisition of wheat TaVRN2 genes overexpression transfer-gen plant and vernalization treatment

Two fringe false bromegrass callus is infected using agriculture bacillus mediated method and obtains transgenic seedling, and specific implementation method is such as Under：

(1) first three day picking Agrobacterium (the Agrobacterium single bacterium colony for carrying recombinant plasmid) is infected to be inoculated in and strengthen containing 50mg/L In the YEP culture mediums of miromycin, 28 DEG C, 200rpm shakes bacterium and stays overnight, and the bacterium tiling that 1ml is activated is taken within second day to arrive and contains acetyl cloves The MGL culture mediums of ketone, light culture two days later, prepare to infect.

(2) microorganism collection on culture medium is infected to 20ml in liquid, 28 DEG C shake it is scattered, measure concentration, OD600 values is made to exist Between 0.6-1.0, A600 0.06-0.1.The two fringe false bromegrass ratarias induction that 300 pieces or so of collection grown 6-7 weeks is cured Wound, is transferred to the sterile small beakers of 50mL, pours into the suspension 20mL containing Agrobacterium, jiggles 1min, stands 4min, pours out Bacterium solution, and siphon away extra bacterium solution with pipettor is as much as possible.

(3) prepare the better 9cm culture dishes for being placed with sterile dry filter paper.Each culture dish is transferred to about 100 pieces and infected Callus, it is separated as far as possible between callus and callus, filter paper is allowed to suck extra bacterium solution.After callus is well placed, 28 DEG C of dark trainings It supports 3 days.

(4) callus is transferred on the primary screening culture medium containing G418 and grown, is transferred to after two weeks containing 6-BA's It is grown on postsearch screening culture medium.Primary screening culture medium prescription composition is as follows：

The formula composition of postsearch screening culture medium 6-BA of 0.1g/L more than primary screening culture medium.

After 2 weeks, the seedling that differentiation obtains is transferred to root media, the seedling half quantity of 3 or more strengthening roots will be grown Hardening is taken out, after the hardening phase of 7 days or so, is transplanted to long-day greenhouse；Half quantity, which is taken out, is put into 4 DEG C of illumination boxs Processing, TaZCCT1-A1, TaZCCT1-B1, TaZCCT1-D1 takes out hardening after handling 3 weeks, after the hardening phase of 7 days or so, It transplants to long-day greenhouse；TaZCCT2-A2, TaZCCT2-D2 handle 8 weeks after after the hardening phase of 7 days or so, transplant to length Sunlight greenhouse；TaZCCT2-B2 handle 14 weeks after after the hardening phase of 7 days or so, transplant to long-day greenhouse.

Identified non-vernalization TaZCCT1-A1, TaZCCT1-B1, it is respectively 46 plants that the TaZCCT1-D1 positives, which are overexpressed plant, 42 plants, 47 plants, show 80 days flowering phenotypes at least more late than wild type (WT)；Non- vernalization TaZCCT2-A2, TaZCCT2-B2, It is respectively 50 plants that the TaZCCT2-D2 positives, which are overexpressed plant, 36 plants, 41 plants, wherein TaZCCT2-A2 have 2 plants show it is more late than WT Spend 95 days, TaZCCT2-D2 have 1 plant show it is more late than WT spend 98 days, other show until natural death without table of blooming Type；It is respectively 48 plants that vernalization TaZCCT1-A1, TaZCCT1-B1, the TaZCCT1-D1 positive, which are overexpressed plant, 42 plants, 44 plants, the spring It shows to restore WT flowering times substantially after change；Vernalization TaZCCT2-A2, TaZCCT2-B2, the TaZCCT2-D2 positive are overexpressed Plant is respectively 55 plants, and 42 plants, 48 plants, never flowering phenotype, TaZCCT2-B2 are showed under the conditions of saturation vernalization (vernalization in 8 weeks) (14 weeks) also do not bloom (as shown in Figure 8) under the conditions of vernalization is extended.

To sum up, TaZCCT1-A1, TaZCCT1-B1, TaZCCT1-D1 are overexpressed plant and are showed under long-day conditions significantly Evening flower phenotype, and evening flower phenotype can be reversed by vernalization.TaZCCT2 is overexpressed plant and never blooms under long-day conditions, and Vernalization phenotype does not reverse.

Embodiment 3：Wheat TaVRN2 genes overexpress the detection of transfer-gen plant expression quantity

It is soft using Beacon Designer 7 and Primer Premier 5.0 etc. according to the requirement of qRT-PCR design of primers Part designs gene specific primer.SYBR Green Design options are selected, establish file, list entries runs BLAST After search sequence and Template structure search tools, Primer search tools are run, selection is most Excellent primer sequence (first ensure that primer specificity considers further that and avoid formwork structure influence).Primer gives birth to work bioengineering service in Shanghai Co., Ltd synthesizes, and is purified using PAGE.

Using special 96 orifice plates of qRT-PCR (Axygen, the U.S.) and high transparency sealed membrane (Axygen, the U.S.), fluorescence Quantitative PCR apparatus Icycler real-time PCR system (Bio-Rad, the U.S.) carry out qRT-PCR analyses, each sample 3 Secondary repetition.Reverse transcription product is template, and reaction system is with reference to SYBR Green Realtime PCR Master Mix (QPK- 201) specification, reaction condition are as follows：

Multiple samples are mixed, carry out first time amplification, whether detection primer can be used, and verify that primer expands according to melt curve analysis The specificity of increasing, simple spike think specific amplified, if any bimodal, appropriate adjustment annealing temperature and primer dosage, if still not Energy specific amplified, redesigns primer.It is diluted by 10 times of concentration using hybrid template, diluted 4 times altogether successively, with 5 concentration Sample builds relative standard's curve, and whether the amplification efficiency and aim sequence for verifying all primers have in this concentration range The relationship of linear amplification.

Using tubulin as internal reference, adjusting each template concentrations makes the difference of internal reference Ct values be less than 2.In each gene magnification has Ginseng expands simultaneously, and Ct values are read under implied terms, and each sample repeats three times, and data analysis is using double calibration curve methods, meter Average expression amount and relative deviation are calculated, is mapped with Excel.Profit 2 simultaneously^-ΔΔCtThe relative expression quantity with internal reference is substantially calculated, is determined The gene expression abundance of gene.Relative expression quantity calculates fold change=2^–△△CT, △ △ CT=(CT-gen-CT- herein Tubulin) processing-(CT-gene-CT-tubulin) controls.

Choose without TaZCCT1-A1, TaZCCT1-B1 of vernalization treatment, TaZCCT1-D1, TaZCCT2-A2, TaZCCT2-B2, TaZCCT2-D2 strain T0 cut three pieces blade extraction RNA, reverse transcription is not bloomed with the same time for positive plant Wild type as control, carry out qRT-PCR analyze its expression quantity, respectively with TaZCCT1, TaZCCT2 quantify primer measure, draw Object sequence is respectively as shown in SEQ ID NO.25-SEQ ID NO.30.The results are shown in Figure 5, the results showed that, TaZCCT1-A1, TaZCCT1-B1, TaZCCT1-D1, TaZCCT2-A2, TaZCCT2-B2, TaZCCT2-D2 expression quantity in transgenic line are bright The aobvious wild type tissue-cultured seedling higher than contemporaneity illustrates the said gene overexpression in transgenic line.

It is overexpressed wheat Ubi::TaZCCT1-D1-OX and Ubi::TaZCCT2-D2-OX gene two fringe false bromegrass plant T0 For the qRT testing results of related floral genes are distinguished as shown in fig. 9 a and fig. 9b before vernalization and after vernalization, can be seen by Fig. 9 A Go out, be overexpressed VRN1 and FT in plant and hardly express；It can be seen from Fig. 9 B after vernalization treatment, Ubi::TaZCCT1- D1-OX is overexpressed plant VRN1 and FT and almost restores WT expressions, and Ubi::TaZCCT2-D2-OX is overexpressed plant VRN1 It is still extremely low with FT expression quantity.

The foregoing is merely the preferred embodiments of the application, are not limited to the application, for the skill of this field For art personnel, the application can have various modifications and variations.It is all within spirit herein and principle, made any repair Change, equivalent replacement, improvement etc., should be included within the protection domain of the application.

Sequence table

<110>Shandong Agricultural University

<120>Application of the wheat TaZCCT2 genes in the flowering of plant time is regulated and controled

<130> 2017

<160> 30

<170> SIPOSequenceListing 1.0

<210> 1

<211> 751

<212> DNA

<213>Wheat (Triticum aestivum)

<400> 1

actagtacgg gtggatcaat cagaaggaaa tatgttatca ttttatctgg cttgtgctat 60

aaattaccgg aaccatccga ggtgaagttt actaggatca tagggcgaag ctggagatga 120

tggcgacgcc atggcttcgg gtaccttgac aaagcagccg ttgacccgtg gccgaagctc 180

agcgtaagct tttctggact cgtatctgat ttgcttgtca tagcgccgcc tcttcctctt 240

ctccctatac ctcatcacct tcgctgctct ctcctgcatt gtgggataat gggcaggccc 300

caccatcatc tctgtgtcaa tagtcatgat tgcttcattg ctaatagtgt tggtgaatgc 360

acctccgtaa aatggcacga tgtgggctct tgccggtggc tgcactaggt gagccatggg 420

tcggccgcct gcgcccacct ccagcgtgag cctgctgctg ttccctgcag ctgctgtttc 480

atgaaatggt gtggtccatg ttctgctatg gtcgaagttg gctggcggca gtggcactgg 540

gtggtggtgg tggtggttgc cttgggcgaa gaactggtgc tgacgcagct ggtgctcctg 600

atgatggtga tgacgatgat gaatgggcga gaccatgagg cgcgggcagt tgttggcgcc 660

gcacaaaccg catgacatgg acatactgct agctagctcc aaggtttgct tgcttttttg 720

ttttttctgc tgtggtctgg tgcgtggatc c 751

<210> 2

<211> 666

<212> DNA

<213>Wheat (Triticum aestivum)

<400> 2

aagttaggat ccatgtccat gtcatgcgat ttgtgcggcg ccaacaactg ctcgcgcctc 60

atggtctcgc ccattcatca tcatcatcac catcatcagg agcaccagct gcgtgagcac 120

cagttcttcg cccaaggcaa ccaccaccac caccaccatg gcgcggcagt agaccaccca 180

gtgccaccgc cgccagccaa cttcgaccac cgcagaacat ggactacacc atttcatgaa 240

acagcagctg cagggaacag cagcaggctc acactggagg tgggcgcagg cggccgacac 300

atggctcacc tagtgcagcc accggcaaga gcccacatcg tgccatttta tggaggtgca 360

ttcacaaaca ctattagcaa tgaagcaatc atgactattg acacagagat gatggtgggg 420

cctgcccatt atcccacaat gcaggagaga gcagcgaagg tgatgaggta tagggagaag 480

aggaagaggc ggcgctatga caagcaaatc cgatacgagt ccagaaaagc ttacgctgag 540

ctccggccac gggtaaacgg ccgcttcgtc aaggtacccg aagccatggc gtcgccatca 600

tctccagctt tgccctatgg tcctagtaaa cttcacctcg gatggttccg gtaaactagt 660

aagtta 666

<210> 3

<211> 758

<212> DNA

<213>Wheat (Triticum aestivum)

<400> 3

ggatccacac caggaaaaaa caaacaagca agcaaccctt ggagctagct agcagtatgt 60

ccatgtcatg cggtttgtgc ggcgccaaca actgcccgcg cctcatggtc tcgcccattc 120

atcatcacca tcatcaggag caccagctac gcgagcacca gttcttcgcc caaggcaacc 180

accaccacca ccaccatggc gcggcagcag accacccagt gccactgccg ccagccaact 240

tcgaccaccg cagaacatgg gccacaccat ttcatgaaac agcagctgca gggaacagca 300

tcagcaggct cacgctggag gtgggcgcag gcggccgaca catggctcac ctagtgcagc 360

caccggcaag agcccacatc gtgccatttt acggaggtgc attcacaaac actattagca 420

atgaagcaat catgactatt gacacaaaga tgatggtggg gcctgcccat tatcccacaa 480

tgcaggagag agcggcgaag gtgatgaggt atagggagaa gaggaagagg cggcgctatg 540

acaagcaaat ccgatacgag tccagaaaag cttacgctga gctccagcca cgggtcaacg 600

gccgcttcgt caaggtaccc gaagccatgg catcgccatc atctccagct tcgccctatg 660

atcctagtaa acttcatctt ggatggttcc agtaatttat agcacaagcc agataaaatg 720

ataacatatt tacttttgat tgatccacct gtactagt 758

<210> 4

<211> 751

<212> DNA

<213>Wheat (Triticum aestivum)

<400> 4

actagtactc ctcccatcgg tcaaacaata accaacttat tttactttga tgaaaaacta 60

ccggaaccat ccgaggtgaa gtttactagg atcatagggc gaagctgggg gtgacgacga 120

tgcagcggct tctggtacct tgacaaagcg gccattgacc cgtggcctga gctcggcgta 180

agcttttctg gactcatagc ggatttgctt gtcatagcac cgcctcttcc tcttctccct 240

gtacctcatc accttcgcct ctctctcctg catcgtcaga ttatgggcag cccccaccat 300

catctctgta tcaatagtca tgatcgttgc attgctaata gtgctggtga atgcagcccc 360

gcagaatggc acgatggtgg ttcttggccg tgccggtggc tgcagcaggt gagccatgtt 420

ttggccgcct gcgtctacct ccagcgtgag cctgctgctg ttccctgcag ctgctgtttc 480

atgaaacggt gtggtccatg atctgcagtg gtggcaattg gctgacggtg gcggtggcgg 540

tgggtagtcc gccgccgcgt cgtggtggtg gtggtggtgg ccttgggtga agaactggta 600

ctcgcgcagc cggtgttgtt cctgatgctg aagaacgggc gagatcatgt ggtgcgggca 660

gtcgcttgcg ccgcacaaac cgcatgacat gggcatactg cagctagctc ctacgtttgc 720

ttgcttgctt gtttgcttct ggtgtggatc c 751

<210> 5

<211> 666

<212> DNA

<213>Wheat (Triticum aestivum)

<400> 5

ggatccatgt ccatgtcatg cggtttgtgc ggcgccagca actgcccaca ccacatgatc 60

tcgcccgttc ttcagcatca tcagcatcat cagcatcatc aggaacaccg gctgcgcgag 120

taccagttct tcgcccaagg ccaccaccac caccaccatg acggcacggc agcggactac 180

ccaccgccac cgccggccaa ttgccaccac tgcagatcat ggaccacacc gtttcatgaa 240

acagcagctg cagggaacag cagcaggctg accctggagg tggacgctgg cggccaacac 300

ctggctcacc tgctgcagcc accggcgccg ccaagagcca ccatcgtgcc attctgcggg 360

ggcgcattca ccagcactat tagcaatgca acgatcatga ctattgatac agagatgatg 420

gtgggggctg cccataatcc gacgatgcag gagagacagg cgaaggtgat gaggtacagg 480

gagaagagga agaggcggcg atatgaaaag caaatacgct acgagtccag aaaagcttac 540

gccgagctca ggccacgggt caatggccgc tttgtcaagg tacccgaagc cgatgtgtct 600

ccatcacccc cagcttcgcc ctatgatcct agtaaactta acctcgaatg gttccggtag 660

actagt 666

<210> 6

<211> 657

<212> DNA

<213>Wheat (Triticum aestivum)

<400> 6

aagggatcca tgcccatgtc atgcagtttg tgcggcgcca gcaactgccc gcaccacatg 60

aactcacccg ttcttcatca tcatcaccat catcaggaac accgactgtg cgagtaccag 120

ttcttcgccc aaggccagca ccaccaccac catggtgcgg cagcggacta cccaccgcca 180

ccgccggcca actgccacca ccgcagatca tggaccacac catttcatga aacagcagct 240

gcagggaaca gcagcaggct cacgctggag gtggacgcgg gcggacaaca cacggctcac 300

ctgctgcagc caccggcgcc accaagagcc accatcgtgc cattctgcgg gggtgcattc 360

accagcacta ttagcaatgc aacgatcagg acaattgata cagagatgat ggtggcggct 420

gcccataatc cgacgatgca ggagagagag gcgaaggtga tgaggtacag ggagaagagg 480

aagaggcggc gctatgacaa gcaaatccgc tacgagtcca gaaaagctta cgccgagctc 540

aggccacggg tcaatggccg ctttgtcaag gtacccgaag ccaccgcgtc gccatcaccc 600

ccaacttcgc cctatgatcc tagtaaactt cacctcggat ggttctagac tagtctt 657

<210> 7

<211> 206

<212> PRT

<213>Wheat (Triticum aestivum)

<400> 7

Met Ser Met Ser Cys Gly Leu Cys Gly Ala Asn Asn Cys Pro Arg Leu

1 5 10 15

Met Val Ser Pro Ile His His Arg His His His His Gln Glu His Gln

20 25 30

Leu Arg Gln His Gln Phe Phe Ala Gln Gly Asn His His His His His

35 40 45

Pro Val Pro Leu Pro Pro Ala Asn Phe Asp His Ser Arg Thr Trp Thr

50 55 60

Thr Pro Phe His Glu Thr Ala Ala Ala Gly Asn Ser Ser Arg Leu Thr

65 70 75 80

Leu Glu Val Gly Ala Gly Gly Arg Pro Met Ala His Leu Val Gln Pro

85 90 95

Pro Ala Arg Ala His Ile Val Pro Phe Tyr Gly Gly Ala Phe Thr Asn

100 105 110

Thr Ile Ser Asn Glu Ala Ile Met Thr Ile Asp Thr Glu Met Met Val

115 120 125

Gly Pro Ala His Tyr Pro Thr Met Gln Glu Arg Ala Ala Lys Val Met

130 135 140

Arg Tyr Arg Glu Lys Arg Lys Arg Arg Arg Tyr Asp Lys Gln Ile Arg

145 150 155 160

Tyr Glu Ser Arg Lys Ala Tyr Ala Glu Leu Arg Pro Arg Val Asn Gly

165 170 175

Cys Phe Val Lys Val Pro Glu Ala Met Ala Ser Pro Ser Ser Pro Ala

180 185 190

Ser Pro Tyr Asp Pro Ser Lys Leu His Leu Gly Trp Phe Arg

195 200 205

<210> 8

<211> 213

<212> PRT

<213>Wheat (Triticum aestivum)

<400> 8

Met Ser Met Ser Cys Asp Leu Cys Gly Ala Asn Asn Cys Ser Arg Leu

1 5 10 15

Met Val Ser Pro Ile His His His His His His His Gln Glu His Gln

20 25 30

Leu Arg Glu His Gln Phe Phe Ala Gln Gly Asn His His His His His

35 40 45

His Gly Ala Ala Val Asp His Pro Val Pro Pro Pro Pro Ala Asn Phe

50 55 60

Asp His Arg Arg Thr Trp Thr Thr Pro Phe His Glu Thr Ala Ala Ala

65 70 75 80

Gly Asn Ser Ser Arg Leu Thr Leu Glu Val Gly Ala Gly Gly Arg His

85 90 95

Met Ala His Leu Val Gln Pro Pro Ala Arg Ala His Ile Val Pro Phe

100 105 110

Tyr Gly Gly Ala Phe Thr Asn Thr Ile Ser Asn Glu Ala Ile Met Thr

115 120 125

Ile Asp Thr Glu Met Met Val Gly Pro Ala His Tyr Pro Thr Met Gln

130 135 140

Glu Arg Ala Ala Lys Val Met Arg Tyr Arg Glu Lys Arg Lys Arg Arg

145 150 155 160

Arg Tyr Asp Lys Gln Ile Arg Tyr Glu Ser Arg Lys Ala Tyr Ala Glu

165 170 175

Leu Arg Pro Arg Val Asn Gly Arg Phe Val Lys Val Pro Glu Ala Met

180 185 190

Ala Ser Pro Ser Ser Pro Ala Leu Pro Tyr Gly Pro Ser Lys Leu His

195 200 205

Leu Gly Trp Phe Arg

210

<210> 9

<211> 212

<212> PRT

<213>Wheat (Triticum aestivum)

<400> 9

Met Ser Met Ser Cys Gly Leu Cys Gly Ala Asn Asn Cys Pro Arg Leu

1 5 10 15

Met Val Ser Pro Ile His His His His His Gln Glu His Gln Leu Arg

20 25 30

Glu His Gln Phe Phe Ala Gln Gly Asn His His His His His His Gly

35 40 45

Ala Ala Ala Asp His Pro Val Pro Leu Pro Pro Ala Asn Phe Asp His

50 55 60

Arg Arg Thr Trp Ala Thr Pro Phe His Glu Thr Ala Ala Ala Gly Asn

65 70 75 80

Ser Ile Ser Arg Leu Thr Leu Glu Val Gly Ala Gly Gly Arg His Met

85 90 95

Ala His Leu Val Gln Pro Pro Ala Arg Ala His Ile Val Pro Phe Tyr

100 105 110

Gly Gly Ala Phe Thr Asn Thr Ile Ser Asn Glu Ala Ile Met Thr Ile

115 120 125

Asp Thr Lys Met Met Val Gly Pro Ala His Tyr Pro Thr Met Gln Glu

130 135 140

Arg Ala Ala Lys Val Met Arg Tyr Arg Glu Lys Arg Lys Arg Arg Arg

145 150 155 160

Tyr Asp Lys Gln Ile Arg Tyr Glu Ser Arg Lys Ala Tyr Ala Glu Leu

165 170 175

Gln Pro Arg Val Asn Gly Arg Phe Val Lys Val Pro Glu Ala Met Ala

180 185 190

Ser Pro Ser Ser Pro Ala Ser Pro Tyr Asp Pro Ser Lys Leu His Leu

195 200 205

Gly Trp Phe Gln

210

<210> 10

<211> 212

<212> PRT

<213>Wheat (Triticum aestivum)

<400> 10

Met Pro Met Ser Cys Gly Leu Cys Gly Ala Ser Asp Cys Pro His His

1 5 10 15

Met Ile Ser Pro Val Leu Gln His Gln Glu Gln His Arg Leu Arg Glu

20 25 30

Tyr Gln Phe Phe Thr Gln Gly His His His His His His Asp Ala Ala

35 40 45

Ala Asp Tyr Pro Pro Pro Pro Pro Pro Ser Ala Asn Cys His His Cys

50 55 60

Arg Ser Trp Thr Thr Pro Phe His Glu Thr Ala Ala Ala Gly Asn Ser

65 70 75 80

Ser Arg Leu Thr Leu Glu Val Asp Ala Gly Gly Gln Asn Met Ala His

85 90 95

Leu Leu Gln Pro Pro Ala Arg Pro Arg Thr Thr Ile Val Pro Phe Cys

100 105 110

Gly Ala Ala Phe Thr Ser Thr Ile Ser Asn Ala Thr Ile Met Thr Ile

115 120 125

Asp Thr Glu Met Met Val Gly Ala Ala His Asn Leu Thr Met Gln Glu

130 135 140

Arg Glu Ala Lys Val Met Arg Tyr Arg Glu Lys Arg Lys Arg Arg Cys

145 150 155 160

Tyr Asp Lys Gln Ile Arg Tyr Glu Ser Arg Lys Ala Tyr Ala Glu Leu

165 170 175

Arg Pro Arg Val Asn Gly Arg Phe Val Lys Val Pro Glu Ala Ala Ala

180 185 190

Ser Ser Ser Pro Pro Ala Ser Pro Tyr Asp Pro Ser Lys Leu His Leu

195 200 205

Gly Trp Phe Arg

210

<210> 11

<211> 217

<212> PRT

<213>Wheat (Triticum aestivum)

<400> 11

Met Ser Met Ser Cys Gly Leu Cys Gly Ala Ser Asn Cys Pro His His

1 5 10 15

Met Ile Ser Pro Val Leu Gln His His Gln His His Gln His His Gln

20 25 30

Glu His Arg Leu Arg Glu Tyr Gln Phe Phe Ala Gln Gly His His His

35 40 45

His His His Asp Gly Thr Ala Ala Asp Tyr Pro Pro Pro Pro Pro Ala

50 55 60

Asn Cys His His Cys Arg Ser Trp Thr Thr Pro Phe His Glu Thr Ala

65 70 75 80

Ala Ala Gly Asn Ser Ser Arg Leu Thr Leu Glu Val Asp Ala Gly Gly

85 90 95

Gln His Leu Ala His Leu Leu Gln Pro Pro Ala Pro Pro Arg Ala Thr

100 105 110

Ile Val Pro Phe Cys Gly Gly Ala Phe Thr Ser Thr Ile Ser Asn Ala

115 120 125

Thr Ile Met Thr Ile Asp Thr Glu Met Met Val Gly Ala Ala His Asn

130 135 140

Pro Thr Met Gln Glu Arg Gln Ala Lys Val Met Arg Tyr Arg Glu Lys

145 150 155 160

Arg Lys Arg Arg Arg Tyr Glu Lys Gln Ile Arg Tyr Glu Ser Arg Lys

165 170 175

Ala Tyr Ala Glu Leu Arg Pro Arg Val Asn Gly Arg Phe Val Lys Val

180 185 190

Pro Glu Ala Asp Val Ser Pro Ser Pro Pro Ala Ser Pro Tyr Asp Pro

195 200 205

Ser Lys Leu Asn Leu Glu Trp Phe Arg

210 215

<210> 12

<211> 212

<212> PRT

<213>Wheat (Triticum aestivum)

<400> 12

Met Pro Met Ser Cys Ser Leu Cys Gly Ala Ser Asn Cys Pro His His

1 5 10 15

Met Asn Ser Pro Val Leu His His His His His His Gln Glu His Arg

20 25 30

Leu Cys Glu Tyr Gln Phe Phe Ala Gln Gly Gln His His His His His

35 40 45

Gly Ala Ala Ala Asp Tyr Pro Pro Pro Pro Pro Ala Asn Cys His His

50 55 60

Arg Arg Ser Trp Thr Thr Pro Phe His Glu Thr Ala Ala Ala Gly Asn

65 70 75 80

Ser Ser Arg Leu Thr Leu Glu Val Asp Ala Gly Gly Gln His Thr Ala

85 90 95

His Leu Leu Gln Pro Pro Ala Pro Pro Arg Ala Thr Ile Val Pro Phe

100 105 110

Cys Gly Gly Ala Phe Thr Ser Thr Ile Ser Asn Ala Thr Ile Arg Thr

115 120 125

Ile Asp Thr Glu Met Met Val Ala Ala Ala His Asn Pro Thr Met Gln

130 135 140

Glu Arg Glu Ala Lys Val Met Arg Tyr Arg Glu Lys Arg Lys Arg Arg

145 150 155 160

Arg Tyr Asp Lys Gln Ile Arg Tyr Glu Ser Arg Lys Ala Tyr Ala Glu

165 170 175

Leu Arg Pro Arg Val Asn Gly Arg Phe Val Lys Val Pro Glu Ala Thr

180 185 190

Ala Ser Pro Ser Pro Pro Thr Ser Pro Tyr Asp Pro Ser Lys Leu His

195 200 205

Leu Gly Trp Phe

210

<210> 13

<211> 29

<212> DNA

<213>Artificial sequence ()

<400> 13

ttttctgctg tggtctggtg cgtggatcc 29

<210> 14

<211> 31

<212> DNA

<213>Artificial sequence ()

<400> 14

ggactagtac gggtggatca atcagaagga a 31

<210> 15

<211> 30

<212> DNA

<213>Artificial sequence ()

<400> 15

aagttaggat ccatgtccat gtcatgcgat 30

<210> 16

<211> 31

<212> DNA

<213>Artificial sequence ()

<400> 16

taacttacta gtttaccgga accatccgag g 31

<210> 17

<211> 31

<212> DNA

<213>Artificial sequence ()

<400> 17

ggggatccac accaggaaaa aacaaacaag c 31

<210> 18

<211> 31

<212> DNA

<213>Artificial sequence ()

<400> 18

ggactagtac aggtggatca atcaaaagta a 31

<210> 19

<211> 29

<212> DNA

<213>Artificial sequence ()

<400> 19

ggggatccac accagaagca aacaagcaa 29

<210> 20

<211> 30

<212> DNA

<213>Artificial sequence ()

<400> 20

ggactagtac tcctcccatc ggtcaaacaa 30

<210> 21

<211> 47

<212> DNA

<213>Artificial sequence ()

<400> 21

ggatccatgt ccatgtcatg cggtttgtgc ggcgccagca actgccc 47

<210> 22

<211> 36

<212> DNA

<213>Artificial sequence ()

<400> 22

actagtctac cggaaccatt cgaggttaag tttact 36

<210> 23

<211> 29

<212> DNA

<213>Artificial sequence ()

<400> 23

ggggatccac accagaaacg aacaagcaa 29

<210> 24

<211> 30

<212> DNA

<213>Artificial sequence ()

<400> 24

ggactagtac tcctccaacc ggtcaatcaa 30

<210> 25

<211> 20

<212> DNA

<213>Artificial sequence ()

<400> 25

atgttcctgc catgtacgtc 20

<210> 26

<211> 20

<212> DNA

<213>Artificial sequence ()

<400> 26

tgagggagtc cgtgagatcc 20

<210> 27

<211> 20

<212> DNA

<213>Artificial sequence ()

<400> 27

atcaccttcg ctgctctctc 20

<210> 28

<211> 20

<212> DNA

<213>Artificial sequence ()

<400> 28

cccacatcgt gccattttac 20

<210> 29

<211> 18

<212> DNA

<213>Artificial sequence ()

<400> 29

ccaccatcgt gccattct 18

<210> 30

<211> 22

<212> DNA

<213>Artificial sequence ()

<400> 30

cccaccatca tctctgtatc aa 22

Claims (10)

1. following application of any substance in the flowering of plant time is regulated and controled；

(1) wheat TaZCCT2 genes；

(2) protein of wheat TaZCCT2 gene codes；

(3) recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the wheat TaZCCT2 genes；

The regulation and control flowering of plant time is embodied in：Plant shows as not flowering phenotype under long-day conditions and/or through saturation Vernalization treatment cannot still bloom.

2. application according to claim 1, which is characterized in that the wheat TaZCCT2 genes include：TaZCCT2-A2, TaZCCT2-B2 and TaZCCT2-D2；The nucleotide sequence of the TaZCCT2-A2 as shown in SEQ ID NO.4 in sequence table, The nucleotide sequence of TaZCCT2-B2 is as shown in SEQ ID NO.5, the nucleotide sequence such as SEQ ID NO.6 institutes of TaZCCT2-D2 Show.

3. application according to claim 1 or 2, which is characterized in that the protein of the wheat TaZCCT2 gene codes, Its amino acid sequence is respectively as shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12.

4. application according to claim 1, which is characterized in that the plant is herbaceous plant or energy-source plant.

5. the application according to claim 1 or 4, which is characterized in that the plant is two fringe false bromegrass.

6. application of the following any substance in turfgrass produces and/or prepared by bioenergy；

(1) wheat TaZCCT2 genes；

(2) protein of wheat TaZCCT2 gene codes；

(3) recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the wheat TaZCCT2 genes；

The wheat TaZCCT2 genes include：TaZCCT2-A2, TaZCCT2-B2 and TaZCCT2-D2；The TaZCCT2-A2 Nucleotide sequence as shown in SEQ ID NO.4 in sequence table, the nucleotide sequence such as SEQ ID NO.5 institutes of TaZCCT2-B2 Show, the nucleotide sequence of TaZCCT2-D2 is as shown in SEQ ID NO.6；

The protein of the wheat TaZCCT2 gene codes, amino acid sequence is respectively such as SEQ ID NO.10, SEQ ID Shown in NO.11 and SEQ ID NO.12.

A kind of 7. method for cultivating genetically modified plants, which is characterized in that include the following steps：Described in claims 1 or 2 Wheat TaZCCT2 channel genes set out in plant, obtain genetically modified plants；Compared with the plant that sets out, genetically modified plants are in long day It does not bloom according under the conditions of, does not bloom under the conditions of saturation vernalization, the extension vernalization time does not bloom still.

8. the method according to the description of claim 7 is characterized in that the wheat TaZCCT2 genes are infected by Agrobacterium What conversion imported.

9. the method according to the description of claim 7 is characterized in that the plant that sets out is herbaceous plant or energy-source plant.

10. the genetically modified plants that claim 7-9 any one of them method is cultivated are produced in turfgrass or prepared by bioenergy In application.