CN108642065A - A kind of paddy endosperm silty related gene OsSecY2 and its coding protein and application - Google Patents

Abstract

The present invention discloses a kind of paddy endosperm silty related gene Ossecy2 and its coding protein and application, gene Ossecy2 provided by the invention, for it is following 1) or 2) or 3) or 4) described in DNA molecular：1) DNA molecular shown in SEQ ID NO.1；2) DNA molecular shown in SEQ ID NO.2；1) or 2) 3) hybridize under strict conditions with the DNA sequence dna limited and the DNA molecular of encoding said proteins；1) or 2) or 3) 4) there is 90% or more homology, and the DNA molecular of coded plant Starch synthesis GAP-associated protein GAP with the DNA sequence dna limited.The present invention also provides the protein of the gene code, the albumen influences the synthesis of starch in albumen, the encoding gene of the albumen is imported in the plant of Starch synthesis exception, can cultivate the normal genetically modified plants of Starch synthesis.The albumen and its encoding gene can be applied to genetic modification of plants.

Description

A kind of paddy endosperm silty related gene OsSecY2 and its coding protein and application

Technical field

The invention belongs to genetic engineering fields, and in particular to a kind of paddy endosperm silty related gene OsSecY2 and its volume Code protein and application.

Background technology

Rice is important one of the pattern species of cereal crops and plant research.Rice paddy seed is in maturation A large amount of starch is accumulated, is sprouted for seed and seedling development provides main energy, while starch is also that the mankind are important Food source.In rice paddy seed the number of starch accumulation determine seed size and weight and rice yield it is directly related, The content of amylose and the structure of amylopectin affect the Cooking Quality of rice in seed simultaneously, therefore study and form sediment in rice The building-up process of powder has important application value, carries out the further investigation of its synthesis and Regulation Mechanism, to improving rice yield There is important directive significance with improvement rice quality.

Although many enzymes for participating in Starch synthesis process and regulatory factor are accredited out, which still needs It further to further investigate, and various types of endosperm variation mutant is the good material for studying the process.Rice fecula is prominent Variant includes waxy (waxy, wx), saccharic (sugary, su), silty (floury, flo), shrinkage (shrunken, sh), dead color The types such as (dull, du), core white (white-core, wc).Using above-mentioned paddy endosperm character variation mutant, positioning and clone A series of Starch synthesis and regulation and control related gene, certain basis has been established for the quality-improving of rice.

Invention content

It is an object of the invention to disclose a kind of paddy endosperm silty related gene Osscy2 and its coding protein and answer With.

Gene OsSecY2 provided by the invention, for it is following 1) or 2) or 3) or 4) described in DNA molecular：

1) DNA molecular shown in SEQ ID NO.1；

2) DNA molecular shown in SEQ ID NO.2；

1) or 2) 3) hybridize under strict conditions with the DNA sequence dna limited and the DNA molecular of encoding said proteins；

1) or 2) or 3) 4) there is 90% or more homology with the DNA sequence dna limited, and coded plant Starch synthesis is related The DNA molecular of albumen.

SEQ ID NO.1 in sequence table, are made of 7360 nucleotide.

The present invention also provides a kind of protein of said gene OsSecY2 codings.

It is any shown in such as (a) or (b) specifically, protein provided by the invention：

(a) protein that amino acid sequence forms shown in SEQ ID NO.3；

(b) substitution by the amino acid sequence of SEQ ID NO.3 by one or several amino acid residues and/or missing And/or addition and with the relevant protein derived from SEQ ID NO.3 of Starch synthesis.

SEQ ID NO.3 in sequence table, are made of 542 amino acid.

The present invention also provides the recombinant expression carrier containing the gene OsSecY2, expression cassette, transgenic cell line or Recombinant bacterium.Recombinant expression carrier containing any description above gene also belongs to protection scope of the present invention.

The recombinant expression carrier of the gene can be contained with existing plant expression vector construction.

The plant expression vector includes double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.The plant Object expression vector also may include 3 ' end untranslated regions of foreign gene, that is, include polyadenylation signals and any other participation MRNA is processed or the DNA fragmentation of gene expression.The bootable polyadenylic acid of polyadenylation signals is added to the 3 ' of mRNA precursor End, such as Agrobacterium crown gall nodule induction (Ti) plasmid gene (such as kermes synzyme Nos genes), plant gene (such as soybean storage egg White gene) 3 ' end transcription non-translational region all have similar functions.

When using the gene constructed recombinant plant expression vector, any type can be added before its transcription initiation nucleotide Enhanced promoter or constitutive promoter, such as the ubiquitin promoter of cauliflower mosaic virus (CAMV) 35S promoter, corn (Ubiquitin), they can be used alone or are used in combination with other plant promoters；In addition, using the gene of the present invention When building plant expression vector, enhancer, including translational enhancer or transcriptional enhancer also can be used, these enhancer regions can To be ATG initiation codon or neighboring region initiation codon etc., but must be identical as the reading frame of coded sequence, it is whole to ensure The correct translation of a sequence.The source of the translation control signal and initiation codon is extensive, can be natural, also may be used To be synthesis.Translation initiation region can come from transcription initiation region or structural gene.

For the ease of transgenic plant cells or plant are identified and screened, plant expression vector used can be carried out Processing, as be added the coding that can be expressed in plant can generate color change enzyme or luminophor gene (gus gene, Luciferase genes etc.), resistant antibiotic marker (gentamicin marker, kanamycins marker etc.) or anti- Chemical reagent marker gene (such as anti-herbicide gene).From the security consideration of genetically modified plants, any selectivity can be not added with Marker gene directly screens transformed plant with adverse circumstance.

The recombination over-express vector can be in restriction enzyme XbaI and BamHI double digestion carrier pCAMBIA1305- The recombination site of GFP is inserted into the recombinant plasmid that the gene (OsSecY2) obtains.By the pCAMBIA1305- containing OsSecY2 GFP is named as pCAMBIA1305-GFP-OsSecY2.

Expression cassette, transgenic cell line and recombinant bacterium containing any description above gene (OsSecY2) belong to this hair Bright protection domain.

The primer pair for expanding the gene (OsSecY2) overall length or any segment also belongs to protection scope of the present invention, institute Primer pair preferred Primer1/Primer2, the Primer3/Primer4 stated.

The positioning primer (being shown in Table 1) being related to during this gene of finely positioning, InDel primers for this experiment need and The primer of the primer of designed, designed, these designed, designeds also belongs to protection scope of the present invention.

The present invention also provides the gene, the protein, the recombinant expression carrier, expression cassette, transgenic cell The application of at least one of system or recombinant bacterium in plant breeding.

The present invention also provides the gene, the protein, the recombinant expression carrier, expression cassette, transgenic cell The application of at least one of system or recombinant bacterium in cultivating the normal genetically modified plants of Starch synthesis.

The present invention also provides a kind of methods for cultivating the normal genetically modified plants of Starch synthesis, are by the channel genes In Starch synthesis exception plant, the normal genetically modified plants of Starch synthesis are obtained.

Specifically, the gene can be imported by the recombinant expression carrier in the plant of Starch synthesis exception.

The carrier that foreign gene is expressed in plant can be guided using any type, the gene of encoding said proteins is led Enter plant cell, transgenic cell line and transfer-gen plant can be obtained.The expression vector for carrying the gene can be by using Ti The conventional biology methods such as plasmid, Ri plasmids, plant viral vector, directly delivered DNA, microinjection, conductance, agriculture bacillus mediated Plant cell or tissue are converted, and the plant tissue of conversion is cultivated into plant.The plant host being converted is either list Leaf plant can also be dicotyledon, such as：Tobacco, crowtoe, arabidopsis, rice, wheat, corn, cucumber, tomato, poplar Tree, turfgrass, lucerne place etc..

Advantageous effect：

Present invention firstly discovers that, position and clone to obtain the encoding gene of a new albumen silty GAP-associated protein GAP OsSecY2.The albumen silty GAP-associated protein GAP of the present invention influences the Starch synthesis and Development of Chloroplasts process of plant.Inhibiting should The expression of protein coding gene can lead to the defect of Starch synthesis and Development of Chloroplasts in vegetable seeds, so as to cultivate endosperm With the genetically modified plants of chloroplaset variation.The encoding gene of the albumen is imported in the plant of Starch synthesis exception, Ke Yipei Educate the normal plant of Starch synthesis.The albumen and its encoding gene can be applied to genetic modification of plants.

Description of the drawings

Fig. 1 is the plant phenotype and seed phenotype of wild type Dianjingyou No.1 and mutant D138.

Fig. 2 is wild type Dianjingyou No.1 and mutant D138 seed scanning electron microscopic observations.

Fig. 3 is 10DAF endosperm semithin section observation and 3 leaf phase leaf sheaths of the wild type Dianjingyou No.1 with mutant D138 Chloroplaset is observed.

Fig. 4 is finely positioning of the mutator on the 5th chromosome and sequencing difference.

Fig. 5 is the T for turning pCAMBIA1305-GFP-OsSecY2₁For the T of plant₂Seed phenotype.

Fig. 6 is the T for turning pCAMBIA1305-GFP-OsSecY2₂For endosperm semithin section and T₁3 leaf phase leaf sheath chloroplasets of generation Observation.

Specific implementation mode

Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly What routine biochemistry reagent shop was commercially available.

The discovery of embodiment 1, rice fecula synthesis related locus and its encoding gene

One, the phenotypic analysis of paddy endosperm silty mutant D138

In the Dianjingyou No.1 mutant generated using MNU mutagenesises, an endosperm silty mutant is filtered out, is ordered Entitled D138.

Compared with Dianjingyou No.1, D138's is mainly characterized by：Seed kernel silty is opaque (see Fig. 1), while having plant Strain blade albefaction phenotype (see Fig. 1).This illustrates that gene mutation affects the synthesis of starch, leads to the structure and property hair of amylum body Variation has been given birth to, endosperm is made to show huge difference in appearance.Meanwhile the mutation of gene also affects the hair of plant chloroplaset It educates, to generate the phenotype of blade albefaction.

Scanning electron microscopic observation (see Fig. 2) is carried out to the cross section of wild type and mutant mature seed, in 200 times of amplification Photo on, the starch lamellar structure comparison rule of the cross section of wild type seeds is neat, and mutant is more open.Thus may be used To infer, the change of these starch granule structures and arrangement may be the immediate cause for causing endosperm that silty phenotype is presented.

The endosperm that 10DAF is developed to wild type and mutant carries out semithin section observation, finds mutant amyloplast area Become larger, quantity tails off (see Fig. 3).Wild type and mutant leaf sheath Chloroplast (3 leaf) are observed simultaneously, find mutant chloroplaset Area becomes larger, and quantity reduces (see Fig. 3).Thus infer, mutant endosperm silty phenotype is become larger by amyloplast, between amyloplast Hole, which increases, to be caused；And blade albefaction phenotype is caused by the variation of chloroplaset size and number.

Two, the map based cloning of mutant gene locus

1, the positioning of mutator

First, the cross combination F of mutant D138 and another wild type N22 have been prepared₁, F is obtained after being selfed a generation₂Kind Son.By F₂Seed decladding carries out linkage analysis, by mesh with blade albefaction using phenotype is opaque as 10 plants of extremists of standard screening Gene primarily determine on the 5th article of chromosome long arm of rice, increase extremists to 31 plants, will target gene just be located in Between two labels of s5-7 and s5-32.Increase extremists to 257 plants, using laboratory common primers with it is self-designed Primer, between target gene is eventually positioned at s5-14 and Fy-10 two labels, physical distance is 88kb (Fig. 4).,

The method of above-mentioned SSR marker analysis is as described below：

(1) total DNA of above-mentioned selection single plant is extracted as template, and the specific method is as follows：

1. taking the rice young leaflet tablet of 0.2g or so, it is placed in 2.0mL Eppendorf pipes, a steel ball is added, dress The Eppendorf pipes of good sample freeze 5min in liquid nitrogen, are placed on 2000 type instruments of GENO/GRINDER and crush sample 1min。

2. 660 μ L extracting solutions (Tris-HCl containing 100mM (pH 8.0), 20mM EDTA (pH 8.0), 1.4M is added The solution of NaCl, 0.2g/mL CTAB), 65 DEG C of warm bath 30min.

3. 40 μ L 20%SDS, 65 DEG C of warm bath 10min are added, every two minutes mixings that gently turn upside down.

4. 100 μ L 5M NaCl, mild mixing is added.

5. 100 μ L 10 × CTAB, 65 DEG C of warm bath 10min are added, it is interrupted the mixing that gently turns upside down.

6. 900 μ L chloroforms are added, mix well, 12000rpm centrifuges 3min.

7. shifting in supernatant to 1.5mL Eppendorf pipes, 600 μ L isopropanols, mixing, 12000rpm centrifugations is added 5min。

8. abandoning supernatant, 70% (volumn concentration) ethyl alcohol of precipitation rinses primary, room temperature airing.

9. it is molten that 100 1 × TE of μ L (121g Tris are dissolved in 1 liter of water, the solution obtained with hydrochloric acid tune pH value to 8.0) are added Solve DNA.

10. taking 2 μ L electrophoresis detection DNA mass, Nano Drop spectrophotometric determination concentration is used in combination.

(2) DNA of said extracted is diluted to about 20ng/ μ L, PCR amplification is carried out as template；

PCR reaction systems (10 μ L)：DNA (20ng/ μ L) 1 μ L, sense primer (2pmol/ μ L) 1 μ L, downstream primer (2pmol/ μ L) 1 μ L, 10 × Buffer (MgCl₂Free) 1 μ L, dNTP (10mM) 0.2 μ L, MgCl₂(25mM) 0.6 μ L, rTaq (5U/ μ L) 0.1 μ L, ddH₂5.1 μ L of O, totally 10 μ L.

PCR response procedures：94.0 DEG C of denaturation 5min；94.0 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, altogether Cycle 35 times；72 DEG C of extension 7min；10 DEG C of preservations.PCR reactions carry out in LongGene A200PCR instrument.

(3) the PCR product detection of SSR marker

Amplified production is analyzed with 8% native polyacrylamide gel electrophoresis.Using the DNA Ladder of 50bp as contrast ratio Compared with the molecular size range of amplified production, silver staining colour developing.

Above-mentioned primer development process is as follows：

(1) SSR marker is developed

The SSR marker of public collection of illustrative plates is integrated with Rice Genome Sequence, downloads the BAC/PAC near mutational site Cloned sequence.With SSRHunter (Li Qiang etc., heredity, 2005,27 (5):808-810) or SSRIT online softwares (http:// Archive.gramene.org/db/markers/ssrtool) potential SSR sequences (number of repetition >=6) in search clone； The sequence of these SSR and its neighbouring 400~500bp are carried out with corresponding long-grained nonglutinous rice sequence in NCBI by blast program online Compare, if the SSR numbers of repetition of the two are variant, tentatively inferring the PCR products of the SSR primers, there are polymorphic between Xian, round-grained rice Property；5.0 Software for Design SSR primers of Primer Premier are recycled, and are synthesized by Shanghai Ying Jun Bioisystech Co., Ltd. The pairs of primer equal proportions of the SSR of designed, designed are mixed, its polymorphism between Dianjingyou No.1 and N22 is detected, performance is polymorphic Person is used as the molecular labeling of finely positioning.Molecular labeling for finely positioning is shown in Table 1.

Table 1 is used for the molecular labeling of finely positioning

Primer	Sense primer (5 ' -3 ')	Downstream primer (5 ' -3 ')
			S5‐7	GAGAACAATGTGCCGTG	CAGTGGACTTTGAGGGAT
S5‐8	ATCCACCTACCACCACTG	CCCCTTACTCTTCCAATG
			S5‐41	GTGAACCCTTGTGTAATCGC	GCAGCCACCTGACTACTAAT
Fy‐13	AGCTGGTACTAAGAATGCAC	TCCCACAAACACACACGC
			S5‐14	GGGGTTTGCTTCAGGTTAG	GCTAAAGCTGGAGCTGATGA
Fy‐10	AATCCGATTTAGTACGAGGC	TCCCTTCATATCAGCAAACA
			S5‐15	TCACGCCACCACTTGTTG	GCAGAGATGGATGTGCTTCA
S5‐20	ACCTCCTACCTCCCGTTGCT	TCCTGTGGTGGAACCTGTC
			S5‐32	GCTAAGTTTGGTGGGGTCA	CTCCGACTCCATCCAAAATC
I5‐9	CTGCACTGCTGAAATGGAGA	GCTGGGATATCAACCCTACG

2, the acquisition of silty gene

By to the sequencing in the sections 88kb, it was found that secy2 genes there are the mutation of a single base,

According to the primers announced on the net, sequence is as described below：

primer1：5'CGCCATGCCGCACTCACTCT3'(SEQ ID NO.4)；

primer2：5'TGGTCAACCCGCCAGCCTCT 3'(SEQ ID NO.5).

Using primer1 and primer2 as primer, endosperm cDNA carries out PCR amplification as template in being developed using Dianjingyou No.1 Obtain target gene.Amplified reaction carries out on LongGene A200PCR instrument：94℃3min；94 DEG C of 30s, 60 DEG C of 45s, 72 DEG C 10min, 35 cycles；72℃5min.It will be connected to pMD18-T (in Japanese TaKaRa companies) after PCR product recovery purifying, turn Change bacillus coli DH 5 alpha competent cell (Beijing Tiangen company CB101), after selecting positive colony, is sequenced.

Sequencing results show that the segment that PCR reactions obtain has nucleotide sequence shown in SEQ ID NO.2, compile The protein of code 542 amino acid residues composition (see the SEQ ID NO.3 of sequence table).By albumen shown in SEQ ID NO.3 It is named as OsSecY2, the encoding gene of albumen shown in SEQ ID NO.3 is named into OsSecY2.

The acquisition and identification of embodiment 2, genetically modified plants

One, recombinant expression carrier is built

Using the cDNA of Dianjingyou No.1 (coming from rice institute of Agricultural University Of Nanjing germplasm resource bank) as template, PCR amplification is carried out OsSecY2 gene C DS sequences are obtained, PCR primer sequence is as follows：

primer3：

5'CGGAGCTAGCTCTAGAATGCCGCACTCACTCTCCCT3'(SEQ ID NO.6)；

primer4：

5'TGCTCACCATGGATCCGGCACCATATCTCCTTAGAA 3'(SEQ ID NO.7)。

Above-mentioned primer be located at gene shown in SEQ ID NO.2 ATG start to TGA before terminate, include TGA, amplification production Object contains whole code area parts of the gene, by PCR product recovery purifying.Using INFUSION recombination kits (Japan TaKaRa companies) PCR product is cloned into carrier pCAMBIA1305-GFP.INFUSION recombining reactions system (10 μ L)： 1.0 6.0 μ L, 5 × infusion buffer of μ L, pCAMBIA1305-GFP of PCR product, 2.0 μ L, infusion enzyme mix 1μL.The water-bath 15 minutes of 50 DEG C of mixed system, taking-up are placed on ice after of short duration centrifugation, take 2.5 μ L reaction system heat shocks Method converts bacillus coli DH 5 alpha competent cell (Beijing Tiangen companies；CB101).Cell will be totally converted to be uniformly coated on On the LB solid mediums of the kanamycins containing 50mg/L.After 37 DEG C of culture 16h, picked clones positive colony is sequenced.Sequencing The result shows that having obtained, containing the recombinant expression carrier of gene shown in SEQ ID NO.2, to contain OsSecY2's PCAMBIA1305-GFP is named as pCAMBIA1305-GFP-OsSecY2, and OsSecY2 genetic fragments are recombinated using INFUSION Kit (Japanese TaKaRa companies) is inserted between XbaI the and BamHI restriction enzyme sites of the carrier.

Two, the acquisition of recombinational agrobacterium

With freeze-thaw method by pCAMBIA1305-GFP-OsSecY2 conversion Agrobacterium EHA105 bacterial strains (laboratory preservation), obtain To recombinant bacterial strain, extraction plasmid carries out PCR and digestion identification.PCR and digestion are identified that correct recombinant bacterial strain is named as EH- pCAMBIA1305-GFP-OsSecY2。

With pCAMBIA1305-GFP, carrier converts Agrobacterium EHA105 bacterial strains as a contrast, and method is same as above, and obtains turning zero load Body control strain.

Three, the acquisition of genetically modified plants

By EH-pCAMBIA1305-GFP-OsSecY2 and turn empty vector control bacterial strain rice transformation endosperm silty respectively and dash forward Modification D 138, specific method are：

(1) 28 DEG C is cultivated EH-pCAMBIA1305-GFP-OsSecY2 (or turning empty vector control bacterial strain) 16 hours, is collected Thalline, and be diluted in N6 fluid nutrient mediums (Sigma companies, C1416) to a concentration of OD600 ≈ 0.5, obtain bacterium solution；

(2) by culture to the bacterium solution mixed infection of one month D138 Mature Embryos of Rice embryo callus and step (1) 30min, filter paper are transferred to after blotting bacterium solution in co-cultivation culture medium (N6 solid co-cultivation mediums, Sigma companies), 24 DEG C of trainings altogether It supports 3 days；

(3) callus of step (2) is seeded on the N6 solid screening and culturing mediums containing 100mg/L hygromycin and is sieved for the first time It selects (16 days)；

(4) picking health callus is transferred to programmed screening on the N6 solid screening and culturing mediums containing 100mg/L hygromycin, often Subculture is primary within 15 days；

(5) picking health callus is transferred on the N6 solid screening and culturing mediums containing 50mg/L hygromycin and screens for the third time, often Subculture is primary within 15 days；

(6) picking kanamycin-resistant callus tissue is transferred on differential medium and breaks up；Obtain the T of seedling differentiation₀For positive plant.

Four, the identification of transfer-gen plant

1, PCR Molecular Identifications

The T that step 3 is obtained₀Extract genomic DNA for plant, using genomic DNA as template, using Primer3 and Primer4 is that primer is expanded.

PCR reaction systems：22 μ L, Primer4 (10pmol/ μ L) 2 of μ L, Primer3 (10pmoL/ μ L) of DNA (20ng/ μ L) μ L, 10 × Buffer (MgCl₂Free) 2 μ L, dNTP (10mM) 0.4 μ L, MgCl₂(25mM) 1.2 μ L, rTaq (5U/ μ L) 0.4 μ L, ddH₂10 μ L of O, 20 μ L of total volume.Amplified reaction carries out on LongGeneA200PCR instrument, and PCR programs are：94℃ 3min； 94 DEG C of 30s, 55 DEG C of (primer is different, is adjusted) 45s, 72 DEG C of 2min, 35 cycles；72℃ 5min.

PCR product is detected with 1% agarose electrophoresis, and the mesh of SEQ ID NO.2 sizes can be detected in positive plant Band is marked, cannot be detected in negative plant.

2, phenotypic evaluation

Respectively by T₀In generation, turns pCAMBIA1305-GFP-Oscysecy2 positive plants, T₀In generation, turns empty vector control plant, dashes forward Modification D 138 and Dianjingyou No.1 are planted in the transgenosis field of Agricultural University Of Nanjing's soil bridge rice breeding base.After seed maturity, receive Each material seed is taken, observes occur transparent seed (Fig. 5) in the seed of pCAMBIA1305-GFP-OsSecY2 plant, Further semithin section and the observation display of 3 leaf leaf sheath of rice, are transferred to the D138 seeds of pCAMBIA1305-GFP-OsSecY2 The form and quantity of starch granule morphology and quantity and leaf sheath chloroplaset are restored to normal level (Fig. 6).Hence it is demonstrated that Mutant phenotype in D138 is as caused by the mutation of OsSecY2.PCAMBIA1305-GFP-OsSecY2 can make D138 strains Starch synthesis restore to normal level.

Sequence table

<110>Agricultural University Of Nanjing

<120>A kind of paddy endosperm silty related gene OsSecY2 and its coding protein and application

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 7360

<212> DNA

<213>Oryza rice (Oryza sativavar.Dianjingyou1)

<400> 1

cggattttgc aatcccatcg gccggcagag cgcgacggcg gcagctcggc caccgccgcg 60

gcatcgccgc catgccgcac tcactctccc tcctgctcgc gcccagccgc gcgctctccc 120

tctcctcccc accgctccgc ctcgccccaa cgcacccacc acttcgcctg caccacgacg 180

gcggccacct cctcgtgggc acgacgaggc ggcaggctcc ctcgcctcgc cgccgccgtc 240

tccatgccgc cagggcttcc gcgccgtccg ccgccgcggc gtcccccgta gggcctgcgg 300

gcgagggtgg cgaggtgggg ggcagggcga ggaaggcggc ggggtaccgg aacaggttcc 360

tggacctggc gcggctgggg gccgtggcgg agagcgcggc ggaggcgctc ttccgcagcg 420

agattcgccg gcggctggcc gtcacggccg tgctcatcct gctcagccgc gtcggctact 480

tcgtcccgct tcccgggttc gaccgacggc tcatccccga ttcctacctc agctttgcac 540

cccttcctgc aggtctcttc cctttacagt cctccgagaa tattagttcg tgctagctgt 600

agtgtatgaa agtgcgcggt cgtttgatca ttttgatggc cttggtgaac tgtttgaaga 660

atgtgcggtg ctctttcggt tgtgcagatg acctcggtga tttttcatcc gaattgaagc 720

tgtcattttt ccagctcgga atcagtcatc agatttcagc atctattgtc atgcaggttc 780

tattttatcc cttgtttggt cctgctcttt tgttttccaa tggcaacgta tgtctcaagt 840

agcagcaatc cgctcaataa cctgttgcaa actgagcctt agttctttta ttctagagtg 900

tgttcgtttt tgctctttaa gagcgttttg catcagttgc ttctaacgtc gtactaaagc 960

ttttctcagt atttggtgat agtaacaaat tgtgattttt aggttctctg tcatgttctt 1020

ccatcacttg aaaaactacg aaaggaaggg ttagatggac atgagaagat caaaggctat 1080

atgtgagtcg agttctcttt cttgaactga attatttgaa aaggggatct tttattttct 1140

ttctcaacat tcatctactt ttaaatttta agtctggtta ttttgatgtt ctagttggtg 1200

gctgtcgctg ggttttgcac ttgtggcggc ttttacagtg tcatgctact cactgcaata 1260

ttctatatat gctgcaagtt acaggtgaca gtatgttagc tctatatgga gaaaaagctt 1320

tactaataat aatttgtttg gactggaagg atgctcatca gtatttcttt acctatacct 1380

ttttttaatc tttcagagtt aagcatgtaa tgataacaag ccttttcctt gttcttggtg 1440

caatgacaat gacatggatc tgtgacacta tatcggaatc tggatttggt aatactctat 1500

atcatgtata tcggaatctt ggatttggta ttctagcatc atctctgcat gctttgatta 1560

tactgtgtta aagctgtatt caatatggca tattatgcca tatccaaact ttaagactaa 1620

actcagctgt tggacatgaa aacatgcatg ctggcatgat ttctttacca tatatctcta 1680

tgattgcgat tcacgtaaat gatcttgtaa agtaaaagca taaaatgatg gttgttatcc 1740

atttagtgca tattttcttg tacttggttg gaacttttgt tcttatattt tcttctatgt 1800

ctttgcatcc aggacatggc tcttccttga ttatctgtgt gggaatattg actggttata 1860

cagacacact ccacaagatg ttaactcaat tttcaggtaa tctttcacga cactaattgc 1920

aacttttcaa ctgctaagtt ttactccttt gagttggatg cgaccagtaa attctaatga 1980

taatgatgtg tatgtactga atttattatc cttgcatctt cttatatctc tttgcggaag 2040

ttttgtggta ggtggagtat ttcaaggcac ttttccaaac tgcattgtca tctatgatga 2100

tcttatactt tgattttttt ttatctgcct gtttggtgcc tcacattgtg ttgccaacca 2160

aaactcattg ttggattgta actcctttaa aggattgaat ttcattacag cttggcataa 2220

ctgttgctca aataaataag aagcaacatg gtctgagtag aatggataat tccattatgc 2280

cactcaaatt ttgccaaacc agggatgtgc tgttatcgta caagtacaat actttaccct 2340

tttatttcat tgcagacaaa attccatcag tcaaatcatg cccaggatgt gcaaagacta 2400

ttttacccct tctctatcag tttcctctgt tttctattgc acttttccat agctgactgg 2460

agagaacgac ctcatctatc ctccaatgac caatggctag tttagagata tgttagtcat 2520

tattcagaga aattaaaaaa tgagagcaaa ggggtaaaat ttgatcaaca agggtagaaa 2580

agggtaatgt tttggtacag tacagtcata tctggagttg gttttcaatg ggatatctag 2640

gctcagacat attgttaatg atatatatgg aattatccct tttcatcttc tattaaatca 2700

ttacaggatg gtgaaatctt attttgcact taaaaatctt ggatggttgt gtctgttata 2760

acctcgtcag tagtgttatc ttagctgatc tacctgagct ccatttctct agctgagcat 2820

aacataatat gcatcgtgca atgttaaggt ttgtttgcac gatcatttgg gcactagcca 2880

gttcatgaag atataatgtt gacatttttg tcagtaacgt gtatatacga actagaattt 2940

taagtcttaa aacacttcac cagtttctac aatacaataa cttgtttacc aagatggatc 3000

agataaacat ttggagaaaa gaaaccgaaa atgtaactcc taatttcttt cggtcatata 3060

cagtatgtac acagacagct gatatgctga gacttctagt gttattttct tttatttgat 3120

atgcctttcg aaacaggaaa ttggtacagc tgttggccct acatcttggg gatagctggg 3180

acttttattt tggttaccat gggagcagta ctggtgactg aagggtgtag gaagataaag 3240

cttcagtact atggatttaa attggcttct ggtgcaaggt aatgataaaa tcaactctac 3300

actcattttt attatcatgt acttttgaat gctatttttg catggagcac ataagaacat 3360

tatccacaca agctgcacat aagaaccttt catgttgccc aaatgcccaa acagaatata 3420

ctttatcaca ttaactgcaa accttttgtt tgaaacatct atttatgtta tttgaaaact 3480

ccagtttgtt atattctgct taagttctaa tttctaaaca atttaacagc acccttctac 3540

cggtattttt agctgcagcc tggcatggtt atatggctca atgatatggt tggatgtgga 3600

ttgacctagc aaaggctact ccatcatcac ctatttgtgc taatactacg ctttatggtt 3660

ttctcaatcc ttttacttat cttatatttg atcattcttt tgtaggagtg agagctcccc 3720

agttacagag gtagagccat atatcccttt taacataaat ccaactggga tgcagccttt 3780

gcttaccacc tcatacttat tagcttttcc aagcattatg gccaggtaat tcattgtgtt 3840

tattttttgg gtatgttttg gttaaaattt ccattctgat tttggaattt ctccagcatt 3900

tttggtacgc aattttggga aagtttgaag gaaacgttga atccaaagac ttcagttggt 3960

ggtggtccat gggtttatta tttgacatat gcatttcttg tcttcgtctt caatattttt 4020

gacattgtaa gttactttct catcttaata actgtctaac tattttattt ttcaggatac 4080

agtcattata ccaatattcc ttctattatc ttgtggtgat gttctcttat agttgctcgt 4140

gaccttgttt tggtgcctgc ggaacctggc tgaccccctt agagaatgca ttgtttaaaa 4200

aattccgtaa tgaattgtgg atgtagcaca cagagtcctt taaacctaca aaaaaaaaat 4260

tcaaattgtc tagatgttga gatacagaaa ggacaagcat acatcacggt attgttcacc 4320

atgaagtagc agtagccgta agacttttcc ttttgtatct tgacatgtag gaaaaaactt 4380

gagttttata tttttcttta cacagagcta ctcatgctac atccatgaat cattttggaa 4440

ttttttaatc atcgcttatg ttgattcatc agattttttt atgggggaca acgaatcccc 4500

tggggaccaa caactatgca taatctaact gttgaaccta gtatcacata caaaactttt 4560

cttaacaatg ctcttgtaga tcttcaaaaa catgacagat atttgtgatg taattttgat 4620

atcagaactc atgttctcaa cattttcagg aagataatat tcttttattt tcttttcatg 4680

attttatttg cacatgcctt atcaaatata gcttaatcta cacattattc actgcaggca 4740

aacttgccaa aagagatatc tgactacctg aataaaatga gtgctagagt accgaagata 4800

aagcctggaa gagcaacagt agagtatctt acaaaaatac aaacatctac acgtttctgg 4860

ggtaggtggc cttcacgaga acttgtagca tggccaaact ttcctctgtt ttgctttatg 4920

ttttttctta tttttaaaaa gtgtttcttt ccttgaattc cagggggtat attgctgagc 4980

ttgttggcga cttcctcttt attacttgac cgatatctca ggcagataaa tgagggattt 5040

tctataggtt tcacgtcggt gttgattatt gtgagtgcat ctcaattata ttcttcatta 5100

tcatttgtca ccatgaagaa gattgatgtt gaattgcatt ttcaatcata ttcttagtta 5160

actatttgcc acttttaaga tgtggcaatt aaggatttgc cactcgcagt ctatgacatc 5220

tgggtccagt ggcaaatcct taagtgtcac ttgtaataat ggcaaatagt taattatctc 5280

ttttcatggt gctatttttt ccaagtattg gcctttttac atgtgttttc tctgaatatc 5340

ttctaggtgc ctgaatctga aattctaaat gaacttaaac ttggtcaagt gactagggat 5400

tttagctgat tatgcacact tccaatgttg accttctgta ttttgttttt tcaatgtttc 5460

tgccttttga tcttcttaaa aatattgata aaatccaaat ggtgtattag atgatttagg 5520

gcttaaggcc tttcgctctg tcaagttaag ccctcctagc tgtccccaca atgcattcct 5580

gctccccaca ggcccacacc cataaaaaat gccattagaa tctctgtttg atgtactatt 5640

tgttgtactt atggaggaag gctgggtgat tttgaccttt gagagatgaa tattatgtaa 5700

ttaaatatta tgtttatgca gtttagcaca ttattgcaag ttgttccata atgcagagcc 5760

cactgctatg cataatttat aaatctagga tatatattta gaaagtaaaa gcacacaatt 5820

tttttattga aaagaacaaa acaactgaag attttgtttc cttaaaatct taaatgaaaa 5880

gcttgagcct atgcagtata ggaatcattt ccagccgtaa tcatattagc agtgaacttg 5940

gcaaatgtgt tagttctttg ccactaaata attaatatgc ttacctgcct atagatagtt 6000

accgtaccga tgtgttcttc catccacaat ttcattttac atggatagct caaagtttgt 6060

gttcatttcc ctctacattg cattttcttt ttattatttt tgtttaaaaa caaaaatgca 6120

tatcaactat aaagaattct attagtgtgc tgcttatttt ctgctgctgc attaggtgtt 6180

ctagcccttt tctaccttca tttacttatg gacattaaat attttttttc tttgatcaaa 6240

tgggacatgt gcgtgatgaa catgtgtttg gataatgaaa ctatatgaag atgattgttc 6300

aggtgggctc aatcatcgag ctgagaaggt cttatcaagc atacaatgtg atgccagcac 6360

taagcaaagt tctaaggaga tatggtgcct gaggttatgt acgccacata tttggttatg 6420

atggtatcat ccacaaggta cttcttcctt tgctgctagt ctttgttaat attaagctaa 6480

gcctgccttt ttcccctttg ttttagaaga agagggccat ttcaaaaaaa cttcagagtt 6540

tacaggctta cagccgacta gatgctgtga ccttgattat tgtcaacaac ttgcagtacg 6600

gtgcagtaag aagagttcta taacccagac caatattgtg cttgggttgg gatgagatta 6660

gtatagtttg atatcaatct tctgtggcat aaactggaac tgaagaacca aggaggatat 6720

tttgttactc atggcacagc aactatgaag agcgtgacct acgaggagct gtgtaattgt 6780

gttgtctttg gccacttctg gaatggttga cggcttgatg caatgcgaac gaaaatttgg 6840

atccaatctc acccagctgt ataattttct gaagatcaga ttgccaaatt gctggctagc 6900

tgcatcacgc ttagtaaatg gtgcggtcag aagtcagaac ctgaagtctg caaaattgct 6960

ggttttgggt tgattgttgg aacgttctac atcagaggct ggcgggttga ccatctggac 7020

ttatccgtgt agcacaatga agatcagctg tcgtgcgttt gctgaccagt agtatctctc 7080

tgtaggctta tgtttttgta aatatatggc ttattaacag tagaacttcc actcctgtcc 7140

tgacttctca aaggctgttc tgttcacttt tccaaaaagc agcttcatat ttacaaaaga 7200

taaagaagca catttttctt ttattgacaa agatatagct gagctgcatg ctgaagaaac 7260

agacgtatca tacaggtcga gcctccaatg tgacattatt gcgctcaatg gcgcgttgta 7320

ccattatcta ctacagtaca tcagtactaa tgtctttcaa 7360

<210> 2

<211> 1629

<212> DNA

<213>Oryza rice (Oryza sativavar.Dianjingyou1)

<400> 2

atgccgcact cactctccct cctgctcgcg cccagccgcg cgctctccct ctcctcccca 60

ccgctccgcc tcgccccaac gcacccacca cttcgcctgc accacgacgg cggccacctc 120

ctcgtgggca cgacgaggcg gcaggctccc tcgcctcgcc gccgccgtct ccatgccgcc 180

agggcttccg cgccgtccgc cgccgcggcg tcccccgtag ggcctgcggg cgagggtggc 240

gaggtggggg gcagggcgag gaaggcggcg gggtaccgga acaggttcct ggacctggcg 300

cggctggggg ccgtggcgga gagcgcggcg gaggcgctct tccgcagcga gattcgccgg 360

cggctggccg tcacggccgt gctcatcctg ctcagccgcg tcggctactt cgtcccgctt 420

cccgggttcg accgacggct catccccgat tcctacctca gctttgcacc ccttcctgca 480

gatgacctcg gtgatttttc atccgaattg aagctgtcat ttttccagct cggaatcagt 540

catcagattt cagcatctat tgtcatgcag gttctctgtc atgttcttcc atcacttgaa 600

aaactacgaa aggaagggtt agatggacat gagaagatca aaggctatat ttggtggctg 660

tcgctgggtt ttgcacttgt ggcggctttt acagtgtcat gctactcact gcaatattct 720

atatatgctg caagttacag agttaagcat gtaatgataa caagcctttt ccttgttctt 780

ggtgcaatga caatgacatg gatctgtgac actatatcgg aatctggatt tggacatggc 840

tcttccttga ttatctgtgt gggaatattg actggttata cagacacact ccacaagatg 900

ttaactcaat tttcaggaaa ttggtacagc tgttggccct acatcttggg gatagctggg 960

acttttattt tggttaccat gggagcagta ctggtgactg aagggtgtag gaagataaag 1020

cttcagtact atggatttaa attggcttct ggtgcaagga gtgagagctc cccagttaca 1080

gaggtagagc catatatccc ttttaacata aatccaactg ggatgcagcc tttgcttacc 1140

acctcatact tattagcttt tccaagcatt atggccagca tttttggtac gcaattttgg 1200

gaaagtttga aggaaacgtt gaatccaaag acttcagttg gtggtggtcc atgggtttat 1260

tatttgacat atgcatttct tgtcttcgtc ttcaatattt ttgacattgc aaacttgcca 1320

aaagagatat ctgactacct gaataaaatg agtgctagag taccgaagat aaagcctgga 1380

agagcaacag tagagtatct tacaaaaata caaacatcta cacgtttctg ggggggtata 1440

ttgctgagct tgttggcgac ttcctcttta ttacttgacc gatatctcag gcagataaat 1500

gagggatttt ctataggttt cacgtcggtg ttgattattg tgggctcaat catcgagctg 1560

agaaggtctt atcaagcata caatgtgatg ccagcactaa gcaaagttct aaggagatat 1620

ggtgcctga 1629

<210> 3

<211> 542

<212> PRT

<213>Oryza rice (Oryza sativavar.Dianjingyou1)

<400> 3

Met Pro His Ser Leu Ser Leu Leu Leu Ala Pro Ser Arg Ala Leu Ser

1 5 10 15

Leu Ser Ser Pro Pro Leu Arg Leu Ala Pro Thr His Pro Pro Leu Arg

20 25 30

Leu His His Asp Gly Gly His Leu Leu Val Gly Thr Thr Arg Arg Gln

35 40 45

Ala Pro Ser Pro Arg Arg Arg Arg Leu His Ala Ala Arg Ala Ser Ala

50 55 60

Pro Ser Ala Ala Ala Ala Ser Pro Val Gly Pro Ala Gly Glu Gly Gly

65 70 75 80

Glu Val Gly Gly Arg Ala Arg Lys Ala Ala Gly Tyr Arg Asn Arg Phe

85 90 95

Leu Asp Leu Ala Arg Leu Gly Ala Val Ala Glu Ser Ala Ala Glu Ala

100 105 110

Leu Phe Arg Ser Glu Ile Arg Arg Arg Leu Ala Val Thr Ala Val Leu

115 120 125

Ile Leu Leu Ser Arg Val Gly Tyr Phe Val Pro Leu Pro Gly Phe Asp

130 135 140

Arg Arg Leu Ile Pro Asp Ser Tyr Leu Ser Phe Ala Pro Leu Pro Ala

145 150 155 160

Asp Asp Leu Gly Asp Phe Ser Ser Glu Leu Lys Leu Ser Phe Phe Gln

165 170 175

Leu Gly Ile Ser His Gln Ile Ser Ala Ser Ile Val Met Gln Val Leu

180 185 190

Cys His Val Leu Pro Ser Leu Glu Lys Leu Arg Lys Glu Gly Leu Asp

195 200 205

Gly His Glu Lys Ile Lys Gly Tyr Ile Trp Trp Leu Ser Leu Gly Phe

210 215 220

Ala Leu Val Ala Ala Phe Thr Val Ser Cys Tyr Ser Leu Gln Tyr Ser

225 230 235 240

Ile Tyr Ala Ala Ser Tyr Arg Val Lys His Val Met Ile Thr Ser Leu

245 250 255

Phe Leu Val Leu Gly Ala Met Thr Met Thr Trp Ile Cys Asp Thr Ile

260 265 270

Ser Glu Ser Gly Phe Gly His Gly Ser Ser Leu Ile Ile Cys Val Gly

275 280 285

Ile Leu Thr Gly Tyr Thr Asp Thr Leu His Lys Met Leu Thr Gln Phe

290 295 300

Ser Gly Asn Trp Tyr Ser Cys Trp Pro Tyr Ile Leu Gly Ile Ala Gly

305 310 315 320

Thr Phe Ile Leu Val Thr Met Gly Ala Val Leu Val Thr Glu Gly Cys

325 330 335

Arg Lys Ile Lys Leu Gln Tyr Tyr Gly Phe Lys Leu Ala Ser Gly Ala

340 345 350

Arg Ser Glu Ser Ser Pro Val Thr Glu Val Glu Pro Tyr Ile Pro Phe

355 360 365

Asn Ile Asn Pro Thr Gly Met Gln Pro Leu Leu Thr Thr Ser Tyr Leu

370 375 380

Leu Ala Phe Pro Ser Ile Met Ala Ser Ile Phe Gly Thr Gln Phe Trp

385 390 395 400

Glu Ser Leu Lys Glu Thr Leu Asn Pro Lys Thr Ser Val Gly Gly Gly

405 410 415

Pro Trp Val Tyr Tyr Leu Thr Tyr Ala Phe Leu Val Phe Val Phe Asn

420 425 430

Ile Phe Asp Ile Ala Asn Leu Pro Lys Glu Ile Ser Asp Tyr Leu Asn

435 440 445

Lys Met Ser Ala Arg Val Pro Lys Ile Lys Pro Gly Arg Ala Thr Val

450 455 460

Glu Tyr Leu Thr Lys Ile Gln Thr Ser Thr Arg Phe Trp Gly Gly Ile

465 470 475 480

Leu Leu Ser Leu Leu Ala Thr Ser Ser Leu Leu Leu Asp Arg Tyr Leu

485 490 495

Arg Gln Ile Asn Glu Gly Phe Ser Ile Gly Phe Thr Ser Val Leu Ile

500 505 510

Ile Val Gly Ser Ile Ile Glu Leu Arg Arg Ser Tyr Gln Ala Tyr Asn

515 520 525

Val Met Pro Ala Leu Ser Lys Val Leu Arg Arg Tyr Gly Ala

530 535 540

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

cgccatgccg cactcactct 20

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

tggtcaaccc gccagcctct 20

<210> 6

<211> 36

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

cggagctagc tctagaatgc cgcactcact ctccct 36

<210> 7

<211> 36

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

tgctcaccat ggatccggca ccatatctcc ttagaa 36

Claims (10)

1. a kind of gene, it is characterised in that：The gene be it is following 1) or 2) or 3) or 4) shown in DNA molecular：

1) DNA molecular shown in SEQ ID NO.1；

2) DNA molecular shown in SEQ ID NO.2；

1) or 2) 3) hybridize under strict conditions with the DNA sequence dna limited and the DNA for encoding albumen described in SEQ ID NO.3 divides Son；

1) or 2) or 3) 4) there is 90% or more homology with the DNA sequence dna limited, and encodes the DNA of Starch synthesis GAP-associated protein GAP Molecule.

2. the protein of gene code described in claim 1.

3. a kind of protein, it is characterised in that any shown in such as (a) or (b)：

(a) protein that amino acid sequence forms shown in SEQ ID NO.3；

(b) by the amino acid sequence of SEQ ID NO.3 by one or several amino acid residues substitution and/or missing and/or Addition and with the relevant protein derived from SEQ ID NO.3 of Starch synthesis.

4. the recombinant expression carrier, expression cassette, transgenic cell line containing gene described in claim 1 or recombinant bacterium.

5. recombinant expression carrier according to claim 4, it is characterised in that：The recombinant expression carrier be The recombination that gene obtains described in claim 1 is inserted between the multiple cloning sites XbaI and BamHI of pCAMBIA1305-GFP carriers Plasmid.

6. expanding described in the overall length of gene or the primer pair of its arbitrary segment or finely positioning claim 1 described in claim 1 Positioning primer involved by gene.

7. gene described in claim 1, protein described in Claims 2 or 3, recombinant expression carrier, expression described in claim 4 The application of at least one of box, transgenic cell line or recombinant bacterium in plant breeding.

8. application according to claim 7, it is characterised in that the plant is monocotyledon or dicotyledon.

9. a kind of method for cultivating the normal genetically modified plants of Starch synthesis, is to close channel genes starch described in claim 1 At in abnormal plant, obtaining the normal genetically modified plants of Starch synthesis.

10. according to the method described in claim 9, it is characterized in that：Gene described in claim 1 passes through claim 4 or 5 institutes Recombinant expression carrier is stated to import in the plant of Starch synthesis exception.