CN106350525B

CN106350525B - A kind of rice grain shape gene DSS and its coding protein and application

Info

Publication number: CN106350525B
Application number: CN201610985544.7A
Authority: CN
Inventors: 万建民; 江玲; 张胜忠; 冯志明; 牟昌龄; 刘世家; 刘喜; 田云录; 赵志刚; 王益华; 刘裕强; 陈亮明
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2016-11-09
Filing date: 2016-11-09
Publication date: 2019-05-14
Anticipated expiration: 2036-11-09
Also published as: CN106350525A

Abstract

The invention discloses a kind of rice grain shape gene DSS and its coding protein and applications.The nucleotide sequence for the gene (DSS) that the present invention clones is as shown in SEQ ID NO:1, and amino acid sequence is as shown in SEQ ID NO:3.The present invention passes through clone to rice grain shape gene (DSS) and identification, the expression analysis of gene, verify its function, it was found that overexpression DSS can be such that mutant dss seed increases, it is restored to wild type size, and the expression of the gene is inhibited wild type seeds a degree of can be made to become smaller, it is seen that the gene has certain effect in terms of yield and quality of rice breeding.

Description

A kind of rice grain shape gene DSS and its coding protein and application

Technical field

The invention belongs to genetic engineering fields, and in particular to a kind of gene DSS for controlling rice grain shape and its coding egg White matter and application.

Background technique

Rice is important cereal crops, it provides the Energy intaking demand of world population about 21%.In recent years, rice The increase of per unit area yield encounters bottleneck, how rice is improved under the case where Monitoring of Paddy Rice Plant Area is basically unchanged or is declined year by year Total output, Ensuring Food Safety are the significant challenges currently faced.The yield of rice by number of productive ear, number of grain per ear and Grain waits factors compositions again, and seed size is the direct determinant of rice grain weight.Seed size not only influences rice yield, It is an important quality trait.Large number of and widely distributed with crowd that rice is food, people can be according to oneself hobby And folkways and customs select the type of edible rice.For example, the people in the U.S., southern china and most of Asian countries likes seed Elongated rice varieties, and the resident on the ground such as South Korea, Japan and north of China then prefers the short and round rice varieties of seed.Cause This illustrates the regulatory mechanism of seed size and is to improve rice yield and improvement rice quality using desirable genes in breeding One Critical policies.

The grain shape character of rice includes grain length, grain is wide, grain is thick and the mutual ratio between them.Typically now think grain The heredity long, grain is wide and grain is thick is all by controlled by multiple genes.Grain shape related gene is divided or is extended by regulating cell, influences grain husk The processes such as the grouting of the size of shell and seed determine the size and shape of seed, the final yield for influencing crop.Most of water Grain of rice type gene is grain shape QTLs to be detected by building genetic group, then carry out what finely positioning was found by backcross population, Such as GS3, GW2, GS5, GW6a etc..Other participates in the gene of regulation hormone-content and signal transduction, also assists in rice grain The regulation of type, such as D1, D2, BRD2, ARF2, GN1a etc..

Although having the report of many grain shape related genes at this stage, really use production in practice and it is few, study carefully Its reason is mainly that rice grain shape is an extremely complex character, by polygenic regulation, and its research is led at this stage Still the clone that concentrate on individual gene also knows little about it to their complicated regulated and control networks.Therefore for rice grain shape On the one hand research needs us to study the interaction between clone gene and regulated and control network, on the other hand then need us gram Grand more grain shape genes, to disclose the molecular mechanism of grain shape regulation more fully hereinafter.

Summary of the invention

It is an object of the invention to disclose the nucleotide sequence of rice grain shape related gene DSS a kind of.Its nucleotide sequence As shown in SEQ ID NO.1, contain 7550bp.

Second object of the present invention also provides the protein sequence of the rice grain shape related gene DSS coding, amino Acid sequence contains 473 amino acid as shown in SEQ ID NO.3.

The encoding gene of the protein be preferably it is following 1) or 2) or 3) described in DNA molecular:

1) DNA molecular shown in SEQ ID NO.1；

2) DNA molecular shown in SEQ ID NO.2；

1) or 2) 3) hybridize under strict conditions with the DNA sequence dna limited and the DNA molecular of encoding said proteins；

1) or 2) or 3) 4) there is 90% or more homology, and coded plant grain shape GAP-associated protein GAP with the DNA sequence dna limited DNA molecular.

Recombinant expression carrier containing any description above gene also belongs to protection scope of the present invention.

The recombinant expression carrier of the gene can be contained with existing plant expression vector construction.

The plant expression vector includes double base agrobacterium vector and the carrier etc. that can be used for plant micropellet bombardment.The plant Object expression vector also may include 3 ' end untranslated regions of foreign gene, that is, include polyadenylation signals and any other participation The DNA fragmentation of mRNA processing or gene expression.The bootable polyadenylic acid of polyadenylation signals is added to the 3 ' of mRNA precursor End, as Agrobacterium crown gall nodule induces (Ti) plasmid gene (such as kermes synzyme Nos gene), plant gene (such as soybean storage egg White gene) 3 ' end transcription non-translational region all have similar functions.

It, can be plus any one before its transcription initiation nucleotide when using the gene constructed recombinant plant expression vector Enhanced promoter or constitutive promoter, such as the ubiquitin promoter of cauliflower mosaic virus (CAMV) 35S promoter, corn (Ubiquitin), they can be used alone or are used in combination with other plant promoters；In addition, using gene of the invention When constructing plant expression vector, enhancer, including translational enhancer or transcriptional enhancer also can be used, these enhancer regions can To be ATG initiation codon or neighboring region initiation codon etc., but must be identical as the reading frame of coded sequence, it is whole to guarantee The correct translation of a sequence.The source of the translation control signal and initiation codon be it is extensive, can be it is natural, can also To be synthesis.Translation initiation region can come from transcription initiation region or structural gene.

For the ease of transgenic plant cells or plant are identified and screened, plant expression vector used can be carried out Processing, as be added the coding that can be expressed in plant can produce color change enzyme or luminophor gene (gus gene, Luciferase genes etc.), resistant antibiotic marker (gentamicin marker, kanamycins marker etc.) or anti- Chemical reagent marker gene (such as anti-herbicide gene).From the security consideration of genetically modified plants, any selectivity can be not added Marker gene directly screens transformed plant with adverse circumstance.

The recombinant expression carrier can be recombination over-express vector or recombination interference carrier

Recombinating over-express vector can be in the weight with restriction enzyme KpnI and SpeI double digestion carrier pCAMBIA1390 The recombinant plasmid that the gene (DSS) obtains is inserted into group site.PCAMBIA1390 containing DSS is named as pCAMBIA1390-DSS。

Recombinating interference carrier can be in Kpn I and Sac the I recombination site and Mlu I of LH-FAD2-1390RNAi carrier The recombinant plasmid that the Partial Fragment for being inserted into the gene (DSS) respectively with BamH I recombination site obtains.By the LH- containing DSS FAD2-1390RNAi is named as LH-FAD2-1390RNAi-DSS.

Expression cassette and recombinant bacterium containing any description above gene (DSS) all belong to the scope of protection of the present invention.

The primer pair for expanding the gene (DSS) overall length or any segment also belongs to protection scope of the present invention, described Primer pair preferred Primer1/Primer2, Primer3/Primer4, Primer5/Primer6 and Primer7/Primer8；Its Middle Primer1 sequence is as shown in SEQ ID NO.4, and Primer2 sequence is as shown in SEQ ID NO.5, Primer3 sequence such as SEQ Shown in ID NO.6, Primer4 sequence is as shown in SEQ ID NO.7, and Primer5 sequence is as shown in SEQ ID NO.8, Primer6 Sequence is as shown in SEQ ID NO.9, and Primer7 sequence is as shown in SEQ ID NO.10, Primer8 sequence such as SEQ ID NO.11 It is shown.

The positioning primer (being shown in Table 1) being related to during this gene of map based cloning, except primer I ndel3-29, RM426, Outside RM168, RM1350, RM8277 and RM3225, remaining primer is that this experiment needs and the primer of designed, designed, these voluntarily set The primer of meter also belongs to protection scope of the present invention.

The utility model has the advantages that

Rice grain shape related gene DSS of the invention can influence the size of rice grain.Under mutant background, it is overexpressed The gene can lead to rice grain shape and become larger.Under wild type background, the expression of the locus gene is inhibited to can lead to rice grain shape one Determine becoming smaller for degree.The gene and mutant can be applied to theoretical research and the genetic improvement of rice grain shape regulation, from And the yield and quality of rice is made to be further improved.

Detailed description of the invention

Fig. 1 is wild type WT (Nanjing35) and mutant dss phenotypic analysis.

The paddy comparison diagram of A wild type WT and mutant dss；

The brown rice comparison diagram of B wild type WT and mutant dss；

The average grain length of C wild type WT and mutant dss；

The average grain of D wild type WT and mutant dss is wide；

The average mass of 1000 kernel of E wild type WT and mutant dss；

The average single plant yield of F wild type WT and mutant dss；

The plant type figure in G wild type WT and mutant dss heading period；

H wild type WT and each internode of mutant dss stem and fringe comparison diagram；

Each internode of the stem of I wild type WT and mutant dss and spike length degree statistics.

Fig. 2 is the finely positioning of DSS.

Fig. 3 is over-express vector pCAMBIA1390 plasmid map.

Fig. 4 is the interference carrier LH-FAD2-1390RNAi plasmid map of Li Hui transformation.

Fig. 5 is the grain shape observation that transgenosis is overexpressed plant.

A compares dss and the plant type figure for being overexpressed plant heading period；

B compares dss and the relative expression quantity for being overexpressed DSS gene in plant；

C wild type WT, mutant dss and overexpression strain grain shape and glume cross section；

D wild type WT, mutant dss and overexpression strain lemma cross section periphery prothenchyma (of wood) number.

Fig. 6 is the grain shape observation that transgenosis interferes plant.

A compares the plant type figure after WT and transgenosis interference plant heading；

B compares the relative expression quantity of DSS gene in WT and transgenosis interference plant；

C wild type WT, mutant dss and transgenosis interference plant grain shape and glume cross section；

D wild type WT, mutant dss and transgenosis interfere plant lemma cross section periphery prothenchyma (of wood) number.

Specific embodiment

Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly What routine biochemistry reagent shop was commercially available.

Embodiment 1, the discovery for encoding rice grain shape gene

One, the acquisition of rice grain shape mutant

Rice grain shape mutant dss (decreased seed size) is that japonica rice variety Nanjing 35 passes through Co⁶⁰Radiation Screening obtains after mutagenesis.By for many years, the phenotype of multipoint relaying, dss is stablized.The method for investigating grain shape: 30 days after heading, master is taken 1/4 seed of fringe top is measured using vernier caliper is wide to the grain length and grain that do not have a seed, wild type and each 10 weight of mutant It is multiple.Investigation mass of 1000 kernel method: wild type and mutant respectively take 1000 seeds, weigh weight, are respectively repeated 5 times.Single plant is investigated to produce Amount method: it 30 days after heading, by wild type and every plant of mutant all grain harvests, weighs, is respectively repeated 10 times.By Fig. 1 It is shown, it is found that the grain length of dss, grain are wide and mass of 1000 kernel type significantly becomes smaller compared with wild type, single plant yield significantly reduces.In addition mutant The plant height of dss is significantly reduced compared with wild type, and each internode has to shorten in various degree.The tiller number of mutant dss dramatically increases.

Two, the acquisition of rice grain shape related gene

It is female parent with rice variety 9311, mutant dss is that paternal hybrid obtains F₁, later be selfed after F₂Segregating population (8000 plants).In F₂Phenotype and the extremely similar single plant of mutant dss are selected in group, extract DNA using its blade.Utilize covering SSR and the InDel label of rice genome carry out linkage analysis, and the gene of preliminary discovery control rice grain shape is present in label Between RM426 and Indel3-29.Later between RM426 and Indel3-29, designed, designed SSR and InDel is marked and is combined The phenotype of single plant further reduces positioning section, will finally reduce between a2 and Indel3-3 between positioning area, and a9 is altogether Separation marking.According to the sequence prediction of OryzasativaLcv.Nipponbare, the physical distance of the section is about 140kb, finds the section by sequencing Lack 18kb (Fig. 2)

The method of above-mentioned SSR marker analysis is as described below:

(1) total DNA of above-mentioned selection single plant is extracted as template, and the specific method is as follows:

1. the rice young leaflet tablet for taking 0.2 gram or so is placed in 2.0ml Eppendorf pipe, a steel ball is placed in pipe, The Eppendorf pipe for installing sample is freezed 5min in liquid nitrogen, is placed on 2000 type GENO/GRINDER instruments and crushes sample 1min。

2. 660 μ l extracting solutions (Tris-Hcl containing 100mM (PH 8.0), 20mM EDTA (PH 8.0), 1.4M is added The solution of NaCl, 0.2g/ml CTAB), it is acutely vortexed in vortex device and mixes, ice bath 30min.

3. 40 μ l 20%SDS, 65 DEG C of warm bath 10min, mixing of gently turning upside down every two minutes is added.

4. 100 μ l 5M NaCl are added, it is mild to mix.

5. 100 μ l 10 × CTAB, 65 DEG C of warm bath 10min are added, it is interrupted mixing of gently turning upside down.

6. 900 μ l chloroforms are added, mix well, 12000rpm is centrifuged 3min.

7. shifting supernatant into 1.5mL Eppendorf pipe, 600 μ l isopropanols are added, mix, 12000rpm centrifugation 5min。

8. abandoning supernatant, 70% (volumn concentration) ethyl alcohol of precipitating rinses primary, room temperature airing.

9. it is molten that 100 1 × TE of μ l (121 grams of Tris are dissolved in 1 liter of water, the solution obtained with hydrochloric acid tune pH value to 8.0) are added Solve DNA.

10. taking 2 μ l electrophoresis detection DNA mass, and with DU800 spectrophotometric determination concentration (Beckman Instrument Inc.U.S.A)。

(2) DNA of said extracted is diluted to about 20ng/ μ l, carries out PCR amplification as template；

PCR reaction system (10 μ l): DNA (20ng/ul) 1ul, upstream primer (2pmol/ul) 1ul, downstream primer (2pmol/ul) 1ul, 10xBuffer (MgCl₂Free) 1ul, dNTP (10mM) 0.2ul, MgCl₂(25mM) 0.6ul, rTaq (5u/ul) 0.1ul, ddH₂O5.1ul, total 10ul.

PCR response procedures: 94.0 DEG C of denaturation 5min；94.0 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, altogether Circulation 35 times；72 DEG C of extension 7min；10 DEG C of preservations.PCR reaction carries out in MJ Research PTC-225 thermal cycler.

Above-mentioned primer development process is as follows:

(1) SSR marker is developed

The SSR marker of public map is integrated with Rice Genome Sequence, downloads the BAC/PAC near mutational site Cloned sequence.With potential in SSRHunter (Li Qiang etc., heredity, 2005,27 (5): 808-810) or SSRIT software search clone SSR sequence (number of repetition >=6)；The sequence of these SSR and its neighbouring 400~500bp are existed in NCBI by blast program Line is compared with corresponding long-grained nonglutinous rice sequence, if the SSR number of repetition of the two is variant, tentatively infers the PCR of the SSR primer There are polymorphisms between Xian, round-grained rice for product；5.0 software design SSR primer of Primer Premier is recycled, and by Shanghai English fine horse Bioisystech Co., Ltd's synthesis.The pairs of primer equal proportion of the SSR of designed, designed is mixed, detects it in 9311 Hes Polymorphism between Nanjing35 shows the molecular labeling that polymorphic person is used as finely positioning DSS.Molecule a1 used for positioning, A2, a13, a15 and a19 label are shown in Table 1.

The PCR product of SSR marker detects:

Amplified production is analyzed with 8% native polyacrylamide gel electrophoresis.Using the DNA Ladder of 50bp as contrast ratio Compared with the molecular size range of amplified production, silver staining colour developing.

(2) InDel marker development

InDel design of primers: being sequenced partial sector of the 9311 and Nanjing35 near the position DSS, and It is compared, existing SNPs is used simultaneously with software design InDel label based on these SNPs between the two for discovery The corresponding another primer of 5.0 software design of Primer Premier, primer I ndel3-3 and Indel3-4 used for positioning are shown in Table 1.

The PCR reaction system of InDel labeled analysis: DNA (20ng/ul) 2ul, Primer1 (10pmol/ul) 2ul, Primer2 (10pmol/ul) 2ul, 10xBuffer (MgCl₂Free) 2ul, dNTP (10mM) 0.4ul, MgCl₂(25mM) 1.2ul, rTaq (5u/ul) 0.4ul, ddH₂O 10ul, total volume 20ul.

Amplified reaction carries out in PTC-200 (MJ Research Inc.) PCR instrument: 94 DEG C of 3min；94 DEG C of 30sec, 55 DEG C (primer different, adjusted) 45sec, 72 DEG C of 2.5min, 35 circulations；72℃5min.

PCR product purification and recovery is carried out by kit (Beijing Tiangen company) step.PCR product digestions is overnight Afterwards, it is separated by electrophoresis in the Ago-Gel of 1-4%, observes and take pictures under ultraviolet lamp after EB is dyed.DCAPS with 8% it is non- It is denaturalized PAGE glue separation, silver staining.

Table 1 is used for the molecular labeling of the assignment of genes gene mapping

(3) acquisition of grain shape gene

According to the site design primer of positioning, sequence is as described below:

Primer1:

5'—CGGGAGCGGAAGAGATTA—3'(SEQ ID NO.4)

Primer2:

5'—TCGGTAAACCTTTCTGAACTT—3'(SEQ ID NO.5)

Using primer1 and primer2 as primer, using the cDNA of Nanjing35 as template, carries out PCR amplification and obtain purpose Gene.The amplified production to primer contains whole code areas of the gene.

Amplified reaction is with KOD enzymatic amplification (be purchased from TOYOBO company), in PTC-200 (MJ Research Inc.) PCR instrument Upper progress: 94 DEG C of 2min；98 DEG C of 10sec, 60 DEG C of 30sec, 68 DEG C of 5min, 35 circulations；68℃20min.PCR product is recycled It is connected on carrier pMb18T carrier after purification (purchased from TAKARA company), conversion bacillus coli DH 5 alpha competent cell (is purchased from Tiangen company), positive colony is selected, is sequenced.

Sequencing results show that the segment that PCR reaction obtains includes nucleotide sequence shown in SEQ ID NO.2, compile The protein (see SEQ ID NO.3) of code 473 amino acid residues composition, albumen shown in SEQ ID NO.3 is named as DSS。

The acquisition and identification of embodiment 2, genetically modified plants

One, over-express vector and interference carrier building are recombinated

Using the cDNA of Nanjing35 as template, carries out PCR amplification and obtains DSS gene, PCR primer sequence is as follows:

Primer3 (sequence shown in underscore is Kpn I recombination site):

5'—TTCTGCACTAGGTACCATGCAGCGGCGGCGGGC—3'(SEQ ID NO.6)

Primer4 (sequence shown in underscore is Spe I recombination site):

5'—GGACTAGTTTAAACATCATATACGGGC—3'(SEQ ID NO.7)

Above-mentioned primer is located at the code area initial position and code area terminator position of gene shown in SEQ ID NO.2, expands Volume increase object contains the complete coding region of the gene, by PCR product recovery purifying.UsingHD Cloning Kit PCR product is cloned into carrier pCAMBIA1390 (Fig. 3) by recombination kit (Takara company).

In-Fusion recombining reaction system (10 μ L): PCR product 10-200ng is recycled through Kpn I and Spe I double digestion 2 μ L, Deionized water to of pCAMBIA1390 carrier 50-200ng, 5 × In-Fusion HD Enzyme Premix 10μL.50 DEG C of reaction 15min of mixed system are placed on ice by pipette tips piping and druming after mixing, and 2 μ L reaction system heat shock methods is taken to turn Change bacillus coli DH 5 alpha competent cell (Tiangen company).Cell will be totally converted to be uniformly coated on card containing 100mg/L that is mould On the LB solid medium of element.37 DEG C of culture 12-16h, picked clones positive colony are sequenced.

The building of interference carrier carries out PCR amplification and obtains DSS gene, PCR equally using the cDNA of Nanjing35 as template Primer sequence is as follows:

Primer5 (sequence shown in underscore is Kpn I recombination site):

5'—TTCTGCACTAGGTACCAGGCCTGGCCGTTGCTTATTGCGTTTG—3'(SEQ ID NO.8)

Primer6 (sequence shown in underscore is Sac I recombination site):

5'—CTGACGTAGGGGCGATAGAGCTCCGGTATCTAATTGCCGCTGAT—3'(SEQ ID NO.9)

Primer7 (sequence shown in underscore is BamH I recombination site):

5'—CGGGGATCCGTCGACTACGCCGTTGCTTATTGCGTTTG—3'(SEQ ID NO.10)

Primer8 (sequence shown in underscore is Mlu I recombination site):

5'—AGGTGGAAGACGCGTTACCGGTATCTAATTGCCGCTGAT—3'(SEQ ID NO.11)

The above-mentioned Primer5/6 and Primer7/8 product expanded is respectively designated as RNAi1 and RNAi2, contains this The partial coding region of gene, by PCR product recovery purifying.UsingHD Cloning Kit recombination kit PCR product is cloned into carrier LH-FAD2-1390RNAi (Fig. 4) by (Takara company).

In-Fusion recombining reaction system (10 μ L): the PCR product 10-200ng of RNAi1 uses Kpn I and Sac for the first time I double digestion recycles 2 μ L of LH-FAD2-1390RNAi carrier 50-200ng, 5 × In-Fusion HD Enzyme Premix, 50 DEG C of reaction 15min of mixed system are placed on ice by 10 μ L of Deionized water to, pipette tips piping and druming after mixing, and second The secondary LH-FAD2- that RNAi1 segment is connected with PCR product 10-200ng, the BamH I and Mlu I double digestion recycling of RNAi2 2 μ L, Deionized water to of 1390RNAi carrier 50-200ng, 5 × In-Fusion HD Enzyme Premix, 10 μ L.50 DEG C of reaction 15min of mixed system are placed on ice by pipette tips piping and druming after mixing, and take the conversion of 2 μ L reaction system heat shock methods big Enterobacteria DH5 α competent cell (Tiangen company).Cell will be totally converted and be uniformly coated on the kanamycins containing 100mg/L On LB solid medium.37 DEG C of culture 12-16h, picked clones positive colony are sequenced.

Sequencing result shows to have obtained the recombinant expression carrier containing DSS gene shown in SEQ ID NO.2, will contain DSS PCAMBIA1390 be named as pCAMBIA1390-DSS, the LH-FAD2-1390RNAi containing DSS is named as LH-FAD2- 1390RNAi-DSS。

Two, the acquisition of recombinational agrobacterium

PCAMBIA1390-DSS and LH-FAD2-1390RNAi-DSS is converted into Agrobacterium EHA105 bacterium respectively with thermal shock method Strain (is purchased from handsome company, the U.S.), obtains recombinant bacterial strain, extracts plasmid and carries out PCR and digestion identification.Just by PCR and digestion identification True recombinant bacterial strain is respectively designated as EH-pCAMBIA1390-DSS and EH-LH-FAD2-1390RNAi-DSS.

Three, the acquisition of genetically modified plants

By EH-pCAMBIA1390-DSS rice transformation mutant dss, EH-LH-FAD2-1390RNAi-DSS rice transformation Nanjing35, method particularly includes:

(1) 28 DEG C is cultivated EH-pCAMBIA1390-DSS and EH-LH-FAD2-1390RNAi-DSS16 hours, and bacterium is collected Body, and being diluted in the N6 fluid nutrient medium containing 100 μm of ol/L (Sigma company, C1416) to concentration is OD₆₀₀≈ 0.5, is obtained Obtain bacterium solution；

(2) by the 35 Mature Embryos of Rice embryo callus of mutant dss and Nanjing and step of culture to one month (1) bacterium solution mixed infection 30min, filter paper blot be transferred to after bacterium solution co-culture medium (N6 solid co-cultivation medium, Sigma company) in, 24 DEG C co-culture 3 days；

(3) callus of step (2) is seeded in containing 100mg/L paromomycin (Phyto Technology Laboratories company) N6 solid screening and culturing medium on for the first time screen (16 days)；

(4) picking health callus is transferred to programmed screening on the N6 solid screening and culturing medium containing 100mg/L paromomycin, Every 15 days subcultures are primary；

(5) picking health callus is transferred on the N6 solid screening and culturing medium containing 50mg/L paromomycin and screens for the third time, Every 15 days subcultures are primary；

(6) picking kanamycin-resistant callus tissue is transferred on differential medium and breaks up；

Obtain the T of seedling differentiation₀For positive plant.Using mutant dss and Nanjing35 as negative control.

Four, the identification of transgenic plant

1, PCR Molecular Identification

The T that step 3 is obtained₀Genomic DNA is extracted for positive plant, using genomic DNA as template, is utilized The primer on primer Primer3 and SEQ ID NO.2 near the upper SEQ ID NO.2 insertion point left margin of pCAMBIA1390 Primer4 is expanded (Primer3:5'-as primer pairTTCTGCACTAGGTACCATGCAGCGGCGGCGGGC—3' (SEQ ID NO.6) and Primer4:5'-GGACTAGTTTAAACATCATATACGGGC -3'(SEQ ID NO.7)), amplification Length 1446bp.Using on LH-FAD2-1390RNAi near SEQ ID NO.2 insertion point left margin primer Primer4 and Primer Primer5 on SEQ ID NO.2 is expanded (Primer5:5'-as primer pairTTCTGCACTAGGTACCAGG CCTGGCCGTTGCTTATTGCGTTTG -3'(SEQ ID NO.8) and Primer6:5' -CTGACGTAGGGGCGATAGAGC TCCGGTATCTAATTGCCGCTGAT -3'(SEQ ID NO.9)), amplification length 483bp.PCR reaction system: DNA (20ng/ Ul) 2ul, Primer5 (10pmol/ul) 2ul, Primer6 (10pmol/ul) 2ul, 10xBuffer (MgCl₂Free) 2ul, DNTP (10mM) 0.4ul, MgCl₂(25mM) 1.2ul, rTaq (5u/ul) 0.4ul, ddH₂O 10ul, total volume 20ul.Amplification is anti- It should be carried out in PTC-200 (MJ Research Inc.) PCR instrument: 94 DEG C of 3min；94 DEG C of 30sec, 55 DEG C of 45sec, 72 DEG C 1min, 35 circulations；72℃5min.

With kit (Beijing Tiangen company) purification and recovery PCR product.PCR product is examined with 1% agarose electrophoresis It surveys.

2, phenotypic evaluation

Respectively by T₀In generation, turns EH-pCAMBIA1390-DSS and EH-LH-FAD2-1390RNAi-DSS plant, Nanjing35 It is planted in Agricultural University Of Nanjing's rice test station with mutant dss, cross-sectional slices observation and expression are carried out to small ear after heading Amount analysis, and investigate grain shape.As shown in Figure 5, be transferred to EH-pCAMBIA1390-DSS transgenic plant DSS-OE1 and The expression quantity of DSS significantly improves in DSS-OE2, and the size of seed is significantly increased compared with mutant dss, is restored to the water of wild type It is flat.As shown in Figure 6, the expression quantity for being transferred to DSS in the transgenic plant R4 and R7 of EH-LH-FAD2-1390RNAi-DSS is significant It reduces, seed size significantly becomes smaller compared with wild type WT.The grain shape of seed can be influenced by illustrating DSS really.

<110>Agricultural University Of Nanjing

<120>a kind of rice grain shape gene DSS and its coding protein and application

<160> 21

<210> 1

<211> 7550

<212> DNA

<213>Oryza rice (Oryza sativa var. Nipponbare)

<220>

<223>gene order of seed grain shape related gene DSS

<400> 1

aaagaaaagg gctagagtct aagaggggag agagagagag agagagagag gaaggaaccc 60

ttcgtcctcg tcgcctcact tttgtctccc actccttcgt cggcggctcg gctcggcgca 120

ggcgcagcgg ggagaagacc aaggaggagg gagaggcgga cgcgggagcg gaagagatta 180

atttccagtg gggtttgggg cgcggtgagg aggtgaggga tgcagcggcg gcgggcgcag 240

acgtgggcgg gggtggggaa gacggcgcag gcggcggcgg cgcacgcggc gctcttctgc 300

ttcacgctcc tcctcgcgct caaagtcgac ggccgcacag cctactcctg gtggtaacgc 360

tccctgctct aaaccctagc tagcaccctc ccccgtcctc cgccgccacg ggcctccgct 420

tcgatctggc ttagtggttc ccgcgagatt gcgagttggg ggtggaatta gtggctggcg 480

tagtggtttt tttggggggg tttccatcgg atgcagatgc aggctgaggg gggaatcgga 540

ctagtccttt gcgtgcggtt gagagtcgtc gcctgcttgt ggtggtctgg tgaactaatt 600

ttctccacca gaacgattca gctctttcgt gtccttgtgt ttggacattg atgagttgat 660

gtaggcattt tgctcacgca gagggtgtgc ttcggttagt ctttagctga tgctgggcca 720

cagttcctgg ttctactgaa ggctgcactt tgagagctcg ttcttatttg gttatgtatt 780

tgtttgagta acccagcgct cttgttccta taatgatggt agcagattca gaagacattg 840

ttgactgctt tgtctgtagc agtgaaggta ttaataccga atgctaattc tgctatttcc 900

atcatgcagg attatattca tccctctatg gctatttcat ggcattgttg cccgtggaag 960

gttttcaatg ccagcccctt cgcttcctca tggccgtcat gtaagaattg gtatcaattt 1020

ctctagttag tatgcacgtg cttaccccac attttgatct gatgggtttc tatttgtatg 1080

tagtgggctc cttgccattc aattgttgca gcgccgttgc ttattgcgtt tgagctgctg 1140

ctttgcatat atctcgaaag tttgagaggt aggttcttag gttatctaga tgagagaagc 1200

tttggcgacc ataaacgaat ttcctggagg ctcttatacc ccttctctct gtttgttctt 1260

ccgcagttaa aagtaagccg actgttgatt tgaagattgt attccttcct cttctggcct 1320

ttgaagtgat tattcttgct gacaatttca ggtaatgaat ctgaacaatt attttgcatg 1380

cctttaatac tgtatcagta aatgcacaaa cgcactacca attggcacga ttgtatgtgc 1440

cttactgttt tatctgctta tgtattctgc aagtcttaag tgctgaatgt aactagtttt 1500

tttttccaag attgtttttc tgactaagca gctagcactt ataaactgtg ccatgaactc 1560

gtaatatgtc ctaacctatt tttggttacg tctgggattg tagtaagacg acctgaccta 1620

ttgtcaaata tggtatgcac cttcaagagc agctaacgcg ttttagatta taaatttctt 1680

gcaaccaaaa gaattcaatt atctggtgtt ctgttgttct caatggccgg ttcttggtgt 1740

ctgtcttttt ctccactgga aagaatactg aaattactca actgcctctt tgtttatttt 1800

tgcacactgc ttaggctgtg ttcgccagtc cacgttccca accggaacag tacgcgcgga 1860

aaacggagcg gtccattagc gcgtaattaa ttaagtatta gctatttttt tttcaaaaat 1920

agattaattt gattttttaa gcaacttttg tatagaaact ttttgcaaaa aacacaccgt 1980

ttaacagttt gaaaagtgtg cgcgtggaaa acgagggaga ggggttggaa aaaggggtgc 2040

cgaacacagc cttagtcagg ttcaatgata tctttctgtt ggttgcaaaa taaattaatc 2100

atgatcatta tactcatatg gtttctgttg gttgcaaaat aaattaataa ttatcattat 2160

acttgacgac ttggtatgta gagggtagca ctaagtgctt gtttatcatt gcttgtttga 2220

tagcaggttg aattatctca attacaaata tactcaagtc tactgttgat attattctta 2280

gttttgttat tccgtacaac attttttttg ctacataata ataaatggtg gcattctatc 2340

caaaagttac aaatggtgtt tttaaaaggt aaatttcgca atactgaact accatttgca 2400

aaactatcgc aaaagacaca tgtttattca caattttgga gaactacact ttttagttgc 2460

aaaatgtgca gcaaaactac actcctatca gagaaacagg tctgataggt tgggccctct 2520

catcagtcat cagtatttca tccgggttgt ttctgtttct gatgcatgtg ttggttaaaa 2580

agaaacagcc tacacatgca acactgacta gtggacctag cctgtcaggc tcattggcat 2640

tttcagtaat ttagttttgt gaaacttttc acaaccaaag gtattcctcc gaaatcgtcg 2700

caaaagtgtg tttgcgattg ttttagcgat ggcttttgtc tggtttaatg aaattgaatc 2760

attgttaaaa tttagcttgt cacacaatca gtactgttgt tggtatgcaa cgcataaatt 2820

ggatgcaatt cataaagata tgtgctgacc aaatcatgaa ccttaatttg gccaaaaata 2880

tctagagata ttagttgtta atacaatagt agcgctaaag ttaatttgga tgttaacctt 2940

tatttttttt ccttgcattg gtttgactat tcagaatgtg tagagcttta atgccaggag 3000

atgaagaaag tatgagcgat gaagctattt gggagacact tcctgtgagt ataagtacta 3060

gtaactagtg gttcttttta agaaattatc tccattagct tcaatttgag cttaactttt 3120

atttactata agtaaccata cttctaccaa atcatcttat aaaaatatat tagaaacttt 3180

taaatacgat gataactaaa ttagagagct gaatatcatg caacaaaatg cattattttt 3240

cagtccattt ttagtggaat actggattgg aataatttta ttgataagaa taaatcagct 3300

gcaaggatga aagtagaatc tcatgaactt gtcaattgac gatgctgtat tttcacatta 3360

tggagcctat atgttggact tgtaccagct taatatgggt tgatgattta ttaagtttaa 3420

caaagcaaaa catatacagt gaacaaatat tcactacata atgaagtaaa ttctgttcaa 3480

agtttaagag aattaaacct tgatcagggc ttgtgtttat agaattatgg tttgatcatt 3540

tcattctatc tgatactcta tttgtcacag cagaatgtac cgatttacat tgtaatattt 3600

cacaccgatg taaagtctat gaatgaataa cattgtgtgt ggctctttta taagttatct 3660

atgatatcat atttcttatc ttgtgctgac tgccgtgttc tagaatagtg tggactatac 3720

actgttcttt tcatcttata tgacacggct tctatttgct atcagcactt ttgggttgca 3780

atttctatgg tgtttcttat agctgctaca accttcacac ttttgaagct gtctggtaaa 3840

gtttcctgga tctccttttt gttttttgac cttcattatg gcatgtccta tttgttatgt 3900

gttttcaagc actgtagact gtagagttaa aaagtttgct tccttgcaca tgactaatat 3960

tgtttgtttg tctgctaagc ctctatagtt ggtaggatat ggctttctca aaagtcgctt 4020

cattgtttac tagagtggtt gtcacaatga cattcttcta agagtgatta ggtagttgca 4080

aatgagacaa tagttactaa aacaagatta gattgtcaat taaccataaa atctggaaac 4140

attacattca gcagcttggt tttgaaagcc aggcagtttt ctactatttg gaaatggctg 4200

gtgatttcac ctgaactggc cgggtttcta tttttggcag tttaaagcat aaattcgtgc 4260

aagttaaaac tatctttagt ataagcaata caatgttgga tagagagcaa aaagatattc 4320

ctagggttcc cgtgatgtga agacccacca gctgctttcc cattcacatg catatatgca 4380

acatttttcc atggtttctc actctaaaga gtgtaatctt ccaattccca acacaaaatc 4440

gaagtcagct tctccacact gaatcaaact ccttaatgca tttcatgtgg tcgattttct 4500

ttgacgatac tttcaatttg gtgatctatt acagttcttt tttttttggt atacgcaaaa 4560

gacttgtgta gcattaagga gtttgaatgt tacatcccct gcctagctcc atatagctgg 4620

gcaactacct aatgagtagt acaagattaa ttctcgtgat acaattgtgc gacctatgtg 4680

ccagagcgat gttagaccac agattgagcc atctttgctc ctgcaacgat ccagagtctt 4740

gcctctgcgg tgattgctgc aatcaccgca tccagttcct actttcccaa ttgaaaatcc 4800

ggtccttcaa gattacccaa gcgaccagga tccatcaaag ttctgagttg ttccagttac 4860

taggggctgc tttgtctgcc tcctccatga gcttttaagt gctacttttt aaatcaaatc 4920

atttattagt tcgatgtgat aagaacaaca tgttcagcaa actatcttag attgtacaat 4980

attcaggttt ttatttctct tcggcctaat tttcctctac tctgaaatgt tttgtgatat 5040

tattattgca tgacaggtga tgttggtgct ttgggatggt gggatttgtt tataaattat 5100

gggtgagact agtctcaata gcaattttct ttattaacga gatctgttat aatataatcc 5160

agcaccttct tttttgtaca gaatcgcgga gtgttttgca tttcttgttt gtactagatg 5220

gtttaatccc atgattcata aatctcctaa tcctggggag gctagctcat catcagcggc 5280

aattagatac cgtgattggg agagtggtct tctcctccca tcactagaag atcatgaaca 5340

agagaggctc tgtggtcttc ctgacatagg aggtcacgta atgaaaatac cactggtgat 5400

tttccaagtt ttgctttgta tgcgcttgga ggtacgtgtc atttatatat ttctattggg 5460

ttacatatgg ttgataaact ggtagatgca cttgtagaca gacattggat ggggattggg 5520

gagcttccag gaattgtttt ttaattatgt catgtaacag aacacagtaa cactatttgg 5580

aaaaaatgca aaacaagaac tttgtccatt ttctgagttc gtctaggggg tcaacgcttg 5640

ttagtggctt tttatcatga gctggatcaa taataatctt gaaaacatca tttgcttttg 5700

ttttttcagg gtacgcctcc tagtgctcag tatattccga tatttgcact gttctcccca 5760

ctgtttattt tacaaggcgc tggtgtcctt ttctctctag caagattgtt ggagaaggtt 5820

gttctactat tacgaaatgg accagttagt cctaattacc ttacaatctc atcaaaagtc 5880

cgtgattgct ttgcttttct tcatcgtggt tcaaggtaat atttgatagc tattatgagc 5940

tacttctcta tatgtttgtt ttcttgttgg cttatcttac tttgcatcac acaggcttct 6000

tggttggtgg tctattgatg aaggcagcaa agaagagcaa gcccggttat tctatactga 6060

atctactggg tacatgatag ttgacttcag cctgttcata ttgttaattt agatcctatt 6120

aagctggtca agttgtttca tttcctctat gtttacagtt ctttttgcgc atccacatcc 6180

actttctata ctgatttcct gcctggttgc cttttggttt taaggtacaa cacattttgt 6240

ggctatccac ctgaggtagt caggaaaatg cctaagaggg atcttgcaga agaggttaca 6300

ttctctcttt tcattttatt attgtttacc ttattaatgt tatgtgcact ctattttatc 6360

ataatataac tattttccta cttattatct ttcaggtatg gaggctccaa gcagctttgg 6420

gagagcaatc agaaattacc aaatgtacca agcaggaatt tgaaaggctt caaaatgtac 6480

catctccttg tgacttgtga agtttcatca ttttacatta tataaattgg tgcaatacat 6540

cctatagaca tgattgagtc cattaacttg aggacatgcc atttaggtcg ctcagcttac 6600

acaataagat cacatatgtc tgagtcgttc atgtttaagg agacttatgt gatatagcct 6660

tgaaactttt agcaaactac aattttaggt accgagaaat attgaattat caagtttgtg 6720

ggttcaagtg ggacatccat acaactctaa gaaactcatt tcattttaac cttttctgtt 6780

gttttattta agaacctaag tcactacagc tctatggcac taactgaaac ttccagagag 6840

gcagagagcg ctgatgatga tctgttggtt gtctgaccgg ctctttttcc tttgttgact 6900

aagtacttcc ttttccattt caggagaagg ttctttgtag gatttgctac gagggggaga 6960

tatgcatggt cttacttcct tgccggcaca gaacattatg caagtatgtt tccagtcact 7020

tgttaagcca ctttggatgc tcttacatgt tgatttggaa ctgacagttt tgttgatggt 7080

tctgtgatag gacttgttct gataagtgca agaaatgtcc aatctgccgt gtgcccattg 7140

aagaacgcat gcccgtatat gatgtttaaa cttcgctaac tcagatgaac gttacaaatt 7200

tgtacatgtt ggttgtgcaa tgtcgcgcca tgtagtctca atcacaactt taagctgatt 7260

gaggtttgca caagttcaga aaggtttacc gaatatggag aaaatataaa gcatatcatg 7320

tctaaccaaa agcatgaaaa ggtagttgat gatcattttg ccggttacaa ttatgtactg 7380

taagtatgtc atcggtggtt ttaacttttt tttttggtga tcgatagatg ctccagttag 7440

attgtgtagc atcttctcaa gtttatgcat tgtctgaatg taaataagaa tattgtcttg 7500

tttgagtgtt gtagtgctct ttggttgaga agagtagaaa agaaaaatgt 7550

<210> 2

<211> 1422

<212> DNA

<213>Oryza rice (Oryza sativa var. Nipponbare)

<220>

<223>the CDS sequence of seed grain shape related gene DSS

<400> 2

atgcagcggc ggcgggcgca gacgtgggcg ggggtgggga agacggcgca ggcggcggcg 60

gcgcacgcgg cgctcttctg cttcacgctc ctcctcgcgc tcaaagtcga cggccgcaca 120

gcctactcct ggtggattat attcatccct ctatggctat ttcatggcat tgttgcccgt 180

ggaaggtttt caatgccagc cccttcgctt cctcatggcc gtcattgggc tccttgccat 240

tcaattgttg cagcgccgtt gcttattgcg tttgagctgc tgctttgcat atatctcgaa 300

agtttgagag ttaaaagtaa gccgactgtt gatttgaaga ttgtattcct tcctcttctg 360

gcctttgaag tgattattct tgctgacaat ttcagaatgt gtagagcttt aatgccagga 420

gatgaagaaa gtatgagcga tgaagctatt tgggagacac ttcctcactt ttgggttgca 480

atttctatgg tgtttcttat agctgctaca accttcacac ttttgaagct gtctggtgat 540

gttggtgctt tgggatggtg ggatttgttt ataaattatg gaatcgcgga gtgttttgca 600

tttcttgttt gtactagatg gtttaatccc atgattcata aatctcctaa tcctggggag 660

gctagctcat catcagcggc aattagatac cgtgattggg agagtggtct tctcctccca 720

tcactagaag atcatgaaca agagaggctc tgtggtcttc ctgacatagg aggtcacgta 780

atgaaaatac cactggtgat tttccaagtt ttgctttgta tgcgcttgga gggtacgcct 840

cctagtgctc agtatattcc gatatttgca ctgttctccc cactgtttat tttacaaggc 900

gctggtgtcc ttttctctct agcaagattg ttggagaagg ttgttctact attacgaaat 960

ggaccagtta gtcctaatta ccttacaatc tcatcaaaag tccgtgattg ctttgctttt 1020

cttcatcgtg gttcaaggct tcttggttgg tggtctattg atgaaggcag caaagaagag 1080

caagcccggt tattctatac tgaatctact gggtacaaca cattttgtgg ctatccacct 1140

gaggtagtca ggaaaatgcc taagagggat cttgcagaag aggtatggag gctccaagca 1200

gctttgggag agcaatcaga aattaccaaa tgtaccaagc aggaatttga aaggcttcaa 1260

aatgagaagg ttctttgtag gatttgctac gagggggaga tatgcatggt cttacttcct 1320

tgccggcaca gaacattatg caagacttgt tctgataagt gcaagaaatg tccaatctgc 1380

cgtgtgccca ttgaagaacg catgcccgta tatgatgttt aa 1422

<210> 3

<211> 473

<212> PRT

<213>Oryza rice (Oryza sativa var. Nipponbare)

<220>

<223>amino acid sequence of seed grain shape related gene DSS

<400> 3

Met Gln Arg Arg Arg Ala Gln Thr Trp Ala Gly Val Gly Lys Thr

1 5 10 15

Ala Gln Ala Ala Ala Ala His Ala Ala Leu Phe Cys Phe Thr Leu

20 25 30

Leu Leu Ala Leu Lys Val Asp Gly Arg Thr Ala Tyr Ser Trp Trp

35 40 45

Ile Ile Phe Ile Pro Leu Trp Leu Phe His Gly Ile Val Ala Arg

50 55 60

Gly Arg Phe Ser Met Pro Ala Pro Ser Leu Pro His Gly Arg His

65 70 75

Trp Ala Pro Cys His Ser Ile Val Ala Ala Pro Leu Leu Ile Ala

80 85 90

Phe Glu Leu Leu Leu Cys Ile Tyr Leu Glu Ser Leu Arg Val Lys

95 100 105

Ser Lys Pro Thr Val Asp Leu Lys Ile Val Phe Leu Pro Leu Leu

110 115 120

Ala Phe Glu Val Ile Ile Leu Ala Asp Asn Phe Arg Met Cys Arg

125 130 135

Ala Leu Met Pro Gly Asp Glu Glu Ser Met Ser Asp Glu Ala Ile

140 145 150

Trp Glu Thr Leu Pro His Phe Trp Val Ala Ile Ser Met Val Phe

155 160 165

Leu Ile Ala Ala Thr Thr Phe Thr Leu Leu Lys Leu Ser Gly Asp

170 175 180

Val Gly Ala Leu Gly Trp Trp Asp Leu Phe Ile Asn Tyr Gly Ile

185 190 195

Ala Glu Cys Phe Ala Phe Leu Val Cys Thr Arg Trp Phe Asn Pro

200 205 210

Met Ile His Lys Ser Pro Asn Pro Gly Glu Ala Ser Ser Ser Ser

215 220 225

Ala Ala Ile Arg Tyr Arg Asp Trp Glu Ser Gly Leu Leu Leu Pro

230 235 240

Ser Leu Glu Asp His Glu Gln Glu Arg Leu Cys Gly Leu Pro Asp

245 250 255

Ile Gly Gly His Val Met Lys Ile Pro Leu Val Ile Phe Gln Val

260 265 270

Leu Leu Cys Met Arg Leu Glu Gly Thr Pro Pro Ser Ala Gln Tyr

275 280 285

Ile Pro Ile Phe Ala Leu Phe Ser Pro Leu Phe Ile Leu Gln Gly

290 295 300

Ala Gly Val Leu Phe Ser Leu Ala Arg Leu Leu Glu Lys Val Val

305 310 315

Leu Leu Leu Arg Asn Gly Pro Val Ser Pro Asn Tyr Leu Thr Ile

320 325 330

Ser Ser Lys Val Arg Asp Cys Phe Ala Phe Leu His Arg Gly Ser

335 340 345

Arg Leu Leu Gly Trp Trp Ser Ile Asp Glu Gly Ser Lys Glu Glu

350 355 360

Gln Ala Arg Leu Phe Tyr Thr Glu Ser Thr Gly Tyr Asn Thr Phe

365 370 375

Cys Gly Tyr Pro Pro Glu Val Val Arg Lys Met Pro Lys Arg Asp

380 385 390

Leu Ala Glu Glu Val Trp Arg Leu Gln Ala Ala Leu Gly Glu Gln

395 400 405

Ser Glu Ile Thr Lys Cys Thr Lys Gln Glu Phe Glu Arg Leu Gln

410 415 420

Asn Glu Lys Val Leu Cys Arg Ile Cys Tyr Glu Gly Glu Ile Cys

425 430 435

Met Val Leu Leu Pro Cys Arg His Arg Thr Leu Cys Lys Thr Cys

440 445 450

Ser Asp Lys Cys Lys Lys Cys Pro Ile Cys Arg Val Pro Ile Glu

455 460 465

Glu Arg Met Pro Val Tyr Asp Val

470 473

<210> 4

<211> 18

<212> DNA

<213>artificial sequence

<220>

<223> Primer1

<400> 4

cgggagcgga agagatta 18

<210> 5

<211> 21

<212> DNA

<213>artificial sequence

<220>

<223> Primer2

<400> 5

tcggtaaacc tttctgaact t 21

<210> 6

<211> 33

<212> DNA

<213>artificial sequence

<220>

<223> Primer3

<400> 6

ttctgcacta ggtaccatgc agcggcggcg ggc 33

<210> 7

<211> 27

<212> DNA

<213>artificial sequence

<220>

<223> Primer4

<400> 7

ggactagttt aaacatcata tacgggc 27

<210> 8

<211> 43

<212> DNA

<213>artificial sequence

<220>

<223> Primer5

<400> 8

ttctgcacta ggtaccaggc ctggccgttg cttattgcgt ttg 43

<210> 9

<211> 44

<212> DNA

<213>artificial sequence

<220>

<223> Primer6

<400> 9

ctgacgtagg ggcgatagag ctccggtatc taattgccgc tgat 44

<210> 10

<211> 38

<212> DNA

<213>artificial sequence

<220>

<223> Primer7

<400> 10

cggggatccg tcgactacgc cgttgcttat tgcgtttg 38

<210> 11

<211> 39

<212> DNA

<213>artificial sequence

<220>

<223> Primer8

<400> 11

aggtggaaga cgcgttaccg gtatctaatt gccgctgat 39

<210> 12

<211> 21

<212> DNA

<213>artificial sequence

<220>

<223>a13 upstream primer

<400> 12

aggcgattcc catttgcttg c 21

<210> 13

<211> 22

<212> DNA

<213>artificial sequence

<220>

<223>a13 downstream primer

<400> 13

agcagcgagg agggagaaga gg 22

<210> 14

<211> 25

<212> DNA

<213>artificial sequence

<220>

<223>Indel3-4 upstream primer

<400> 14

cattctaaat gtgaccgtta tgtcc 25

<210> 15

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>Indel3-4 downstream primer

<400> 15

gtaccgggtc gctttgttct 20

<210> 16

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>Indel3-3 upstream primer

<400> 16

gtggggaaca ggtttgaccg 20

<210> 17

<211> 19

<212> DNA

<213>artificial sequence

<220>

<223>Indel3-3 downstream primer

<400> 17

tgcagcgttt tcgcatcgt 19

<210> 18

<211> 22

<212> DNA

<213>artificial sequence

<220>

<223>a15 upstream primer

<400> 18

acggctccac gagaacatct gg 22

<210> 19

<211> 21

<212> DNA

<213>artificial sequence

<220>

<223>a15 downstream primer

<400> 19

ctgctgcgga attgagcttg g 21

<210> 20

<211> 22

<212> DNA

<213>artificial sequence

<220>

<223>a1 upstream primer

<400> 20

caggatcgga caggatcaca gg 22

<210> 21

<211> 22

<212> DNA

<213>artificial sequence

<220>

<223>a1 downstream primer

<400> 21

gctcctggcg cagctataga cc 22

<210> 22

<211> 23

<212> DNA

<213>artificial sequence

<220>

<223>a2 upstream primer

<400> 22

tccacgtgtt atcctctctt tgc 23

<210> 23

<211> 22

<212> DNA

<213>artificial sequence

<220>

<223>a2 downstream primer

<400> 23

ccagattcct gcgttgtaca gg 22

<210> 24

<211> 23

<212> DNA

<213>artificial sequence

<220>

<223>a19 upstream primer

<400> 24

aagtgaggcg acgaggacga agg 23

<210> 25

<211> 23

<212> DNA

<213>artificial sequence

<220>

<223>a19 downstream primer

<400> 25

aaacgcaacg cacagaagga agg 23

<210> 26

<211> 21

<212> DNA

<213>artificial sequence

<220>

<223>Indel3-9 upstream primer

<400> 26

tgtcatcgtt gcatgtttgt t 21

<210> 27

<211> 21

<212> DNA

<213>artificial sequence

<220>

<223>Indel3-9 downstream primer

<400> 27

cagcagttct cgcatagtcc t 21

<210> 28

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>RM426 upstream primer

<400> 28

atgagatgag ttcaaggccc 20

<210> 29

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>RM426 downstream primer

<400> 29

aactctgtac ctccatcgcc 20

<210> 30

<211> 21

<212> DNA

<213>artificial sequence

<220>

<223>RM168 upstream primer

<400> 30

tgctgcttgc ctgcttcctt t 21

<210> 31

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>RM168 downstream primer

<400> 31

gaaacgaatc aatccacggc 20

<210> 32

<211> 23

<212> DNA

<213>artificial sequence

<220>

<223>RM1350 upstream primer

<400> 32

aggaacaccc aagagagtca tgc 23

<210> 33

<211> 22

<212> DNA

<213>artificial sequence

<220>

<223>RM1350 downstream primer

<400> 33

gcaagaaagc tctgctccat gc 22

<210> 34

<211> 25

<212> DNA

<213>artificial sequence

<220>

<223>RM8277 upstream primer

<400> 34

cagcagagac tatagacact caagc 25

<210> 35

<211> 24

<212> DNA

<213>artificial sequence

<220>

<223>RM8277 downstream primer

<400> 35

tgcctagcta ctctaggtga aacc 24

<210> 36

<211> 23

<212> DNA

<213>artificial sequence

<220>

<223>RM3225 upstream primer

<400> 36

gatagaggat tgggtgcgtg tgc 23

<210> 37

<211> 23

<212> DNA

<213>artificial sequence

<220>

<223>RM3225 downstream primer

<400> 37

tacgccaacc aattccaaac acc 23

Sequence table

1

Claims

1. a kind of rice grain shape related gene DSS or recombinant expression carrier, expression cassette or recombinant bacterium containing gene are changing water Application in the plant breeding of grain of rice type；The rice grain shape related gene DSS, nucleotide sequence such as SEQ ID NO.1 It is shown.

2. a kind of method for changing rice grain shape is that rice grain shape related gene DSS is crossed to scale in small particle mutant dss It reaches, obtains the transgenic paddy rice of grain shape increase;Or inhibit rice grain shape related gene in conventional rice kind Nanjing35 The expression of DSS obtains the transgenic paddy rice that grain shape becomes smaller；The rice grain shape related gene DSS, nucleotide sequence is such as Shown in SEQ ID NO.1.

3. according to the method described in claim 2, it is characterized by: the rice grain shape related gene DSS should by containing The recombinant expression carrier of gene is directed respectively into small particle mutant dss or conventional rice Nanjing35.