CN112226442B - Wheat grain size character related gene TaSRK, encoding protein and application thereof - Google Patents

Abstract

The invention relates to a wheat grain size character related geneTaSRKThe coding protein and the application thereof aim to obtain more abundant wheat grain size character related genes and provide more diversified wheat breeding means. The invention discloses and confirms a wheat grain size character related gene for the first timeTaSRKAnd the encoded protein TaSRK thereof; and designing and constructing corresponding amplification primer pairs, gene expression vectors and recombinant bacteria. The trait gene of the invention can be applied to plant breeding. Is helpful to reveal the molecular genetic mechanism of the grain size of wheat, and lays a foundation for the application practice of wheat breeding.

Description

Wheat grain size character related gene TaSRK, encoding protein and application thereof

Technical Field

The invention relates to the technical field of molecular biology, in particular to a wheat grain size character related geneTaSRKAnd its coded protein and application.

Background

Wheat is one of the important food crops in China, and provides 50% of food energy for human beings. Based on the method, the improvement of the unit yield and the total yield of the wheat has important significance for the economic development and the grain safety of China; meanwhile, the improvement of unit yield and total yield is also one of the important targets for long-term pursuit of wheat breeders in China.

At present, the grain size related genes of wheat are cloned from mode crop rice in a homologous cloning mode, and then a part of cloning is carried out to verify whether the genes have functional characteristics. Rice is one of the model crops, and research on grain size is greatly advanced. Genes related to grain size and grain weight are isolated mainly by methods of quantitative genetics and map-based cloning.

The mechanisms of such research are mainly related to the following pathways: through ubiquitin-mediated proteasomeGW2andGW5/qSW5) Degradation and G protein signaling pathwayGS3AndDEP1) Related pathway of transcription controlGS2) Plant hormoneTGW6、CKX2、GS6AndGnp4/LAX2) The four routes, and other unknown routesGS5AndGW8). Whereas wheat has a large, complex genome. Based on the isotency and collitency of the genes, comparative genomics provides the possibility of cloning sequence-conserved genes between different cereal crops.

Several genes related to grain size were isolated from common wheat by homologous cloning. For example, encoding common wheat sucrose synthase 2 #TaSus2) The gene encoding a putative cytokinin oxidase [ ] geneTaCKX2.1AndTaCKX2.2) Cell wall sucrose invertase geneTaCwi-A1Etc. were successfully cloned and chromosome localized. Controlling grain width and grain weight of wheatTaGW2AndTaGW7geneThey were also isolated from homologous clones, which negatively regulate wheat grain width and thousand kernel weight.TaDA1Gene (DA 1-RELATED 1) as negative regulator of wheat grain size and method for preparing the sameTaGW2The interaction affects the weight of wheat kernels and has an additive genetic effect. Homologous cloning of wheat grain size related genesTaGS5-A1It has also been confirmed that it is associated with grain size, thousand kernel weight, plant height, etc., and has found that superior genotypes are found which allow grain to be increasedTaGS5-A1bOr (b)TaGS5-3A-TCan be applied to wheat high-yield breeding.

However, the development of new genes related to the grain size traits of wheat has been slow, and so far, cloning of new genes related to the grain size of wheat has been reported freshly, which also limits the application thereof in breeding. Therefore, a new way is developed to separate and obtain new grain size related genes and research the functions of the genes, and the method has important significance for analyzing the molecular mechanism behind the grain size of wheat.

Disclosure of Invention

The invention aims to provide a wheat grain size character related geneTaSRKThe coding protein and the application thereof can obtain more abundant wheat grain size character related genes and provide more diversified wheat breeding means.

In order to solve the technical problems, the invention adopts the following technical scheme:

screening to obtain a wheat grain size character related geneTaSRKThe nucleotide sequence of the genome is shown as SEQ ID NO. 1; the full-length cDNA nucleotide sequence is shown as SEQ ID NO. 2; the CDS nucleotide sequence is shown as SEQ ID NO. 3.

A wheat grain size character related protein TaSRK has the amino acid sequence as follows:

(1) An amino acid sequence as shown in SEQ ID NO. 4; or (b)

(2) Addition, deletion or substitution of one or more amino acids based on the amino acid sequence shown in SEQ ID NO.4 to obtain the sequence of the active fragment or the conservative variant.

The primer pair for amplifying the genes has the following full nucleotide sequence:

TaSRK-1F：5’-TGATTTACACTCGTTCCAACCA-3’；

TaSRK-1R: 5'-CTTCCGGAACGACAGGCACG-3'; or (b)

TaSRK-2F：5’- ATGTCTGTCCCGCGTCCCATTG-3’；

TaSRK-2R：5’- CTAGGTGCATGCTGAGTGTG-3’。

An expression vector comprising the gene construct of any one of the above and a recombinant bacterium constructed from the expression vector are designed. When the gene of the invention is used for constructing a plant expression vector, any one of enhanced promoters or inducible promoters can be added before transcription initiation nucleotides; to facilitate identification and selection of transgenic plant cells or plants, the vectors used may be processed, for example by adding plant selectable markers (GUS gene, luciferase gene, etc.) or antibiotic markers (gentamicin, kanamycin, etc.) that are resistant.

Use of any of the genes in the preparation of transgenic plant cells. Use of any one of the genes and/or the proteins in plant breeding. Carrying the inventionTaSRKThe expression vector of (2) may be obtained by transforming plant cells or tissues by using Ti plasmid, ri plasmid, plant viral vector, direct DNA transformation, microinjection, conductance, agrobacterium-mediated and other conventional biological methods, and cultivating the transformed plant tissues into plants; the host to be transformed may be either a monocot or a dicot.

Compared with the prior art, the invention has the main beneficial technical effects that:

1. the invention firstly discloses and confirms a brand new wheat grain size related gene which is named asTaSRKThe related genes of the grain size of the wheat are clarifiedTaSRKThe gene is positioned on wheat chromosome 2A, the length of the coding frame is 2508bp, and the expressed protein can regulate the grain length and grain weight of wheat.

2. The invention is helpful for revealing the molecular genetic basis of the grain size of wheat, plays an important role in improving the wheat yield and cultivating high-yield wheat varieties rapidly and efficiently by utilizing the genetic engineering technology, and lays a foundation for the application practice of wheat breeding.

Drawings

FIG. 1 is a schematic view ofTaSRKGraphs of relative expression levels in Yunong 201 (Yn 201) and Yunong 3114 (Yn 3114) at different stages of seed development;

FIG. 2 is a schematic view ofTaSRKRelative expression profile in the over-expressed transgenic lines (OE-1, OE-2 and OE-3) and control round 987 (Lx 987);

FIG. 3 is a plasmid map of the pLGY-02 vector;

FIG. 4 is a plot of the field phenotype during heading or flowering of the over-expressed transgenic lines (OE-1, OE-2, and OE-3) versus the control (Lx 987);

FIG. 5 is a graph comparing the different stages of seed development of the over-expressed transgenic lines (OE-1, OE-2 and OE-3) with the control (Lx 987);

FIG. 6 is a graph of a statistical comparison of grain length, grain width, grain size and grain weight in over-expressed transgenic lines (OE-1, OE-2 and OE-3) versus control (Lx 987).

Detailed Description

The following examples are given to illustrate the invention in detail, but are not intended to limit the scope of the invention in any way.

The instruments and devices referred to in the following examples are conventional instruments and devices unless otherwise specified; the related reagents are all conventional reagents on the market unless specified; the test methods are conventional, unless otherwise specified.

The quantitative tests in the following examples were all set up in triplicate and the results averaged. Primer synthesis and sequencing work were all done by the biological engineering (Shanghai) Co., ltd.

Example 1: wheat grain size character related geneTaSRKAcquisition of (a)

The wheat grain size trait related gene mining is carried out by adopting forward genetics and transcriptome sequencing, and the specific steps are as follows:

(1) The method comprises the following steps of (1) carrying out investigation on grain length, grain width, thousand grain weight and grain weight of 14 environmental points in 3 years on a natural population constructed by 163 parts of wheat resources from Huang-Huai wheat region; the above materials were subjected to Genome-wide association analysis (Genome-wide association study, GWAS) of the grain size trait in wheat in combination with data of a wheat 90K gene chip.

As a result, 4 significant SNP sites related to grain size were identified, which were Tdurum_contig27861_306, wsnp_Ex_c42720_49228237, RAC875_c69068_71, wsnp_Ku_c2413_4626451, respectively, located in the 504278926 ～ 526300474 segment on the 2A chromosome.

(2) Mutagenesis treatment of high quality noodle wheat variety Yunong 201 seed with 0.8% Ethyl Methylsulfonate (EMS) from 2000M ₂ Screening out one wheat strain with different strain types, long grains and high grain weight from the generation mutagenesis population, and obtaining M after 4 times of continuous selfing ₆ The stable strain Yunong 3114. The high yield of Yunong 3114 grains (7.5 cm/10 grains) and thousand grain weight (45.1 g) increased significantly, whereas the wild-type Yunong 201 had 10 grain lengths and thousand grain weights of 6.4 cm and 39.7g, respectively.

In 2011-2012, yunong 201 (Yn 201) and Yunong 3114 (Yn 3114) were planted in natural soil environment without stress in Henan agricultural university teaching park (Zhengzhou: N34.9 °, E113.6 °). Sampling seeds of different development stages (7 d, 14d, 21d, 28d and 35d after flowering) of the Yunong 201 and the Yunong 3114 after flowering, and carrying out transcriptome sequencing on the sampled seeds; and performing ginseng-free splicing on the transcripts.

The bioinformatics analysis results show that: 380. the individual differences unigenies are enriched in the "recognition of pollen" pathway in Yunong 201 and Yunong 3114. 69 upregulated unigens and 54 upregulated unigens had annotated information in the Swissprot database, encoding 19 and 22 proteins, respectively. Most encode receptor protein kinase (RLK) family proteins, in particular G-type lectin receptor serine/threonine protein kinase (SRK) S-receptor-like serine/threonine protein kinase. Wherein 1 RLK protein (sp|o 64477|y2913) is encoded by 18 unigenies and 10 unigenies; chinese spring database with unigeniesThe gene was found to be located on chromosome 2A at 515292584 ～ 515295492 and located in the relevant region of the above-mentioned grain weight GWAS. Since the gene belongs to SRK family genes, the gene is named asTaSRK。

(3) To verify whether the above-mentioned difference in grain length and grain weight of the Yunong 201 and Yunong 3114 is determined by the genesTaSRKThe gene was cloned sequenced in Yunong 201 and Yunong 3114, respectively.

The method comprises the following specific steps:

1) Extraction of DNA

The DNA at seedling stage of Yunong 201 and Yunong 3114 are extracted respectively by SLS method.

2) Total RNA extraction and first strand cDNA Synthesis

And respectively extracting total RNA of seedling stage of the Yunong 201 and the Yunong 3114 by using TRIZOL reagent. Taking total RNA with quality meeting the requirement, and referring to PrimeScript ^TM The synthesis of the first strand of cDNA was performed by the RT Reagent Kit (perfect Real time) instruction.

3）TaSRKCloning and sequence analysis of genes

The nested PCR primer is designed, and TaSRK-2F and TaSRK-2R are respectively designed at two ends of an initiation codon ATG and a termination codon TAA, and are respectively as follows:

TaSRK-1F：5’-TGATTTACACTCGTTCCAACCA-3’；

TaSRK-1R：5’- CTTCCGGAACGACAGGCACG-3’；

TaSRK-2F：5’- ATGTCTGTCCCGCGTCCCATTG-3’；

TaSRK-2R：5’- CTAGGTGCATGCTGAGTGTG-3’。

using DNA of Yunong 201 and Yunong 3114 as templates, using primer pair composed of TaSRK-1F and TaSRK-1R to make PCR amplification, making PCR product undergo the process of 1% agarose gel electrophoresis, recovering, connecting to PMD18 carrier (TAKARA), and making sequencing by using manufacturer;

PCR reaction (50. Mu.l system): 10 XPCR Buffer (25. Mu.l), ddH ₂ O (9. Mu.l), dNTP (10. Mu.l), taSRK-1F (1.5. Mu.l), taSRK-1R (1.5. Mu.l), DNA (2. Mu.l), taKaRa LA Taq enzyme (1. Mu.l); PCR parameters: 94 ℃ for 4 min; followed by 94℃for 30 s,60℃for 30 s2 min 30 s at 72 ℃ for 35 cycles; and then at 72 ℃ for 10 min.

Performing PCR amplification by using cDNA of Yunong 201 and Yunong 3114 as templates and using primer pairs consisting of TaSRK-1F and TaSRK-1R to obtain PCR products as templates, performing nested PCR amplification gel running by using primer pairs consisting of TaSRK-2F and TaSRK-2R, recovering, connecting to a PMD18 vector (TAKARA), and sequencing by a worker; the PCR reaction system and parameters are the same as those described above.

Sequencing results showed that: the DNA fragment obtained by PCR amplification with the DNA of wheat Yunong 201 as a template isTaSRKThe genome level sequence of the gene is shown as a sequence table SEQ ID NO.1, the length of the genome level sequence is 3965bp, and the genome level sequence does not contain introns. The DNA fragment obtained by the first PCR amplification by taking the cDNA of wheat Yunong 201 as a template is the cDNA sequence of the TaSRK gene, as shown in SEQ ID NO.2 in a sequence table, and the length of the DNA fragment is 3965bp; the DNA fragment obtained by nested PCR amplification of the primer pair consisting of TaSRK-2F and TaSRK-2R is the complete Open Reading Frame (ORF) sequence of the TaSRK gene, as shown by SEQ ID NO.3 in a sequence table, the length of the DNA fragment is 2508bp, the DNA fragment is the 783-3290 deoxyribonucleotide sequence from the 5' end in the sequence table SEQ ID NO.1, the DNA fragment encodes the amino acid sequence shown by the sequence table SEQ ID NO.4, and the number of the amino acids is 835. Alignment of the gene sequence of Yunong 3114 with the wild-type Yunong 201 sequence revealed that at 1033 base of the gene CDS sequence, 1 nucleotide was mutated from C to T, resulting in the conversion of the translated amino acid from arginine to cysteine, as shown in SEQ ID NO. 3. SpeculationTaSRKIs a key candidate gene causing the grain length and grain weight difference of the Yunong 201 and Yunong 3114.

Example 2:TaSRKfluorescent quantitative analysis of (2)

(1) Performing fluorescence quantitative analysis on the transcriptome sequenced seeds of the Yunong 201 and the Yunong 3114 at different development stages after flowering; total RNA extraction and cDNA reverse transcription were performed as in example 1.

For TaSRKThe gene sequence design fluorescence quantitative specific primers are as follows:

TaSRK-3F：5’-ACACATGCCAAACAGTTCCC-3’；

TaSRK-4R：5’-TGACCCGGCTAAAATCCCTT-3’；

the reference gene is beta-actin (GenBank accession No. AB 181991), and the primer sequences are as follows:

β-actin-F：GTTCCAATCTATGAGGGATACACGC；

β-actin-R：GAACCTCCACTGAGAACAACATTACC。

fluorescence quantification was performed with the United states Berle Bio-Rad IQ5 Real-Time PCR Detection System. 20. Mu.L of each of the upstream and downstream primers was 0.4. Mu.L, and GoTaq qPCR Master Mix (Perfect Real Time; promega) was 10. Mu.L, and nucleic-free water was 7.2. Mu.L. PCR procedure: 95℃for 3 min,95℃for 5 s,60℃for 30 s,72℃for 30 s,40 cycles.

mu.L of the PCR reaction product was taken and electrophoresed on a 2.0% agarose gel, stained with Ethidium Bromide (EB), and UV scanned and imaged to confirm that the amplification curve was consistent. 7d of Yunong 201 seeds are used as a reference, 2 is adopted ^-△△CT Method calculationTaSRKThe relative expression amounts of the genes are shown in FIG. 1.

As shown in fig. 1, in comparison with the Yunong 201,TaSRKexpression was down-regulated in different developing seeds of Yunong 3114, conforming to the expression pattern of transcriptome data.

Example 3:TaSRKacquisition and identification of transgenic wheat

（1）TaSRKConstruction of plant overexpression vectors

According to the cloning in example 1TaSRKThe full-length cDNA sequence of (2) is designed, and a restriction enzyme BamHI and SpeI recognition sites and a protective base are respectively introduced into two ends of the primer, wherein the primer sequence is as follows:

TaSRK-5F：5’- CGGGATCCATGCCTCTCCCGGTCCTG-3’；

TaSRK-6F：5’- CGACTAGTCAGGTGCATGCTGAGTG-3’；

the expression vector pLGY-02 was selected and its vector map is shown in FIG. 2.

Cloning the 2508bp DNA fragment between the enzyme cutting sites BamHI and SpeI of plant expression vector pLGY-02 to obtain wheat-containing geneTaSRKRecombinant expression vector of gene, namedpLGY-02-TaSRK。

（2）TaSRKObtaining transgenic wheat

The pLGY-02-TaSRK is transformed into young embryo callus of wheat round-robin 987 (Lx 987) by using an agrobacterium-mediated transformation method, and transgenic wheat plants are obtained through screening, pre-differentiation and differentiation.

(3) PCR identification of transgenic wheat

Hyg-1F and Hyg-2F primer pairs T using hygromycin tag (Hyg) primers ₁ The generation transgenic plants are identified positively, and the primer sequences are as follows:

Hyg-1F：5’-CGAGTACTTCTACACAGCCATC-3’；

Hyg-2F：5’-GTCTGTCGAGAAGTTTCTGATCG -3’；

obtaining 10 positive transgenic plants in total, and obtaining T through generation ₃ The homozygous transgenic lines OE1, OE2 and OE3.

Example 4:TaSRKphenotypic identification of transgenic wheat

Fluorescent real-time quantitative PCR detection of genes using TaSRK-3F and TaSRK-4R primersTaSRKAt T ₃ The expression levels in leaves of the generation positive transgenic lines are shown in FIG. 3.

As can be seen from FIG. 3, taSRK is at T ₃ The expression level of the generation positive transgenic lines OE1, OE2 and OE3 in the leaves is obviously higher than that of the control and is about 7 times of that of the control leaves.

2019, pair T ₃ The field heading and flowering phases of the transgenic lines (OE 1, OE2, and OE 3) were investigated and recorded against control Lx 987 and the phenotypic results are shown in FIG. 4.

As can be seen from FIG. 4, T compared with the control Lx 987 plant ₃ The heading period (A) and the flowering period (B) of the transgenic lines (OE 1, OE2 and OE 3) are advanced by about 4 days.

T is taken from 7 th, 14 th, 21 th, 28 th and 35 th, d th after flowering ₃ Seeds and mature seeds of the over-expressed transgenic lines (OE 1, OE2 and OE 3) and control Lx 987 were photographed for length and width of 5 seeds at different stages of development, measured and weighed. The results are shown in fig. 5 and 6.

As can be seen from FIG. 5, the grain length of seeds at different development stages was T compared with control Lx 987 ₃ The generation of the over-expressed transgenic lines (OE 1, OE2 and OE 3) was reduced, while the variation in the grain width was not apparent.

As can be seen from FIG. 6-A, T is a function of grain length ₃ The generation overexpressing transgenic lines (OE 1, OE2 and OE 3) showed no significant differences from control Lx 987 at 7d, 14d and 21 post flowering until post grouting and seed maturation exhibited significant reductions.

As can be seen from FIG. 6-B, T ₃ The generation overexpressing transgenic lines (OE 1, OE2 and OE 3) were not significantly different from control x 987 in grain width.

As can be seen from FIG. 6-C, T is compared with control Lx 987 ₃ Seed areas of the generation overexpressing transgenic lines (OE 1, OE2, and OE 3) become smaller.

As can be seen from FIG. 6-D, T is compared with control Lx 987 ₃ The transgenic lines (OE 1, OE2 and OE 3) overexpressed in the late in the filling and in the mature seeds exhibited a significant reduction in grain weight.

In conclusion, the wheat grain size character related gene of the inventionTaSRKThe length and the grain weight of the wheat grains can be regulated and controlled, the method can be used for researching and controlling molecular mechanism of the characters related to the sizes of the wheat grains, and has important application value in the aspect of wheat breeding.

The invention is described in detail above with reference to the drawings and examples; however, it will be understood by those skilled in the art that various specific parameters in the above embodiments may be changed or related technical features may be equivalently replaced without departing from the technical concept of the present invention, so as to form a plurality of specific embodiments, which are common variation ranges of the present invention and are not described in detail herein.

Sequence listing

<110> Henan agricultural university

<120> wheat grain size character related gene TaSRK, encoding protein and application thereof

<130> 2020

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3965

<212> DNA

<213> Triticum aestivum

<400> 1

attggggtta gtatacaatt accttttttc tttcttttct gtcatattct cccctttgac 60

cattgttcaa ggtttttacc atattcatgt agccatcttg gcaacttagt aatgccactt 120

cacttccttg acctttcttg agggttttca ccctattctt gtggctaagc tgaattcatc 180

caaaaaaaca cgcaaacaat tatataatat ttcaacgtga gctcccggat gtttcgtgtc 240

ccagacaccg ctttgacctg aacacctcgt tcactcgcca tgcctctcct tctatgctcc 300

cgtcgagctc cgccaagaga tggacaagcc gtgaaattct tatcgattcc atgacgtcga 360

gattcattgc aagacacgtt ttttggaaga aaaaaatagc agcgcggtca ccatcggaga 420

aaagttccat tctactccct ccgtaactaa atataaggca ttttttatgc cctatactaa 480

ataaaaaaaa catgttacaa tttgatacaa atgtagtgtt ttttaacacg gtataaacgc 540

agatgtttac tgcacacaca cctacattat cacacgcaca gaaggagcgt tccgcgaaca 600

gcccgaatgg gcagcacaag ttgccaaccc tcgttttcac ccatgaagtc aatcctcaaa 660

tgatgattta cactcgttcc aaccatcgat tattcaaaga ctcgttttca ccaaggatgt 720

ctgtcccgcg tcccattgac caacccacgc accgtcctca cctcaacagc tctcgcctcg 780

ccatgtctgt cccgcgtccc attgaccaac ccacgcaccg tcctcacctc aacagctctc 840

gcctcgccat gcctctcccg gtcctgctcg ccctgctctg cgccctacac gcccccgcga 900

gctccgcgtc cacggcgacc tactccctct cgccaggcca gtcgctcgcc ggcgacgaca 960

agctcgtctc cggcggcggc aagttcgcgc tcggcttcat ccagatccca ggcagcgaca 1020

gcaacccctc cggctccggc ggcaacagca ctcagctggg catatggttc agcctcaacc 1080

gtgttcccaa gctgacactg gtgtgggtgg ccaacagggg aggcagcccg gtggccggcg 1140

ccgcgtcccc ggagctcacg atctccggcg acggcaacct cgtcatcgtg gaccgcggca 1200

aagtcgcctg gtccacccga gccgacgtca cagccaacaa caacaacaac agggcggtcc 1260

tccttctcct ggacaccggg aacctcgtgt tgcgcagcgc ctccaacgcc tccgacgtga 1320

tgtggcagag cttcgaccac cccacggaca ctctgctccc cggcgccacc atcgggctgg 1380

acaaggtcac cggccggagc cgccgcctcg tctccaggaa gaaccggatc gaccaggctc 1440

cgggcgccta ctccatggag ctgggccgga gcggcgtcgt ccagatgctg tgggacgcgt 1500

ccgtgcccta ctggtccagc ggggagtgga acggcgacta cttcagctcg gtgccggaga 1560

tgaccgcccg ccacctgata ggctccacct tcgtcaacga cgaccgggag gtgtccttcg 1620

cctaccacct gctcgacgaa accatcacca tgtacagctt cctggacgtg tccgggcaga 1680

ggaagatgct ggtctggcag gatgccacgc gggactgggt gacggtctac gtccacccca 1740

ccacccagtg cgaggtgcac gccgtctgcg ggccattcac ggcctgcgac gagagcgcgc 1800

cggcgccgtg cagccgcatg aaggggttct ccgtgggttc gcctgaggat tgggaccttg 1860

acgatcggag cacgagcggt tgcagaagga acactcagct gaattgtgct agcattagca 1920

acggcaccat ggttggcatg gctgacatgt tctacgccat gccggccgtc aggttaccct 1980

ataaccccca cggcgccgcg ggatatgtcg ccagcgcagc cgaatgcgag caggtctgtc 2040

tgagcaactg ctcttgcact gcatattcct ttggcagtgg tggctgttct atgtggcatg 2100

gtggattgct gaacgtaaaa caacgccaga ttgatggtgc ttcttccagc ggtgatggcg 2160

aaattcttca catccgcctc gcggcgaaag agttccggac ccggaaaaac aacagtgtag 2220

ttatcatttt ggttgccatt ggtgcaggcc tcaacgcttt ggttatcttg gtactcgtcg 2280

tagcgctacg caggaccagg aggaacaaaa ggtacagtga aacattggac aaaatccatg 2340

gtggcagtgg gcttgtttca ttcagataca gcgatttgcg gcgtgcaact agagatttct 2400

cagagaagat tggggcaggt ggttttggtt ctgtgttcaa ggggtcgcta aatgattcga 2460

ccactatagc ggtgaagagg ctttacggtt gttatcaaca agagaagcag ttcagggctg 2520

aggcgagttc aattggaatc ctccaccata caaatttagt caaaatggtt ggtttctgtt 2580

gtgagggcga caagaagctt cttgtctacg aacacatgcc aaacagttcc cttgatgccc 2640

atctgttcag gagcagtgcc aaagctctga attggagaac cagataccag atagctcttg 2700

gagttgccag ggggctggca tacttgcacg agagctgcct ggactacatc atacactgcg 2760

atataaagcc gcaaaacata cttctcgacg cgttgttcgt tcctaagatc gccgacttcg 2820

ggatggcaaa gcttctcaca agggatttta gccgggtcat gaccacaacc aggggcacaa 2880

ttgggtacct tgcccctgaa tggatcagtg gagtggccat cacgcccaaa gtcgatgtgt 2940

atggatatgg gatggtgcta ctggagatca tatccgggag gatgaacgcg aacgaagaat 3000

gcggcagcag tggtgatggc attgtttatt tccccatcca gatggcgcgc aagcttctcg 3060

agggaaacgt catgagcttc gtggatgata ggttaaacgg tgatgttatc gtcgacgagg 3120

ttgaaagggc ttgcaaggtt gcctgttggt gcattcagga cagggagttt gaacggccaa 3180

cgatgggcaa ggtagtccag attcttgagg gtcttgttga agtcgacacc cctccgatgc 3240

ctaagctact cgaagctatc gccggaagat cacactcagc atgcacctag cctggtaacc 3300

gcggacggcc gttagcgtgg cttgcattca cctggtctaa catatatgtc catgtaccag 3360

tctcaaagaa gccaagcgtc gtgcctgtcg ttccggaagc cgagcttgtc gccgctgcca 3420

agtggttggc gagctgacat ggtgtccgtc gcagcagagc ttgtcacaac gatgtgtagg 3480

tggaagatca cggtgaaaac aaagatgggt aaaagatgtg tagctattca agtacaacca 3540

tcaaattaac tagtggaggg aaaatatgtt ccaatggcga tctaagaccg gatgttaggc 3600

ttaacttagt gatgagctgc acgaccaatg ggcattacaa cgaccgacgt cgtctcgtct 3660

tcctagaata tagtactact gttcatgaac ctaaaataat ttttgtttga cagtttcctg 3720

aatgaaccta aaataagttg acagtggggc acggcgcaag aactcaagtg atctgctggc 3780

gcaacaccaa aacagcagag acaccaccag attgatgtag agtttattac gtacttccct 3840

gaatttaaca aactgaaaat gggcaagttt tgagactaac ggagggaggc tattgattgt 3900

cttttgagtg gacatgttac tactatcagt tgatgaattt tttttaaaaa aaagaggtaa 3960

aaata 3965

<210> 2

<211> 3965

<212> DNA

<213> Triticum aestivum

<400> 2

attggggtta gtatacaatt accttttttc tttcttttct gtcatattct cccctttgac 60

cattgttcaa ggtttttacc atattcatgt agccatcttg gcaacttagt aatgccactt 120

cacttccttg acctttcttg agggttttca ccctattctt gtggctaagc tgaattcatc 180

caaaaaaaca cgcaaacaat tatataatat ttcaacgtga gctcccggat gtttcgtgtc 240

ccagacaccg ctttgacctg aacacctcgt tcactcgcca tgcctctcct tctatgctcc 300

cgtcgagctc cgccaagaga tggacaagcc gtgaaattct tatcgattcc atgacgtcga 360

gattcattgc aagacacgtt ttttggaaga aaaaaatagc agcgcggtca ccatcggaga 420

aaagttccat tctactccct ccgtaactaa atataaggca ttttttatgc cctatactaa 480

ataaaaaaaa catgttacaa tttgatacaa atgtagtgtt ttttaacacg gtataaacgc 540

agatgtttac tgcacacaca cctacattat cacacgcaca gaaggagcgt tccgcgaaca 600

gcccgaatgg gcagcacaag ttgccaaccc tcgttttcac ccatgaagtc aatcctcaaa 660

tgatgattta cactcgttcc aaccatcgat tattcaaaga ctcgttttca ccaaggatgt 720

ctgtcccgcg tcccattgac caacccacgc accgtcctca cctcaacagc tctcgcctcg 780

ccatgtctgt cccgcgtccc attgaccaac ccacgcaccg tcctcacctc aacagctctc 840

gcctcgccat gcctctcccg gtcctgctcg ccctgctctg cgccctacac gcccccgcga 900

gctccgcgtc cacggcgacc tactccctct cgccaggcca gtcgctcgcc ggcgacgaca 960

agctcgtctc cggcggcggc aagttcgcgc tcggcttcat ccagatccca ggcagcgaca 1020

gcaacccctc cggctccggc ggcaacagca ctcagctggg catatggttc agcctcaacc 1080

gtgttcccaa gctgacactg gtgtgggtgg ccaacagggg aggcagcccg gtggccggcg 1140

ccgcgtcccc ggagctcacg atctccggcg acggcaacct cgtcatcgtg gaccgcggca 1200

aagtcgcctg gtccacccga gccgacgtca cagccaacaa caacaacaac agggcggtcc 1260

tccttctcct ggacaccggg aacctcgtgt tgcgcagcgc ctccaacgcc tccgacgtga 1320

tgtggcagag cttcgaccac cccacggaca ctctgctccc cggcgccacc atcgggctgg 1380

acaaggtcac cggccggagc cgccgcctcg tctccaggaa gaaccggatc gaccaggctc 1440

cgggcgccta ctccatggag ctgggccgga gcggcgtcgt ccagatgctg tgggacgcgt 1500

ccgtgcccta ctggtccagc ggggagtgga acggcgacta cttcagctcg gtgccggaga 1560

tgaccgcccg ccacctgata ggctccacct tcgtcaacga cgaccgggag gtgtccttcg 1620

cctaccacct gctcgacgaa accatcacca tgtacagctt cctggacgtg tccgggcaga 1680

ggaagatgct ggtctggcag gatgccacgc gggactgggt gacggtctac gtccacccca 1740

ccacccagtg cgaggtgcac gccgtctgcg ggccattcac ggcctgcgac gagagcgcgc 1800

cggcgccgtg cagccgcatg aaggggttct ccgtgggttc gcctgaggat tgggaccttg 1860

acgatcggag cacgagcggt tgcagaagga acactcagct gaattgtgct agcattagca 1920

acggcaccat ggttggcatg gctgacatgt tctacgccat gccggccgtc aggttaccct 1980

ataaccccca cggcgccgcg ggatatgtcg ccagcgcagc cgaatgcgag caggtctgtc 2040

tgagcaactg ctcttgcact gcatattcct ttggcagtgg tggctgttct atgtggcatg 2100

gtggattgct gaacgtaaaa caacgccaga ttgatggtgc ttcttccagc ggtgatggcg 2160

aaattcttca catccgcctc gcggcgaaag agttccggac ccggaaaaac aacagtgtag 2220

ttatcatttt ggttgccatt ggtgcaggcc tcaacgcttt ggttatcttg gtactcgtcg 2280

tagcgctacg caggaccagg aggaacaaaa ggtacagtga aacattggac aaaatccatg 2340

gtggcagtgg gcttgtttca ttcagataca gcgatttgcg gcgtgcaact agagatttct 2400

cagagaagat tggggcaggt ggttttggtt ctgtgttcaa ggggtcgcta aatgattcga 2460

ccactatagc ggtgaagagg ctttacggtt gttatcaaca agagaagcag ttcagggctg 2520

aggcgagttc aattggaatc ctccaccata caaatttagt caaaatggtt ggtttctgtt 2580

gtgagggcga caagaagctt cttgtctacg aacacatgcc aaacagttcc cttgatgccc 2640

atctgttcag gagcagtgcc aaagctctga attggagaac cagataccag atagctcttg 2700

gagttgccag ggggctggca tacttgcacg agagctgcct ggactacatc atacactgcg 2760

atataaagcc gcaaaacata cttctcgacg cgttgttcgt tcctaagatc gccgacttcg 2820

ggatggcaaa gcttctcaca agggatttta gccgggtcat gaccacaacc aggggcacaa 2880

ttgggtacct tgcccctgaa tggatcagtg gagtggccat cacgcccaaa gtcgatgtgt 2940

atggatatgg gatggtgcta ctggagatca tatccgggag gatgaacgcg aacgaagaat 3000

gcggcagcag tggtgatggc attgtttatt tccccatcca gatggcgcgc aagcttctcg 3060

agggaaacgt catgagcttc gtggatgata ggttaaacgg tgatgttatc gtcgacgagg 3120

ttgaaagggc ttgcaaggtt gcctgttggt gcattcagga cagggagttt gaacggccaa 3180

cgatgggcaa ggtagtccag attcttgagg gtcttgttga agtcgacacc cctccgatgc 3240

ctaagctact cgaagctatc gccggaagat cacactcagc atgcacctag cctggtaacc 3300

gcggacggcc gttagcgtgg cttgcattca cctggtctaa catatatgtc catgtaccag 3360

tctcaaagaa gccaagcgtc gtgcctgtcg ttccggaagc cgagcttgtc gccgctgcca 3420

agtggttggc gagctgacat ggtgtccgtc gcagcagagc ttgtcacaac gatgtgtagg 3480

tggaagatca cggtgaaaac aaagatgggt aaaagatgtg tagctattca agtacaacca 3540

tcaaattaac tagtggaggg aaaatatgtt ccaatggcga tctaagaccg gatgttaggc 3600

ttaacttagt gatgagctgc acgaccaatg ggcattacaa cgaccgacgt cgtctcgtct 3660

tcctagaata tagtactact gttcatgaac ctaaaataat ttttgtttga cagtttcctg 3720

aatgaaccta aaataagttg acagtggggc acggcgcaag aactcaagtg atctgctggc 3780

gcaacaccaa aacagcagag acaccaccag attgatgtag agtttattac gtacttccct 3840

gaatttaaca aactgaaaat gggcaagttt tgagactaac ggagggaggc tattgattgt 3900

cttttgagtg gacatgttac tactatcagt tgatgaattt tttttaaaaa aaagaggtaa 3960

aaata 3965

<210> 3

<211> 2508

<212> DNA

<213> Triticum aestivum

<400> 3

atgtctgtcc cgcgtcccat tgaccaaccc acgcaccgtc ctcacctcaa cagctctcgc 60

ctcgccatgc ctctcccggt cctgctcgcc ctgctctgcg ccctacacgc ccccgcgagc 120

tccgcgtcca cggcgaccta ctccctctcg ccaggccagt cgctcgccgg cgacgacaag 180

ctcgtctccg gcggcggcaa gttcgcgctc ggcttcatcc agatcccagg cagcgacagc 240

aacccctccg gctccggcgg caacagcact cagctgggca tatggttcag cctcaaccgt 300

gttcccaagc tgacactggt gtgggtggcc aacaggggag gcagcccggt ggccggcgcc 360

gcgtccccgg agctcacgat ctccggcgac ggcaacctcg tcatcgtgga ccgcggcaaa 420

gtcgcctggt ccacccgagc cgacgtcaca gccaacaaca acaacaacag ggcggtcctc 480

cttctcctgg acaccgggaa cctcgtgttg cgcagcgcct ccaacgcctc cgacgtgatg 540

tggcagagct tcgaccaccc cacggacact ctgctccccg gcgccaccat cgggctggac 600

aaggtcaccg gccggagccg ccgcctcgtc tccaggaaga accggatcga ccaggctccg 660

ggcgcctact ccatggagct gggccggagc ggcgtcgtcc agatgctgtg ggacgcgtcc 720

gtgccctact ggtccagcgg ggagtggaac ggcgactact tcagctcggt gccggagatg 780

accgcccgcc acctgatagg ctccaccttc gtcaacgacg accgggaggt gtccttcgcc 840

taccacctgc tcgacgaaac catcaccatg tacagcttcc tggacgtgtc cgggcagagg 900

aagatgctgg tctggcagga tgccacgcgg gactgggtga cggtctacgt ccaccccacc 960

acccagtgcg aggtgcacgc cgtctgcggg ccattcacgg cctgcgacga gagcgcgccg 1020

gcgccgtgca gccgcatgaa ggggttctcc gtgggttcgc ctgaggattg ggaccttgac 1080

gatcggagca cgagcggttg cagaaggaac actcagctga attgtgctag cattagcaac 1140

ggcaccatgg ttggcatggc tgacatgttc tacgccatgc cggccgtcag gttaccctat 1200

aacccccacg gcgccgcggg atatgtcgcc agcgcagccg aatgcgagca ggtctgtctg 1260

agcaactgct cttgcactgc atattccttt ggcagtggtg gctgttctat gtggcatggt 1320

ggattgctga acgtaaaaca acgccagatt gatggtgctt cttccagcgg tgatggcgaa 1380

attcttcaca tccgcctcgc ggcgaaagag ttccggaccc ggaaaaacaa cagtgtagtt 1440

atcattttgg ttgccattgg tgcaggcctc aacgctttgg ttatcttggt actcgtcgta 1500

gcgctacgca ggaccaggag gaacaaaagg tacagtgaaa cattggacaa aatccatggt 1560

ggcagtgggc ttgtttcatt cagatacagc gatttgcggc gtgcaactag agatttctca 1620

gagaagattg gggcaggtgg ttttggttct gtgttcaagg ggtcgctaaa tgattcgacc 1680

actatagcgg tgaagaggct ttacggttgt tatcaacaag agaagcagtt cagggctgag 1740

gcgagttcaa ttggaatcct ccaccataca aatttagtca aaatggttgg tttctgttgt 1800

gagggcgaca agaagcttct tgtctacgaa cacatgccaa acagttccct tgatgcccat 1860

ctgttcagga gcagtgccaa agctctgaat tggagaacca gataccagat agctcttgga 1920

gttgccaggg ggctggcata cttgcacgag agctgcctgg actacatcat acactgcgat 1980

ataaagccgc aaaacatact tctcgacgcg ttgttcgttc ctaagatcgc cgacttcggg 2040

atggcaaagc ttctcacaag ggattttagc cgggtcatga ccacaaccag gggcacaatt 2100

gggtaccttg cccctgaatg gatcagtgga gtggccatca cgcccaaagt cgatgtgtat 2160

ggatatggga tggtgctact ggagatcata tccgggagga tgaacgcgaa cgaagaatgc 2220

ggcagcagtg gtgatggcat tgtttatttc cccatccaga tggcgcgcaa gcttctcgag 2280

ggaaacgtca tgagcttcgt ggatgatagg ttaaacggtg atgttatcgt cgacgaggtt 2340

gaaagggctt gcaaggttgc ctgttggtgc attcaggaca gggagtttga acggccaacg 2400

atgggcaagg tagtccagat tcttgagggt cttgttgaag tcgacacccc tccgatgcct 2460

aagctactcg aagctatcgc cggaagatca cactcagcat gcacctag 2508

<210> 4

<211> 835

<212> PRT

<213> Triticum aestivum

<400> 4

Met Ser Val Pro Arg Pro Ile Asp Gln Pro Thr His Arg Pro His Leu

1 5 10 15

Asn Ser Ser Arg Leu Ala Met Pro Leu Pro Val Leu Leu Ala Leu Leu

20 25 30

Cys Ala Leu His Ala Pro Ala Ser Ser Ala Ser Thr Ala Thr Tyr Ser

35 40 45

Leu Ser Pro Gly Gln Ser Leu Ala Gly Asp Asp Lys Leu Val Ser Gly

50 55 60

Gly Gly Lys Phe Ala Leu Gly Phe Ile Gln Ile Pro Gly Ser Asp Ser

65 70 75 80

Asn Pro Ser Gly Ser Gly Gly Asn Ser Thr Gln Leu Gly Ile Trp Phe

85 90 95

Ser Leu Asn Arg Val Pro Lys Leu Thr Leu Val Trp Val Ala Asn Arg

100 105 110

Gly Gly Ser Pro Val Ala Gly Ala Ala Ser Pro Glu Leu Thr Ile Ser

115 120 125

Gly Asp Gly Asn Leu Val Ile Val Asp Arg Gly Lys Val Ala Trp Ser

130 135 140

Thr Arg Ala Asp Val Thr Ala Asn Asn Asn Asn Asn Arg Ala Val Leu

145 150 155 160

Leu Leu Leu Asp Thr Gly Asn Leu Val Leu Arg Ser Ala Ser Asn Ala

165 170 175

Ser Asp Val Met Trp Gln Ser Phe Asp His Pro Thr Asp Thr Leu Leu

180 185 190

Pro Gly Ala Thr Ile Gly Leu Asp Lys Val Thr Gly Arg Ser Arg Arg

195 200 205

Leu Val Ser Arg Lys Asn Arg Ile Asp Gln Ala Pro Gly Ala Tyr Ser

210 215 220

Met Glu Leu Gly Arg Ser Gly Val Val Gln Met Leu Trp Asp Ala Ser

225 230 235 240

Val Pro Tyr Trp Ser Ser Gly Glu Trp Asn Gly Asp Tyr Phe Ser Ser

245 250 255

Val Pro Glu Met Thr Ala Arg His Leu Ile Gly Ser Thr Phe Val Asn

260 265 270

Asp Asp Arg Glu Val Ser Phe Ala Tyr His Leu Leu Asp Glu Thr Ile

275 280 285

Thr Met Tyr Ser Phe Leu Asp Val Ser Gly Gln Arg Lys Met Leu Val

290 295 300

Trp Gln Asp Ala Thr Arg Asp Trp Val Thr Val Tyr Val His Pro Thr

305 310 315 320

Thr Gln Cys Glu Val His Ala Val Cys Gly Pro Phe Thr Ala Cys Asp

325 330 335

Glu Ser Ala Pro Ala Pro Cys Ser Arg Met Lys Gly Phe Ser Val Gly

340 345 350

Ser Pro Glu Asp Trp Asp Leu Asp Asp Arg Ser Thr Ser Gly Cys Arg

355 360 365

Arg Asn Thr Gln Leu Asn Cys Ala Ser Ile Ser Asn Gly Thr Met Val

370 375 380

Gly Met Ala Asp Met Phe Tyr Ala Met Pro Ala Val Arg Leu Pro Tyr

385 390 395 400

Asn Pro His Gly Ala Ala Gly Tyr Val Ala Ser Ala Ala Glu Cys Glu

405 410 415

Gln Val Cys Leu Ser Asn Cys Ser Cys Thr Ala Tyr Ser Phe Gly Ser

420 425 430

Gly Gly Cys Ser Met Trp His Gly Gly Leu Leu Asn Val Lys Gln Arg

435 440 445

Gln Ile Asp Gly Ala Ser Ser Ser Gly Asp Gly Glu Ile Leu His Ile

450 455 460

Arg Leu Ala Ala Lys Glu Phe Arg Thr Arg Lys Asn Asn Ser Val Val

465 470 475 480

Ile Ile Leu Val Ala Ile Gly Ala Gly Leu Asn Ala Leu Val Ile Leu

485 490 495

Val Leu Val Val Ala Leu Arg Arg Thr Arg Arg Asn Lys Arg Tyr Ser

500 505 510

Glu Thr Leu Asp Lys Ile His Gly Gly Ser Gly Leu Val Ser Phe Arg

515 520 525

Tyr Ser Asp Leu Arg Arg Ala Thr Arg Asp Phe Ser Glu Lys Ile Gly

530 535 540

Ala Gly Gly Phe Gly Ser Val Phe Lys Gly Ser Leu Asn Asp Ser Thr

545 550 555 560

Thr Ile Ala Val Lys Arg Leu Tyr Gly Cys Tyr Gln Gln Glu Lys Gln

565 570 575

Phe Arg Ala Glu Ala Ser Ser Ile Gly Ile Leu His His Thr Asn Leu

580 585 590

Val Lys Met Val Gly Phe Cys Cys Glu Gly Asp Lys Lys Leu Leu Val

595 600 605

Tyr Glu His Met Pro Asn Ser Ser Leu Asp Ala His Leu Phe Arg Ser

610 615 620

Ser Ala Lys Ala Leu Asn Trp Arg Thr Arg Tyr Gln Ile Ala Leu Gly

625 630 635 640

Val Ala Arg Gly Leu Ala Tyr Leu His Glu Ser Cys Leu Asp Tyr Ile

645 650 655

Ile His Cys Asp Ile Lys Pro Gln Asn Ile Leu Leu Asp Ala Leu Phe

660 665 670

Val Pro Lys Ile Ala Asp Phe Gly Met Ala Lys Leu Leu Thr Arg Asp

675 680 685

Phe Ser Arg Val Met Thr Thr Thr Arg Gly Thr Ile Gly Tyr Leu Ala

690 695 700

Pro Glu Trp Ile Ser Gly Val Ala Ile Thr Pro Lys Val Asp Val Tyr

705 710 715 720

Gly Tyr Gly Met Val Leu Leu Glu Ile Ile Ser Gly Arg Met Asn Ala

725 730 735

Asn Glu Glu Cys Gly Ser Ser Gly Asp Gly Ile Val Tyr Phe Pro Ile

740 745 750

Gln Met Ala Arg Lys Leu Leu Glu Gly Asn Val Met Ser Phe Val Asp

755 760 765

Asp Arg Leu Asn Gly Asp Val Ile Val Asp Glu Val Glu Arg Ala Cys

770 775 780

Lys Val Ala Cys Trp Cys Ile Gln Asp Arg Glu Phe Glu Arg Pro Thr

785 790 795 800

Met Gly Lys Val Val Gln Ile Leu Glu Gly Leu Val Glu Val Asp Thr

805 810 815

Pro Pro Met Pro Lys Leu Leu Glu Ala Ile Ala Gly Arg Ser His Ser

820 825 830

Ala Cys Thr

835

Claims (3)

1. Gene with nucleotide sequence shown as SEQ ID NO.1TaSRKThe application in negative regulation of the grain size character of wheat.

2. Gene with nucleotide sequence shown as SEQ ID NO.1TaSRKThe application in preparing wheat variety/strain with smaller grain length.

3. The nucleotide sequence is shown as SEQ ID NO.1TaSRKThe application of the gene in advancing the heading stage and/or flowering stage of wheat.

Images