CN112280784B - Rice lateral root development control gene OsLRD2, encoding protein and application thereof - Google Patents
Rice lateral root development control gene OsLRD2, encoding protein and application thereof Download PDFInfo
- Publication number
- CN112280784B CN112280784B CN202011187221.6A CN202011187221A CN112280784B CN 112280784 B CN112280784 B CN 112280784B CN 202011187221 A CN202011187221 A CN 202011187221A CN 112280784 B CN112280784 B CN 112280784B
- Authority
- CN
- China
- Prior art keywords
- oslrd2
- rice
- val
- gly
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Abstract
The invention discloses a rice lateral root development control gene OsLRD2, a coding protein and application thereof, which are characterized in that: the nucleotide sequence of the control gene OsLRD2 is shown as SEQ ID NO. 1, the amino acid sequence of the protein coded by the control gene OsLRD2 is shown as EQ ID NO. 2, and alpha tubulin is coded and is related to lateral root generation and elongation. If the base sequence is mutated, for example, a cytosine is deleted at 1176bp and the cytosine at 1179bp is mutated into adenine, the synthesis of the amino acid sequence of the protein is terminated in advance, and the amino acid sequence is shown as EQ ID NO 3. Particularly, the plant shows that the number of lateral roots is reduced and is very short, and the growth of main roots and adventitious roots is hindered to different degrees. The protein and the application of the coding gene thereof can create conditions for the improvement of the root system of rice and the development of crossbreeding or transgenic plants.
Description
Technical Field
The invention relates to a rice lateral root development control gene, in particular to a rice lateral root development control gene OsLRD2, a coding protein and application thereof.
Background
The plant root system can be mainly divided into a straight root system and a fibrous root system, the rice root system is configured into the fibrous root system, adventitious roots can be continuously generated from cells in a meristematic region of a stem node closest to a stelar canal, and finally, a plurality of adventitious roots and lateral roots form the root system structure of the rice root system. The huge lateral roots greatly increase the capacity of the rice to absorb water and mineral substances from the outside. In higher plants, lateral roots begin in a specific cell layer on the main root, the pericycle, which can be divided into two cell types depending on the vascular tissue to which they are dorsalively adjacent: in the dicotyledonous plant arabidopsis, the lateral root originates from the pericycle cell adjacent to the xylem; in cereal crops such as rice, maize, lateral roots start in pericycle cells adjacent to the primary phloem. The development process of the lateral roots of the rice is similar to that of arabidopsis thaliana, firstly two adjacent pericycle cells carry out vertical pericycle division, then carry out multiple vertical pericycle and horizontal pericycle divisions, and the primordium gradually expands and gradually passes through the cortex to finally break through the epidermis. The growth and enhancement of the lateral roots of the rice have important significance on the growth and high yield of the rice.
For example, an invention patent with an authorization publication number of CN102268081, named as rice lateral root control gene OsIAA11 and application thereof discloses rice lateral root control gene OsIAA11 and encoded protein, wherein the rice lateral root control gene OsIAA11 is a new gene cloned from Osiaa11 mutant, has a function of controlling the development of rice lateral roots, and can cultivate transgenic rice with better lateral root control function.
Disclosure of Invention
The invention aims to solve the technical problem of providing a rice lateral root generation control gene OsLRD2, a coding protein and application thereof, wherein the control gene OsLRD2 and the coding protein can regulate and control the development of rice lateral roots, so that transgenic rice for controlling the generation and growth of the lateral roots is bred.
The technical scheme adopted by the invention for solving the technical problems is as follows: rice lateral root development control gene OsLRD2, and control geneOsLRD2The total length of the DNA of (1) is 2885 bp: (OsLRD2Gene number: LOC _ Os11g 14220), the CDS has a full length of 1356bp, and the nucleotide sequence is shown as SEQ ID NO 1.
A CDS nucleotide sequence of a rice lateral root development control gene OsLRD2 is deleted with a cytosine (C) at a position of 1176bp and the cytosine (C) at a position of 1179bp is mutated into adenine (A), namely CATC → ATA, so that the mutant becomesOslrd2A rice plant.
A protein coded by a rice lateral root development control gene OsLRD2 has an amino acid sequence shown in EQ ID NO. 2.
When a cytosine (C) is deleted at 1176bp and a cytosine at 1179bp is mutated into adenine in a CDS nucleotide sequence of the control gene OsLRD2, the synthesis of an amino acid sequence of the protein is terminated in advance, as shown in EQ ID NO:3, rice shows that lateral roots are shortened and the quantity of the rice is reduced, the amino acid sequence of the protein is only 392 amino acids, aspartic acid at 392 bit is mutated into glutamic acid, the mutated amino acid position is located in a Tubulin _ C structural domain, and the deleted amino acid sequence position is located in a concerned coil region.
The rice lateral root development control gene OsLRD2 and mutants, alleles and derivatives generated by adding, substituting, inserting and deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO. 1 are applied to constructing transgenic rice.
The protein coded by the rice lateral root development control gene OsLRD2 and derivatives produced by adding, substituting, inserting and deleting one or more amino acids in the amino acid sequence shown in SEQ ID NO. 2 are applied to constructing transgenic rice.
Compared with the prior art, the invention has the advantages that: the rice lateral root development control gene OsLRD2 and the coded protein thereof, the total length of the control gene OsLRD2 is 2885bp, the total length of the CDS is 1356bp, wherein the nucleotide sequence of the CDS is shown as SEQ ID NO. 1, the amino acid sequence of the coded protein is shown as SEQ ID NO. 2, and alpha tubulin is coded. The mutant generated by adding, substituting, inserting and deleting one or more nucleotides in CDS in the control gene OsLRD2 has the coded protein which is shown in a plant that the number of lateral roots of rice is reduced and is very short, and the growth of main roots and adventitious roots is hindered to different degrees. The invention provides a foundation for regulating and controlling the rice root system structure by means of gene engineering, and the application of the protein and the coding gene thereof can create conditions for rice root system improvement and cross breeding or transgenic plant development.
Drawings
FIG. 1 is a table showing the rice lateral root mutant Oslrd2 and wild type Kasalath (WT) cultured under normal conditions for 7 days. Wherein, a, whole plant illumination of wild type (left) and mutant (right), bar =2cm; b, root illumination of wild type (left) and mutant (right), bar =2cm; c, side root stereography of wild type, bar =1mm; d, lateral root stereography of mutants, bar =1mm.
FIG. 2 shows the structure and mutation sites of OsLRD2 gene and encoded protein. Wherein, A is the gene structure and mutation site (indicated by the arrow); b is the protein structure and the mutation pattern (indicated by the arrow), and the numbers represent the amino acid positions of the corresponding functional domains.
FIG. 3 shows Wild Type (WT), mutant Oslrd2, T 3 Phenotype and RT-PCR detection profiles for two transgenic reversion lines (Comp 1 and Comp 2). Wherein, A, the whole plant illumination of wild type (left 1), mutant (left 2), reversion line 1 (right 2), reversion line 2 (right 1), bar =2cm; a1 is wild type lateral root stereography, bar =1mm; a2 is lateral root stereography of the mutant, bar =1mm; a3 is the lateral root stereogram of the reversion strain 1, and bar =1mm; a4 is the lateral root stereogram of the reversion strain 2, and bar =1mm; b, RT-PCR detection of wild type (left 1), mutant (left 2), revertant 1 (right 2), revertant 2 (right 1).
FIG. 4 is a schematic diagram of the structure of the transgene reply vector pCAMBIA-1300.
Detailed Description
The present invention will be described in further detail with reference to the drawings and examples, but the present invention is not limited thereto.
A lateral root development related mutant Oslrd2 (a base C is deleted at 1176bp in a CDS nucleotide sequence and a C at 1179bp is mutated into A) is screened from an indica rice local variety Kasalath mutant library mutagenized by Ethyl Methane Sulfonate (EMS), and the mutant is a recessive mutant which accords with the genetic rule of monogenic control. The 7-day-old mutant Oslrd2 and the aerial parts and roots of the wild type (including main roots, adventitious roots, and lateral roots) were observed, and it was found that the aerial parts of the mutant Oslrd2 were shorter than the wild type, and the number of lateral roots was small and very short (fig. 1).
The invention adopts a gene map-based cloning method to separate the OsLRD2 gene. First create an F 2 Locating colony, and hybridizing Oslrd2 mutant as female parent and wild japonica rice as male parent to obtain F 2 The recessive individual composition of (1). And carrying out primary positioning on the OsLRD2 site by using SSR (Simple Sequence Repeats) molecular markers, wherein the coarse positioning result shows that the mutant gene OsLRD2 is positioned between SSR markers RM120 and RM3701 on the 11 th chromosome, and the physical distances are 5727kb and 8106kb respectively. According to the annotation information of the rice gene, the interval has alpha tubulin OsLRD2. We find that the OsLRD2 gene has mutation by sequencing and comparison, the total length of the DNA of the gene is 2885bp, and the total length of the CDS is 1356bp. OsLRD2 contains two domains, namely a Tubulin domain (Tubulin) and a Tubulin C domain (Tubulin C), and a Coiled coil region (Coiled coil region) at the back. The mutant Oslrd2 has deletion of cytosine (C) at the position 1176bp of the CDS sequence and mutation of cytosine at the position 1179bp into adenine, so that translation is terminated early, the product has only 392 amino acids, aspartic acid at the position 392 in the amino acid sequence is changed into glutamic acid, the position of the mutated amino acid is located in a Tubulin _ C structural domain, and the position of the deleted amino acid sequence structural domain is located in a coiling region (figure 2).
To confirm that the mutant phenotype is caused by the OsLRD2 gene mutation, we performed transgene reversion validation on the mutant. The complete OsLRD2 CDS sequence (SEQ ID NO: 1) driven by the 35S promoter was cloned into the binary plant transgene vector pCAMBIA 1300. And (3) the constructed recovery vector is transformed into a mutant Oslrd2 callus through agrobacterium-mediated transformation, and the mutant Oslrd2 callus is induced by resistance callus to be further differentiated into a transgenic seedling. The development of lateral roots of the mutant (transgenic positive line) transformed with the exogenous OsLRD2 gene was the same as that of the wild type, and the lateral roots developed normally (FIG. 3A). The RNA of the leaves of the wild type and of the two positive transgenic lines (Comp 1, comp 2) was extracted and reverse transcribed into cDNA. The results of semi-quantitative RT-PCR showed that OsLRD2 gene was indeed overexpressed in the transgenic positive lines (FIG. 3B). A transgenic reversion test confirms that the phenotype of the mutant is caused by OsLRD2 gene mutation, and the transgenic rice with the normal function of the mutant is obtained. The result shows that the cloned rice OsLRD2 gene has certain application value, and a molecular regulation mechanism for rice lateral root development can be provided by utilizing the gene to perform transgenic transformation on crop varieties.
Example 1 screening and phenotype of mutants
Using Kasalath population induced by Ethyl Methyl Sulfonate (EMS) as mutant screening object, washing mutant seed with distilled water, and 0.6% (v/v) diluted HNO 3 Dormancy breaking treatment is carried out for 169h, germination is carried out in a dark place at 37 ℃ for about two days until white color is exposed. Sowing the exposed seeds on a nylon gauze floating on the prepared rice culture solution, culturing for 7 days in a rice culture room (under the conditions of day/night: 30 ℃/22 ℃,12h/12h Rh80%,3000 lux), and screening the mutant by taking the change of the number and the length of lateral roots as main target characters. 1 mutant with reduced lateral root number and shortened length was selected (FIG. 1) and designated Oslrd2.
Example 2 Gene mapping
F 2 The positioning population is obtained by hybridization of homozygote (Oslrd 2) and Nipponbare of japonica rice variety, and the genomic DNA for gene positioning is extracted from rice leaves by adopting a rapid extraction method of rice trace DNA. About 2cm of young leaves of rice were taken, frozen with liquid nitrogen, and the leaves were pulverized in a 1.5ml centrifuge tube to extract total DNA, and the obtained DNA was dissolved in 200. Mu.l of sterile water. 2 μ l of DNA sample was used for each SSR reaction.
In the localization test of OsLRD2 gene, 30F were first detected 2 Individuals were subjected to SSR analysis. According to the published molecular genetic maps created by japonica rice and indica rice, SSR primers which are approximately and uniformly distributed on each chromosome are selected, PCR amplification is carried out according to the known reaction conditions, then electrophoresis separation is carried out on 7 percent acrylamide gel, the polymorphism of PCR products is detected, and 30F are detected 2 The individual has no SSR primer of the recon, and the positioning population is enlarged. According to the result of gene localization, the mutant character and the SSR marker RM37 on the 11 th chromosome are found01, located between the SSR markers RM120 and RM3701 on chromosome 11, and the physical distances are 5727kb and 8106kb, respectively.
Example 3 Gene prediction and sequence analysis
According to rice gene annotation information of RGP (http:// pdb.dna. Affrc. Go. Jp/cgi-bin /) and EST database (http:// www.ncbi.nlm.nih.gov /), gene sequencing analysis in the located chromosome segment shows that the segment has an alpha tubulin OsLRD2 gene. The OsLRD2 gene is amplified by using wild type and Oslrd2 mutant cDNA as templates, amplified products are respectively sequenced, and the comparison and analysis of the sequencing results show that the mutant Oslrd2 lacks one base C at 1176bp and mutates the base C at 1179bp to A after the CDS sequence ATG, so that translation is terminated early, the product has only 392 amino acids, and the aspartic acid at 392 bits in the amino acid sequence is changed into glutamic acid (figure 2).
Example 4 functional complementation verification of OsLRD2 Gene in mutant
According to CDS sequence information of the OsLRD2 gene, primers for amplifying complete ORF are designed, and the primer sequences are as follows:
the upstream sequence of the primer is as follows: AAAGGTACCCGCCATGAGGGAGTGCAT
The downstream sequence of the primer is as follows: AAATCTAGAAGATAGAAGCCCACACGGACAG
Using root cDNA of indica rice Kasalath as a template, using high fidelity enzyme PrimerSTAR DNA Polymerase (Takara Bio Inc.) to amplify ORF of OsLRD2 gene, connecting with pUCm-T, and heat-shocking the connecting product to transform Escherichia coli DH5 alpha competent cell. After the sequence is determined to be correct, the plasmid is cut by KpnI and XbaI and then is connected with the pCAMBIA1300 modified vector which is also cut by KpnI and XbaI, and the connection product is thermally shocked to transform the escherichia coli DH5 alpha competent cells. The plasmid with correct enzyme digestion detection is introduced into the mutant Oslrd2 through a rice genetic transformation system mediated by an agrobacterium strain EHA105, and the transgenic plant is obtained through infection, co-culture, screening of a hygromycin resistant callus, differentiation, rooting, training and transplanting. The agrobacterium (EHA 105) mediated rice genetic transformation system is optimized mainly based on the method reported by Hiei et al (1994). The Oslrd2 mutant isolated from this transgenic plant reverted to wild-type (fig. 3A), indicating that the phenotype of Oslrd2 is indeed caused by Oslrd2 mutation. The nucleotide sequence of OsLRD2 is shown as SEQ ID NO:1 is shown. The protein coded by the gene has an amino acid sequence shown in SEQ ID NO. 2.
In order to detect whether transgenic positive plants over-express the OsLRD2 gene, total RNA of leaves of Kasalath and 2 transgenic reversion lines (Comp 1 and Comp 2) is respectively extracted by a Trizol method (a reversion vector constructed by the method is a CaMV 35S constitutive expression promoter, and if the transgenic positive plants are obtained, the originally non-expressed overground parts also over-express the OsLRD2 gene), and the total RNA is reverse transcribed into cDNA. When the reaction is semi-quantitative, the cDNA template amount of each sample is firstly adjusted to be consistent through the expression amount of OsActin gene (the amplification condition is 58 ℃,28 cycles), and then the target gene is amplified, wherein the amplification condition is as follows: 59 ℃ and 22 cycles. The semi-quantitative RT-PCR result is shown in FIG. 3B, which proves that the OsLRD2 gene is over-expressed in the transgenic positive line. The pCAMBIA1300 modified vector is a modified vector in the laboratory, and is an enhanced expression vector which is obtained by using a pCAMBIA-1300 vector as a basic skeleton and inserting a 35S promoter and an Nos terminator into a multiple cloning site (figure 4).
While the above embodiments are merely illustrative, it is obvious that the present invention is not limited to the above embodiments, and there may be many mutants, i.e., mutants, alleles or derivatives produced by adding, substituting, inserting or deleting one or several nucleotides in SEQ ID NO. 1, and gene sequences having at least 80% homology with the cDNA sequence shown in SEQ ID NO. 1, for constructing transgenic rice having a function of controlling lateral root development in rice. The protein shown in SEQ ID NO. 2 belongs to alpha tubulin functional protein, wherein one or more amino acid substitutions, insertions or deletions are carried out to obtain functional analogues. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention shall be deemed to be within the scope of the present invention.
<110> Ningbo university college of science and technology
<120> rice lateral root development control gene OsLRD2, coding protein and application thereof
<130>
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 1356
<212> DNA
<213> Rice lateral root development control Gene OsLRD2
<220>
<221> CDS
<400> 1
ATGAGGGAGT GCATCTCGAT CCACATCGGG CAGGCCGGTA TCCAGGTCGG GAACGCGTGC 60
TGGGAGCTCT ATTGCCTCGA GCATGGCATC CAGCCTGATG GACAGATGCC CGGTGACAAG 120
ACCGTTGGGG GAGGTGATGA TGCTTTTAAC ACCTTCTTCA GTGAGACTGG TGCTGGGAAG 180
CATGTCCCCC GTGCTGTCTT CGTCGATCTT GAGCCTACCG TGATTGATGA GGTGAGGACT 240
GGTGACTACC GCCAGCTCTT CCACCCTGAG CAGCTCATCA GTGGCAAGGA GGATGCAGCC 300
AACAACTTTG CCCGTGGTCA CTACACCATT GGCAAGGAGA TTGTTGATCT GTGCCTTGAC 360
CGCATCAGGA AGCTTGCCGA CAACTGCACT GGTCTCCAGG GCTTCCTTGT GTTCAACGCT 420
GTTGGAGGAG GAACGGGCTC CGGTCTCGGT TCCCTTCTCC TTGAGCGTCT CTCTGTGGAC 480
TATGGCAAGA AGTCCAAGCT CGGGTTCACC GTGTACCCGT CCCCTCAGGT CTCCACCTCT 540
GTGGTTGAGC CATACAACAG TGTCCTCTCC ACCCACTCCC TCCTTGAGCA CACCGATGTC 600
GCTGTCCTGC TCGACAATGA GGCCATCTAT GACATCTGCC GCCGCTCCCT CGACATTGAG 660
CGCCCAACCT ACACCAACCT CAACAGGCTT GTGTCCCAGG TCATCTCCTC ACTGACTGCC 720
TCCCTGAGGT TCGATGGTGC TCTGAATGTG GATGTCAACG AGTTCCAAAC CAACCTGGTG 780
CCCTACCCGA GGATCCACTT CATGCTTTCC TCCTACGCCC CGGTGATCTC GGCCGAGAAG 840
GCCTACCACG AGCAGCTCTC CGTGGCGGAG ATCACCAACA GCGCCTTCGA GCCGTCCTCC 900
ATGATGGCCA AGTGCGACCC GCGCCACGGC AAGTACATGG CGTGCTGCCT GATGTACCGC 960
GGCGACGTGG TCCCCAAGGA CGTGAACGCC GCGGTGGCCA CCATCAAGAC GAAGCGCACC 1020
ATCCAGTTCG TGGACTGGTG CCCCACGGGG TTCAAGTGCG GCATCAACTA CCAGCCGCCC 1080
AGCGTCGTCC CGGGGGGAGA CCTGGCCAAG GTGCAGAGGG CCGTGTGCAT GATCTCCAAC 1140
TCCACCAGCG TCGTCGAGGT GTTCTCCCGC ATCGACATCA AGTTCGACCT CATGTACTCC 1200
AAGCGCGCCT TCGTCCACTG GTACGTCGGC GAGGGCATGG AGGAGGGGGA GTTCTCCGAG 1260
GCCCGCGAGG ACCTCGCCGC GCTGGAGAAG GACTACGAGG AGGTCGGCTC CGAGTTCGAC 1320
GATGGTGACG AGGGTGATGA GGGTGACGAG TACTAG 1356
<210>2
<211>451
<212>PRT
<213> protein encoded by rice lateral root development control gene OsLRD2
<400>2
Met Arg Glu Cys Ile Ser Ile His Ile Gly Gln Ala Gly Ile Gln
1 5 10 15
Val Gly Asn Ala Cys Trp Glu Leu Tyr Cys Leu Glu His Gly Ile
16 20 25 30
Gln Pro Asp Gly Gln Met Pro Gly Asp Lys Thr Val Gly Gly Gly
31 35 40 45
Asp Asp Ala Phe Asn Thr Phe Phe Ser Glu Thr Gly Ala Gly Lys
46 50 55 60
His Val Pro Arg Ala Val Phe Val Asp Leu Glu Pro Thr Val Ile
61 65 70 75
Asp Glu Val Arg Thr Gly Asp Tyr Arg Gln Leu Phe His Pro Glu
76 80 85 90
Gln Leu Ile Ser Gly Lys Glu Asp Ala Ala Asn Asn Phe Ala Arg
91 95 100 105
Gly His Tyr Thr Ile Gly Lys Glu Ile Val Asp Leu Cys Leu Asp
106 110 115 120
Arg Ile Arg Lys Leu Ala Asp Asn Cys Thr Gly Leu Gln Gly Phe
121 125 130 135
Leu Val Phe Asn Ala Val Gly Gly Gly Thr Gly Ser Gly Leu Gly
136 140 145 150
Ser Leu Leu Leu Glu Arg Leu Ser Val Asp Tyr Gly Lys Lys Ser
151 155 160 165
Lys Leu Gly Phe Thr Val Tyr Pro Ser Pro Gln Val Ser Thr Ser
166 170 175 180
Val Val Glu Pro Tyr Asn Ser Val Leu Ser Thr His Ser Leu Leu
181 185 190 195
Glu His Thr Asp Val Ala Val Leu Leu Asp Asn Glu Ala Ile Tyr
196 200 205 210
Asp Ile Cys Arg Arg Ser Leu Asp Ile Glu Arg Pro Thr Tyr Thr
211 215 220 225
Asn Leu Asn Arg Leu Val Ser Gln Val Ile Ser Ser Leu Thr Ala
226 230 235 240
Ser Leu Arg Phe Asp Gly Ala Leu Asn Val Asp Val Asn Glu Phe
241 245 250 255
Gln Thr Asn Leu Val Pro Tyr Pro Arg Ile His Phe Met Leu Ser
256 260 265 270
Ser Tyr Ala Pro Val Ile Ser Ala Glu Lys Ala Tyr His Glu Gln
271 275 280 285
Leu Ser Val Ala Glu Ile Thr Asn Ser Ala Phe Glu Pro Ser Ser
286 290 295 300
Met Met Ala Lys Cys Asp Pro Arg His Gly Lys Tyr Met Ala Cys
301 305 310 315
Cys Leu Met Tyr Arg Gly Asp Val Val Pro Lys Asp Val Asn Ala
316 320 325 330
Ala Val Ala Thr Ile Lys Thr Lys Arg Thr Ile Gln Phe Val Asp
331 335 340 345
Trp Cys Pro Thr Gly Phe Lys Cys Gly Ile Asn Tyr Gln Pro Pro
346 350 355 360
Ser Val Val Pro Gly Gly Asp Leu Ala Lys Val Gln Arg Ala Val
361 365 370 375
Cys Met Ile Ser Asn Ser Thr Ser Val Val Glu Val Phe Ser Arg
376 380 385 390
Ile Asp Ile Lys Phe Asp Leu Met Tyr Ser Lys Arg Ala Phe Val
391 395 400 405
His Trp Tyr Val Gly Glu Gly Met Glu Glu Gly Glu Phe Ser Glu
406 410 415 420
Ala Arg Glu Asp Leu Ala Ala Leu Glu Lys Asp Tyr Glu Glu Val
421 425 430 435
Gly Ser Glu Phe Asp Asp Gly Asp Glu Gly Asp Glu Gly Asp Glu
436 440 445 450
Tyr
451
<210>3
<211>392
<212>PRT
<213> protein encoded by Rice mutant Oslrd2
<400>3
Met Arg Glu Cys Ile Ser Ile His Ile Gly Gln Ala Gly Ile Gln
1 5 10 15
Val Gly Asn Ala Cys Trp Glu Leu Tyr Cys Leu Glu His Gly Ile
16 20 25 30
Gln Pro Asp Gly Gln Met Pro Gly Asp Lys Thr Val Gly Gly Gly
31 35 40 45
Asp Asp Ala Phe Asn Thr Phe Phe Ser Glu Thr Gly Ala Gly Lys
46 50 55 60
His Val Pro Arg Ala Val Phe Val Asp Leu Glu Pro Thr Val Ile
61 65 70 75
Asp Glu Val Arg Thr Gly Asp Tyr Arg Gln Leu Phe His Pro Glu
76 80 85 90
Gln Leu Ile Ser Gly Lys Glu Asp Ala Ala Asn Asn Phe Ala Arg
91 95 100 105
Gly His Tyr Thr Ile Gly Lys Glu Ile Val Asp Leu Cys Leu Asp
106 110 115 120
Arg Ile Arg Lys Leu Ala Asp Asn Cys Thr Gly Leu Gln Gly Phe
121 125 130 135
Leu Val Phe Asn Ala Val Gly Gly Gly Thr Gly Ser Gly Leu Gly
136 140 145 150
Ser Leu Leu Leu Glu Arg Leu Ser Val Asp Tyr Gly Lys Lys Ser
151 155 160 165
Lys Leu Gly Phe Thr Val Tyr Pro Ser Pro Gln Val Ser Thr Ser
166 170 175 180
Val Val Glu Pro Tyr Asn Ser Val Leu Ser Thr His Ser Leu Leu
181 185 190 195
Glu His Thr Asp Val Ala Val Leu Leu Asp Asn Glu Ala Ile Tyr
196 200 205 210
Asp Ile Cys Arg Arg Ser Leu Asp Ile Glu Arg Pro Thr Tyr Thr
211 215 220 225
Asn Leu Asn Arg Leu Val Ser Gln Val Ile Ser Ser Leu Thr Ala
226 230 235 240
Ser Leu Arg Phe Asp Gly Ala Leu Asn Val Asp Val Asn Glu Phe
241 245 250 255
Gln Thr Asn Leu Val Pro Tyr Pro Arg Ile His Phe Met Leu Ser
256 260 265 270
Ser Tyr Ala Pro Val Ile Ser Ala Glu Lys Ala Tyr His Glu Gln
271 275 280 285
Leu Ser Val Ala Glu Ile Thr Asn Ser Ala Phe Glu Pro Ser Ser
286 290 295 300
Met Met Ala Lys Cys Asp Pro Arg His Gly Lys Tyr Met Ala Cys
301 305 310 315
Cys Leu Met Tyr Arg Gly Asp Val Val Pro Lys Asp Val Asn Ala
316 320 325 330
Ala Val Ala Thr Ile Lys Thr Lys Arg Thr Ile Gln Phe Val Asp
331 335 340 345
Trp Cys Pro Thr Gly Phe Lys Cys Gly Ile Asn Tyr Gln Pro Pro
346 350 355 360
Ser Val Val Pro Gly Gly Asp Leu Ala Lys Val Gln Arg Ala Val
361 365 370 375
Cys Met Ile Ser Asn Ser Thr Ser Val Val Glu Val Phe Ser Arg
376 380 385 390
Ile Glu
391 392
Claims (4)
1. A paddy rice lateral root development control gene OsLRD2 mutant is characterized in that a CDS nucleotide sequence of the mutant is that a cytosine is deleted at 1176bp in a nucleotide sequence shown in SEQ ID NO. 1, and the cytosine at 1179bp is mutated into adenine.
2. The protein encoded by the rice lateral root development control gene OsLRD2 mutant as claimed in claim 1, wherein the amino acid sequence of the protein is shown in SEQ ID NO. 3, and rice shows that lateral roots are shortened and the number of the lateral roots is reduced.
3. The use of the rice lateral root development control gene OsLRD2 mutant of claim 1 in the construction of transgenic rice.
4. The use of the rice lateral root development control gene OsLRD2 mutant of claim 2 for encoding protein in the construction of transgenic rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011187221.6A CN112280784B (en) | 2020-10-30 | 2020-10-30 | Rice lateral root development control gene OsLRD2, encoding protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011187221.6A CN112280784B (en) | 2020-10-30 | 2020-10-30 | Rice lateral root development control gene OsLRD2, encoding protein and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112280784A CN112280784A (en) | 2021-01-29 |
| CN112280784B true CN112280784B (en) | 2022-12-02 |
Family
ID=74353740
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011187221.6A Active CN112280784B (en) | 2020-10-30 | 2020-10-30 | Rice lateral root development control gene OsLRD2, encoding protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112280784B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114807221B (en) * | 2022-04-28 | 2023-06-06 | 宁波大学科学技术学院 | Mutant, protein and expression vector of rice root elongation regulatory gene OsDRP1C and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5635618A (en) * | 1993-11-10 | 1997-06-03 | Rhone-Poulenc Agrochimie | Promoter elements of chimeric genes of α-tubulin |
| CN103484472A (en) * | 2013-08-23 | 2014-01-01 | 宁波大学 | Rice lateral root formation control gene OsHK1 and coded protein thereof |
| CN104694549A (en) * | 2013-08-23 | 2015-06-10 | 宁波大学 | Rice lateral root sprout-controlling gene OsHK1 and protein encoded by gene OsHK1 |
| CN108342393A (en) * | 2018-01-25 | 2018-07-31 | 上海市农业科学院 | A kind of mutator Oslrt1, its detection and application of the control rice without lateral root character |
| CN109134632A (en) * | 2018-07-29 | 2019-01-04 | 浙江大学 | The albumen and its encoding gene of regulation plant root development and application |
-
2020
- 2020-10-30 CN CN202011187221.6A patent/CN112280784B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5635618A (en) * | 1993-11-10 | 1997-06-03 | Rhone-Poulenc Agrochimie | Promoter elements of chimeric genes of α-tubulin |
| CN103484472A (en) * | 2013-08-23 | 2014-01-01 | 宁波大学 | Rice lateral root formation control gene OsHK1 and coded protein thereof |
| CN104694549A (en) * | 2013-08-23 | 2015-06-10 | 宁波大学 | Rice lateral root sprout-controlling gene OsHK1 and protein encoded by gene OsHK1 |
| CN108342393A (en) * | 2018-01-25 | 2018-07-31 | 上海市农业科学院 | A kind of mutator Oslrt1, its detection and application of the control rice without lateral root character |
| CN109134632A (en) * | 2018-07-29 | 2019-01-04 | 浙江大学 | The albumen and its encoding gene of regulation plant root development and application |
Non-Patent Citations (3)
| Title |
|---|
| OsTUA2对水稻侧根原基发育的功能研究;党磊;《中国优秀博硕士学位论文全文数据库(博士) 农业科技辑》;20101215;第D047-12页 * |
| 水稻OsTUA2基因克隆与功能研究;何芬芳;《中国优秀博硕士学位论文全文数据库(博士) 农业科技辑》;20110315;第D047-4页 * |
| 登录号：LOC_Os11g14220;Kawahara, Y.等;《Rice Genome Annotation Project》;20130206;第1-6页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112280784A (en) | 2021-01-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107164347B (en) | Ideal plant type gene NPT1 for controlling rice stem thickness, tillering number, spike grain number, thousand grain weight and yield and its application | |
| AU2005298784B2 (en) | Stress tolerant cotton plants | |
| CN101508726B (en) | Drought tolerant associated protein for plant, encoding gene and uses thereof | |
| CN113025626B (en) | Application of tumorous stem mustard BjuEAR1 gene in regulation of plant stress resistance | |
| CN112280784B (en) | Rice lateral root development control gene OsLRD2, encoding protein and application thereof | |
| CN114230648B (en) | Application of rice gene PANDA in improving plant yield | |
| CN103484472B (en) | Rice lateral root formation control gene OsHK1 and coded protein thereof | |
| CN113136398B (en) | GsHA24 protein and application of related biological material thereof in regulation and control of stress tolerance of plants | |
| CN113528540B (en) | Rice grain type gene OsMKK3 coding gene and application thereof | |
| CN112457385B (en) | Application of gene LJP1 for controlling rice growth period | |
| CN104694549B (en) | The protein of control gene OsHK1 and coding occurs for Rice lateral root | |
| CN110343154B (en) | Clone of key gene SEM1 for controlling rice sink source flow and application thereof | |
| CN113462696A (en) | Rice low-temperature sensitive leaf-shaped gene SRNL9 and application thereof | |
| CN112226442A (en) | Wheat grain size character related gene TaSRK, and coding protein and application thereof | |
| CN112226459A (en) | Common wild rice grain type related coding gene and application thereof | |
| CN108690847B (en) | Application of protein nog1 in regulation and control of plant yield and grain number per ear | |
| CN105950598B (en) | Rice dormancy-breaking related protein and coding gene and application thereof | |
| CN109852624B (en) | Rice root elongation control gene OsNDPK4 and encoded protein | |
| CN114807221B (en) | Mutant, protein and expression vector of rice root elongation regulatory gene OsDRP1C and application thereof | |
| CN112899292B (en) | Upland cotton plant height regulating gene GhGA20ox6 and its use | |
| CN102453704B (en) | Plant photooxidative stress-resistant gene carotenoid isomerase (CRTISO) and application thereof | |
| CN110229801B (en) | Gene for controlling rice leaf senescence and protein coded by same | |
| CN112501147B (en) | Common wild rice grain related coding gene and application thereof | |
| CN113817755B (en) | Rice long-grain gene LOG1 and application thereof | |
| CN106957828A (en) | A kind of insensitive paddy rice More-tiller mutant htd7 of witchweed lactone and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 315331 No. 521, Wenwei Road, Baisha road street, Cixi City, Ningbo City, Zhejiang Province Applicant after: COLLEGE OF SCIENCE & TECHNOLOGY NINGBO University Address before: 315212 No. 505 Yuxiu Road, Zhuangshi Street, Zhenhai District, Ningbo City, Zhejiang Province Applicant before: COLLEGE OF SCIENCE & TECHNOLOGY NINGBO University |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |