CN110343154B - Clone of key gene SEM1 for controlling rice sink source flow and application thereof - Google Patents

Abstract

The invention discloses a clone of a key gene SEM1 for controlling source flow of a rice bank and application thereof. The invention provides an application of any one of the following substances 1) to 3) in regulating and controlling the sucrose content of plants and/or regulating and controlling the photosynthesis of the plants: 1) protein SEM 1; 2) a DNA molecule encoding protein SEM 1; 3) a recombinant vector, expression cassette, transgenic cell line or recombinant bacterium comprising a DNA molecule encoding protein SEM 1; the SEM1 gene and the protein coded by the gene can obviously improve the yield of rice. The SEM1 gene provided by the invention is introduced into the mutant to obtain the transgenic rice, so that the library source flow efficiency of the transgenic rice is obviously higher than that of the mutant. The invention has important theoretical and practical significance for cultivating the high-light-efficiency new rice material.

Description

Clone of key gene SEM1 for controlling rice sink source flow and application thereof

Technical Field

The invention relates to the field of plant genetic engineering, in particular to clone of a key gene SEM1 for controlling rice sink source flow and application thereof.

Background

The rice yield increasing process is a process of continuously establishing the balance relation between the genetic improvement of source, library and stream characters and a novel library, source and stream character; the leaf is a main source organ and an important place for synthesizing photosynthetic products by utilizing light energy of plants, and the premature senility of the rice leaf is closely related to the discordance of the storehouse, the source and the flow; the library characteristics are mainly expressed as glume flower number and grain volume weight in unit area, including effective spike, spike grain number, thousand grain weight and the like. The number and area of vascular bundles and phloem cells of the stem and scion stem are commonly referred to as flow traits. Under different environmental conditions, source library flow can possibly become a limiting factor of rice yield, but at present, researches mostly focus on genetic researches and gene function analysis of single traits such as leaf senilism, effective spike, spike grain number, thousand grain weight and the like, and reports on source, library and flow multi-trait mutants and related gene functions are few.

Sucrose, a non-reducing sugar, is the major photosynthetic assimilation product of most higher plants. The sucrose produced by photosynthesis, in addition to partially maintaining the metabolism of the photosynthetic tissues themselves, is mostly transported to other tissues for metabolism or storage through the phloem over long distances. The sucrose has the following four advantages: (1) the solubility in cytoplasm is high; (2) the viscosity is low and the flow rate is high; (3) the chemical property is stable; (4) the osmotic potential is high and sucrose can therefore be the major form of transport of the photosynthetic assimilation products of higher plants from "sources" to "sinks". This process involves three sequential stages of sucrose loading in the source leaf organ, long distance transport and unloading in the sink organ. The long-distance transport of sucrose, the main product of plant photosynthesis, from "sources" (leaves) to "pools" (seeds) is through the stalk phloem. Therefore, the method excavates and controls the multi-character key genes of 'source, library and stream', researches the genetic mechanism of the key genes, analyzes the gene diversity and the application value, and has important significance for analyzing the genetic basis formed by the rice yield.

Disclosure of Invention

The invention aims to provide a protein related to a rice source stock flow, a gene thereof, a transgenic plant cell obtained from the protein, and a method for modifying a rice source stock flow by using the gene.

In order to solve the above technical problems, the present invention aims to provide a novel gene SEM1 cloned from rice-derived kupffer-hindered mutant SEM 1.

The invention provides a protein derived from rice, which is named as SEM1, and the SEM1 protein is protein A1), A2) or A3) as follows:

A1) the amino acid sequence is protein of a sequence 2 in a sequence table;

A2) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in the sequence 2 in the sequence table, has more than 90 percent of identity with the protein shown in A1), and is related to the yield of plants and/or the transport capacity of plant sucrose;

A3) a fusion protein obtained by connecting protein tags at the N-terminal or/and the C-terminal of A1) or A2).

In the protein, the sequence 2 in the sequence table is composed of 1909 amino acid residues.

The protein can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

In the above protein, the protein tag (protein-tag) refers to a polypeptide or protein that is expressed by fusion with a target protein using in vitro recombinant DNA technology, so as to facilitate expression, detection, tracking and/or purification of the target protein. The protein tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and/or a SUMO tag, among others.

In the above proteins, identity refers to the identity of amino acid sequences. The identity of the amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web pages of the NCBI home website. For example, in the advanced BLAST2.1, by using blastp as a program, setting the value of Expect to 10, setting all filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residual Gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a calculation by searching for the identity of a pair of amino acid sequences, a value (%) of identity can be obtained.

In the above protein, the 90% or more identity may be at least 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

Among the above proteins, SEM1 may be derived from rice.

The invention claims the application of the SEM1 protein in any one of the following P1-P8:

the application of the P1 and SEM1 proteins in regulating and controlling the yield of plants;

the application of the P2 and SEM1 proteins in preparing products for improving the yield of plants;

the application of the P3 and SEM1 proteins in breeding high-yield plants;

the application of the P4 and SEM1 proteins in preparing high-yield plant products;

the application of the P5 and SEM1 proteins in regulating and controlling the sucrose transport capacity of plants;

the application of the P6 and SEM1 proteins in preparing products for improving the transportation capacity of plant sucrose;

the application of the P7 and SEM1 proteins in cultivating plants with high sucrose transport capacity;

application of P8 and SEM1 proteins in preparation of plant products with high sucrose transport capacity.

The invention also provides application of the SEM1 protein-related biomaterial in any one of the following Q1-Q9:

use of Q1, the SEM1 protein-related biomaterial for modulating plant yield;

use of Q2, the SEM1 protein-related biomaterial in the manufacture of a product for increasing plant yield;

use of Q3, the SEM1 protein-related biomaterial in breeding high-yield plants;

the application of Q4 and the biological material related to the SEM1 protein in the preparation of high-yield plant products;

the application of Q5 and the biological material related to the SEM1 protein in regulating and controlling the sucrose transport capacity of plants;

the application of Q6 and the biological material related to the SEM1 protein in preparing products for improving the transportation capacity of plant sucrose;

the application of Q7 and the biological material related to the SEM1 protein in cultivating plants with high sucrose transport capacity;

use of Q8, the SEM1 protein-related biomaterial in the preparation of a high sucrose transport capacity plant product;

q9, and application of the biological material related to the SEM1 protein in plant breeding.

The biomaterial is any one of the following B1) to B4):

B1) a nucleic acid molecule encoding the protein of claim 1;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2);

B4) a recombinant microorganism containing B1) the nucleic acid molecule, or a recombinant microorganism containing B2) the expression cassette, or a recombinant microorganism containing B3) the recombinant vector;

wherein, the sequence 1 in the sequence table is composed of 5730 nucleotides, and the coding sequence is the sequence 1 in the sequence table and encodes the protein shown by the sequence 2 in the sequence table.

In the above biological materials, the expression cassette containing a nucleic acid molecule encoding SEM1 (SEM1 gene expression cassette) described in B2) refers to DNA capable of expressing SEM1 in a host cell, and the DNA may include not only a promoter that initiates transcription of SEM1 gene, but also a terminator that terminates transcription of SEM 1. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter of cauliflower mosaic virus 35S; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al (1999) Plant Physiology 120: 979-992); chemically inducible promoter from tobacco, pathogenesis-related 1(PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester)); tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both inducible with jasmonic acid ester); heat shock promoters (U.S. patent 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128(CN101063139B (Chinese patent 200710099169.7)), seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al (1985) EMBO J.4: 3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminators (see, e.g., Odell et al (I)₉₈₅) Nature 313: 810; rosenberg et al (1987) Gene,56: 125; guerineau et al (1991) mol.gen.genet,262: 141; proudfoot (1991) Cell,64: 671; sanfacon et al Genes Dev.,5: 141; mogen et al (1990) Plant Cell,2: 1261; munroe et al (1990) Gene,91: 151; ballad et al (1989) Nucleic Acids Res.17: 7891; joshi et al (1987) Nucleic Acid Res, 15: 9627).

The recombinant expression vector containing the SEM1 gene expression cassette can be constructed using existing plant expression vectors. The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like. Such as pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Corp.) and the like. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The poly A signal can lead poly A to be added to the 3 'end of mRNA precursor, and the untranslated regions transcribed at the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (such as nopaline synthase gene Nos) and plant genes (such as soybean storage protein gene) have similar functions. When the gene of the present invention is used to construct a plant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate identification and screening of transgenic plant cells or plants, plant expression vectors to be used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), marker genes for antibiotics which are expressible in plants (e.g., nptII gene which confers resistance to kanamycin and related antibiotics, bar gene which confers resistance to phosphinothricin which is a herbicide, hph gene which confers resistance to hygromycin which is an antibiotic, dhS gene which confers resistance to methatrexate, EPSPS gene which confers resistance to glyphosate), or marker genes for chemical resistance (e.g., herbicide resistance), mannose-6-phosphate isomerase gene which provides the ability to metabolize mannose, etc. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

In the above biological material, the recombinant microorganism may be specifically yeast, bacteria, algae and fungi.

A method for producing a high-yield and/or high-sucrose transport plant, comprising increasing the expression level and/or activity of SEM1 protein or a gene encoding the same in a plant of interest, resulting in a high-yield and/or high-sucrose transport plant; the yield and/or sucrose transport capacity of said high yield and/or high sucrose transport capacity plant is higher than the yield and/or sucrose transport capacity of said seed plant of interest.

The increase of the expression level of the SEM1 protein or the gene encoding the same in the target plant is achieved by introducing a biological material related to the SEM1 protein into the target plant.

As used herein above, the plant and the plant of interest are both seed plants, such as monocotyledonous or dicotyledonous plants

The monocotyledon may be a gramineous plant. The gramineous plant is Oryza or Oryza sativa. Above, the yield may be the individual plant yield. The yield may be expressed in grains per ear and/or thousand grains weight.

Has the DNA sequence shown in the sequence 1, and also comprises a gene sequence which has at least 90 percent of homology with the DNA sequence shown in the sequence 1. The protein represented by the sequence 2 in the present invention belongs to a member of the callose synthase family, in which one or several substitutions, insertions or deletions are made to obtain a functional analog. Furthermore, mutants, alleles or derivatives produced by addition, substitution, insertion or deletion of one or more nucleotides in the sequence 1 are also included, and sequences having the same function can also achieve the object of the present invention.

In conclusion, the SEM1 gene is firstly cloned in rice by using the rice source bank flow-resistant mutant through the map-based cloning technology, the gene codes a callose synthase family gene, and the function of the gene is not reported so far. By reading the functions of the SEM1 gene, the mechanism of action of the gene in the transportation of photosynthetic products is further analyzed, and the theory of the characters of 'source, reservoir and stream' of rice is enriched. The invention utilizes the map-based cloning technology to clone and control the key functional gene SEM1(Sugar Excessive Mutant 1), and identifying the function of the gene using a transgene complementation assay; meanwhile, the gene is used for regulating and controlling the transportation of nutrient substances, so that the photosynthesis efficiency is improved, and the yield of rice is finally improved.

Drawings

The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.

FIG. 1 phenotypic map of mutant sem1 plant morphology. A: flowering time, mutant sem1 is compared to Wild Type (WT) plants. B, comparison graph of the mutant sem1 with the Wild Type (WT) for the flag leaf and spike type, the mutant sem1 has shorter flag leaf and withered leaf edge; the mutant sem1 partially glume flowers at the ear. C-root comparison of mutant sem1 with Wild Type (WT). D. E, F, G, H compared with Wild Type (WT), the plant height, seed setting rate, tiller number, root length and grain number per ear of mutant sem1 are all obviously different from wild type.

FIG. 2 determination of sucrose content in mutant sem1 and wild-type flag leaf and stem. The results show that the mutant sem1 has significantly higher sucrose content in leaves than in wild type. Whereas in the stem, the mutant sem1 sucrose content was significantly lower than the wild type. Indicating that sucrose in mutant sem1 may be hindered in its transport from leaf to stem.

FIG. 3 comparison of transmission of mutant sem1 and wild-type sisal leaf electron microscopy.

FIG. 4 is a map-based clone of the SEM1 gene. A, B Primary and Fine localization of mutant sem 1. 500 individuals were used to map genes to a range of 45K. And C, sequencing results show that the base substitution in the mutant sem1 mutates the amino acid E into L.

FIG. 5 shows the variation of the transport composition of the photosynthetic products of plants by transgenic manipulation. Wherein A. represents the structural diagram of the complementary vector pCAMBIA2300-SEM 1. B. Complementation test T₀And (3) generating transgenic rice (Nipponbare, sem1 plants and transgenic complementary lines (CP1, CP2 and CP3) from left to right, wherein C is the leaf type of the complementary line and D is the sucrose content of the complementary line.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the following examples, japonica rice variety "Nipponbare", indica rice variety Dular is available to the public fromChinese academy of agricultural sciences Obtained by research of physical and technical techniques。

In the examples described below, the mutant sem1 (seq 1) was obtained (wan et al, Plant Molecular biology.2009,69(1-2):69-80), publicly availableObtained by the research of biotechnology of Chinese academy of agricultural sciencesThe test of the application is repeated, and the test cannot be used for other purposes.

In the following examples, the vector pCambia2300 was purchased from North Noro Biotech, Inc. of Shanghai.

Example 1: morphological characteristics of rice source sink flow-resistant mutant sem1

1. Morphological characteristics of mutant sem1

The phenotype of the mutant sem1 appears at the late tillering stage at the earliest time, and is specifically represented by withered and yellow leaf edges, plant dwarfing, short main roots, few grains per ear, low fruiting rate and obvious photosynthetic product supply shortage characteristic, as shown in fig. 1.In FIG. 1, A represents the flowering phase, the mutant sem1 compared to Wild Type (WT) plants. B shows a graph comparing the flag and spike types of mutant sem1 with Wild Type (WT), from which it can be seen that mutant sem1 has shorter flag and withered leaf edges; the mutant sem1 partially glume flowers at the ear. C represents a plot comparing the roots of mutant sem1 with Wild Type (WT). D. E, F, G, H shows the comparison of plant height, seed setting rate, tiller number, root length and grain number per spike of mutant sem1 and Wild Type (WT), and the data show that the plant height, seed setting rate, tiller number, root length and grain number per spike of mutant sem1 are all different from wild type.

Sucrose is the major product of photosynthesis in higher plants and is also the major form of transport of the photosynthetic assimilation products from "sources" to "sinks". We determined the sucrose content of the plants, and the mutant sem1 had sucrose accumulation in leaves and low content in stems, roots and ears, and the phenotype of mutant sem1 was presumed to be due to the inability of sucrose to be transported normally (FIG. 2).

Example 2:

preparation and observation of a transmission electron microscope:

(1) sample preparation: collecting the mutant and control wild type leaves, and cutting into 0.5-1mm³The left and right small blocks;

(2) fixing: the cut sample pieces were placed in a 2ml centrifuge tube, 2.5% glutaraldehyde solution (PH 7.2) was added, and vacuum was applied in the vacuum apparatus until the leaves completely subsided. 0.1M phosphoric acid rinse three times, every 15min, then add 1% osmic acid fixed 2-3 hours, until the sample becomes black;

(3) and (3) dehydrating: sequentially dehydrating with 50%, 70% and 90% ethanol solution, treating for 20 min at each concentration, treating with ethanol and acetone (1: 1) solution for 20 min at 4 deg.C in a refrigerator, and treating with pure acetone at room temperature for 20 min;

(4) and (3) infiltration: reacting the sample in a mixed solution of anhydrous acetone and embedding agent (3: 1) for 4 hours, treating the sample in the mixed solution of anhydrous acetone and embedding agent (1: 1) for 3 hours, and finally reacting the sample in pure embedding agent for 12 hours;

(5) embedding: in the embedding box selected by the samples in the steps, the samples are treated at 37 ℃ overnight, at 45 ℃ for 12 hours and at 60 ℃ for 24 hours to obtain embedded samples;

(6) slicing and photographing: the embedded samples were cut into ultrathin sections of about 60-70nm with a microtome, then the sections were stained with lead citrate solution for 10 minutes, followed by uranium acetate solution for 30 minutes, washed three times with double distilled water and then air dried, observed with a transmission electron microscope of the Hitachi H-7650 type and selectively photographed in multiples.

The results showed that the number of starch in the wild type leaf was normal, the chloroplast structure was intact, and the basal granule arrangement in the chloroplast was tight (as shown in FIG. 3). Compared with the wild type, the mutant chloroplast cell has only starch granules which are obviously increased, and sucrose is a precursor of starch formation, which indicates that leaf sucrose cannot be transported.

Example 3: map-based cloning of the Gene SEM1

1. Genetic rule

The rice (Oryza sativa L.) mutant sem1, the original wild material was japonica rice variety "Nipponbare".

The rice mutant sem1 was obtained from Nipponbare mutant pool (wan et al, Plant Molecular biology 2009,69(1-2):69-80) and was obtained at the Wanzhuang base of Hebei Gallery.

All F1 generation plants obtained by taking the mutant sem1 as a female parent and taking a wild type as a male parent through orthogonal transformation show normal phenotype, and F₂Four weeks after the seeds were sown, 200 individuals were randomly selected, 164 of which exhibited the wild-type phenotype and 42 exhibited the mutant phenotype. Card square test result (X)²＝0.95<χ²0.05-3.84), the segregation ratio of the normal plant phenotype and the mutant plant phenotype conforms to 3: 1; it was further demonstrated that this mutant phenotype is controlled by a recessive, single recessive nuclear gene.

2. Analysis and localization of populations:

the homozygous sem1 mutant was crossed with the indica variety Dular, F₁Selfing to obtain F₂And (4) a group. And 700 phenotypically obvious phenotypically mutated individuals are selected from the 700 phenotypically mutated individuals as a positioning population. About 1g of young leaves of each plant are taken in the maturation stage and used for extracting total DNA.

3. Indel marker localization SEM1 gene:

the rapid extraction method of the rice trace DNA comprises the following steps: genomic DNA for gene mapping was extracted from rice leaves. Approximately 0.2g of rice leaf was taken, frozen with liquid nitrogen, pulverized in a small mortar having a diameter of 5cm, transferred to a 1.5ml centrifuge tube to extract DNA, and the obtained DNA precipitate was dissolved in 150. mu.l of ultrapure water. Mu.l of DNA sample was used for each PCR reaction.

Primary localization of SEM1 gene: f in combination with Dular at sem1₂Selecting 20 recessive individuals from the population, and selecting indels approximately and uniformly distributed on each chromosome according to the published molecular genetic map created by japonica rice and indica ricePCR amplification was performed according to known reaction conditions, the PCR products were analyzed for polymorphisms by 4% agarose gel electrophoresis separation and ethidium bromide staining, and SEM1 was initially located between two Indel markers, Indel1 and Indel2 (as shown in FIG. 4).

Fine localization of SEM1 gene: selecting F combined with sem1 and Dular₂A total of 700 recessive individuals were selected from the population, and Indel markers and SNP primers were further designed based on the initial mapping as shown in Table 1, and finally SEM1 was refined to be within the 40-kb range as shown in FIG. 4.

Table 1 Indel markers and SNP primer table:

primer name	Sequence of
		Indel1-23F	GCATATGAGTATACATACGTGG(18.33)
Indel1-23R	GACTGTTCACTTTGATGTCAT
		Indel1-29F	ATGGCGGTTCATGGCTTC(20.52)
Indel1-29R	CGGATTGGCATTACAACGA
		SNP1-6-F	CAAGGGTTCTGTGCTAGTGAAA
SNP1-6-R	CCCCTCCATTCAATGTTACG
		SNP1-7-F	AAATGGTCCGTCATCGTAGG
SNP1-7-R	TGTATCTACCCGTATGTGTGTGTC

4. Gene prediction and comparative analysis:

based on the fine localization results, a total of 4 candidate genes were found in this interval in the 40-kb range, as predicted by the Rice Automated Annotation System (http:// Rice GAAS. dna. affrc. go. jp). Sequencing primers (Sem-1-F and Sem-1-R, sequences are shown in Table 2) of each gene are designed according to the number of the remaining recombinant individuals of the two markers, and candidate genes are respectively amplified from the genome of the Sem1 and the genome of the wild type variety by a PCR method by taking the Sem-1-F and the Sem-1-R as the primers and are subjected to sequencing analysis. It was found that sem1 has 1-base substitution mutation at exon 28 of LOC _ Os01G34890 gene, from A to G, and 1014 th arginine (R) to glycine (G). This result was verified in duplicate and the mutant sem1 gene was found to have a mutational event compared to both the wild type and predicted sequences. According to the gene annotation information (TIGR) of BAC clone sequence (shown in SEQ ID NO.3 of the sequence Listing), the gene was named SEM1 gene. The SEM1 gene comprises 41 introns and 42 exons, the full length of the cDNA of the SEM1 gene is shown as SEQ ID NO.1 of the sequence table, and the nucleotide of the sequence 1 in the sequence table is a coding sequence (5730bp) (corresponding to position 219-5948 of SEQ ID NO. 3). The amino acid sequence of the protein coded by the gene is shown as SEQ ID No: 2, under the designation SEM 1.

Table 2:

primer name	Sequence of
		Sem-1-F	cacttagttaggtccacaaccat
Sem-1-R	TATTGCATTGTTCATTGGCGC

Example 4: method for changing transport composition difference of plant photosynthetic products by using transgenic operation

Primers were designed based on the CDS sequence of the gene of interest, and Sma1 and Xba1 cleavage sites were added to the primers in the F and R directions, respectively, (in this case, the sequence of primer F is GAAGAGGTACCCGGGATGGCGACGGGGGGAGGG primer R has a biological sequence of CAGGTCGACTCTAGATCATTCCTCTCCAATGTCCTTTTGC, the underlined part is the restriction site); taking cDNA of japonica rice variety Nipponbare as a template, using primers F and R, carrying out PCR amplification on nucleotide (coding sequence of SEM1 gene) of sequence 1 in a sequence table to obtain a PCR amplification product, and recovering the PCR amplification product.

Carrying out double enzyme digestion on pCambia2300 vector and the PCR amplification product by SmaI and XbaI, respectively carrying out agarose gel electrophoresis on products of two enzyme digestion systems, recovering target bands after electrophoresis, recovering products and recombinase (TAKARA, In-Fusion enzyme mix, cat # 639648) to prepare 2.5ul of system for connecting fragments and the vector, adding all 2.5ul of connection products into 50ul of escherichia coli (trans5 alpha, cat # CD201-1) for transformation, and sequentially carrying out: ice-bath for 30 min, heat-shock at 42 ℃ for 45s, resuscitating at 37 ℃ for 60min, and incubation at 37 ℃ overnight after final coating with a Carna-resistant plate. And after the culture is finished, selecting and streaking the monoclonal antibody, carrying out colony PCR detection, and carrying out sequencing further verification on the monoclonal antibody which is detected to contain the target band. The verification result shows that: the recombinant vector in the single clone is a recombinant expression vector containing DNA shown in a sequence 1 and is named pCambia2300-SEM 1. pCambia2300-SEM1 is a recombinant expression vector obtained by replacing the sequence between the SmaI and XbaI recognition sites of pCambia2300 with DNA of sequence 1, while keeping the other sequences of pCambia2300 unchanged.

And carrying out plasmid extraction on the correct clone after verification to obtain a recombinant vector pCambia2300-SEM 1. The recombinant vector pCambia2300-SEM1 is transferred into an Agrobacterium (Agrobacterium tumefaciens) strain EHA105 by an electric shock method to obtain the recombinant Agrobacterium containing the pCAMBIA2300-SEM1 complementary vector, which is named as EHA105/pCAMBIA2300-SEM 1. The mutant SEM1 was used as a recipient plant, and the SEM1 gene was introduced into the mutant SEM1 by the following specific method: the mature seeds of the mutant sem1 are used for inducing callus, and after 3 weeks of culture in an induction medium (culture condition: 32 ℃ light intensity 13230Lx), the callus with vigorous growth is selected as a transformation receptor. Infecting SEM1 callus with recombinant agrobacterium EHA105/pCAMBIA2300-SEM1, culturing in dark at 25 deg.C for 3 days, culturing in screening culture medium containing 150mg/L G418 and 400mg/L carboxybenzyl (culture condition: 32 deg.C, light intensity 13230Lx, time about 2 weeks), culturing in differentiation culture (culture condition: 32 deg.C, light intensity 13230Lx, time based on differentiation of plantlet), transferring the plantlet to rooting and strong seedling culture medium for about 2 weeks (culture condition: 32 deg.C, light intensity 13230Lx), and planting in field. And counting to obtain 20T 0 generation single plants, harvesting seeds, and planting to obtain 20 lines of T1 generation. 7 strains were randomly selected, and the SEM1 gene expression level was quantitatively analyzed using primers TF1 (5'-GCTGGAGAAGGATGAACACG-3') and TF2 (5'-CATTACTGGTTGTCGCTGACC-3'), while "Nipponbare" (CK) and mutant SEM1 (SEM1 for short) were used as controls. The results of analysis of the gene expression amount by SEM1 are shown in Table 3), 7 lines were classified into two groups. The expression level of one SEM1 gene is similar to that of a Control (CK), the plant height, leaf shape and sucrose content of the transgenic plants are restored to wild-type levels through measurement, and the names of the transgenic plants are CP1, CP2 and CP3 respectively. In another class, the expression level of SEM1 gene is at least two times of that of the control, and the yield indexes such as grain number per ear and grain weight of these lines are significantly improved compared to those of the recipient plant, as shown in table 4, the names of these lines are OV1, OV2, OV3 and OV4, respectively.

As shown in fig. 5, CK represents japan sunny, and CP1, CP2, and CP3 represent 3 groups of T1 generation strains, respectively. Wherein CK represents Nipponbare, and OV1, OV2, OV3 and OV4 represent lines in which SEM1 gene is overexpressed (at least twice as much as that of a recipient plant as a control) in T1-generation lines.

TABLE 3 comparison of the results of relative SEM1 Gene expression levels of T1 generation strains and recipient plants for CK

Name (R)	Relative SEM1 Gene expression level
		CK	1.00
sem1	0
		CP1	1.01
CP2	0.98
		CP3	1.05
OV1	2.05
		OV2	3.76
OV3	2.78
		OV4	4.87

The expression level of one type of SEM1 gene is similar to that of a control, and the plant height, leaf shape and sucrose content of the transgenic plants are recovered to wild levels through measurement. As shown in FIG. 5, in which CK represents a recipient plant of the recombinant vector, CP1, CP2, and CP3 represent 3 groups of T1 generation strains, respectively. In another category, the expression level of SEM1 gene is at least two times higher than that of the control, and the yield indexes such as grain number per ear and grain weight of these lines are significantly improved compared to the recipient plant, as shown in table 4, wherein CK represents the control material, OV1, OV2, OV3, OV4 represent the lines in T1 generation lines in which SEM1 gene is overexpressed (at least two times higher than that of the recipient plant as the control), and sam1 represents the mutant type, i.e., the recipient plant of T0 generation plant. And photosynthetic efficiency is measured.

At the same time, we measured their photosynthetic efficiency as follows: selecting a sunny day with the temperature higher than 30 ℃ one week after the ear starting, and selecting the sunny day with the temperature higher than 30 ℃ at 9 a.m. each day: 00, measuring the photosynthetic rate of the sword leaves of the selected rice plants, wherein the measured part is the front part l/3 of the sword leaves; each measurement took 1 minute; the measurement of each group of materials is completed within 1 hour in time; 13 on the same day: 00 start to repeat the measurement of the morning; repeating the measurement for 2 times within the next week; the photosynthetic determination system is a single U.S. Li-CO 6400 portable photosynthetic rate determinator, so that the determinator can automatically determine net photosynthetic rate, light respiration rate and intercellular CO₂And (4) concentration.

The T1 generation is transferred into SEM1 gene paddy rice (OV-1, OV-2, OV-3, OV-4) and wild type Japanese fine rice (CK) to be planted in a field, and photosynthetic efficiency (umolm) of photosynthesis related parameters is detected in the mature period²s^-1) Transpiration efficiency (mmolm)²s^-1) Intercellular CO₂Concentration (molmol)^-1) And CO₂Porosity conductance (mol)²s^-1)。

As a result, as shown in Table 5 below, the SEM1 gene can improve photosynthetic efficiency. .

TABLE 4 comparison of partial agronomic traits in overexpressing lines

	Number of grains per ear	Thousand Ke weight (g)
			CK (5 single plant)	110	25.2
OV1(5 single plant)	135**	28.2**
			OV2(5 single plant)	136**	28.5**
OV3(5 single plant)	140**	28.4**
			OV4(5 single plant)	141**	28.3**
Mutant (sem1) (5 individuals)	78	22.3

TABLE 5 photosynthetic data of overexpressing strains

From the results in tables 4 and 5, it is shown that SEM1 has the effect of coordinating the transport of photosynthetic products in plants and that overexpression can improve plant yield. Wherein CK represents a recipient plant of the recombinant vector, OV1, OV2, OV3 and OV4 represent lines in which SEM1 gene is overexpressed (at least two times as much as that of a recipient plant as a control) in T1-generation lines; statistical differences were very significant.

The foregoing list is only illustrative of several embodiments of the present invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> institute of biotechnology of Chinese academy of agricultural sciences

Rice Research Institute Anhui Academy of Agricultural Sciences

<120> clone of key gene SEM1 for controlling source flow of rice bank and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5730

<212> DNA

<213> Oryza sativa L.

<400> 1

atggcgacgg ggggaggggg gttgtcgggg ccgcagccgt cgctgcggcg gggcttgtcg 60

agggcgttca ccatgaggcc ggaggggtac tccggggagg acggcgggga gtacagcgag 120

gagagcgagc tggtgcctaa ctcgctcgcc cccatcgtcc ccatcctccg cgccgccaac 180

gagatcgagg aggagaacca gcgcgtcgcc tacctctgtc ggtttaccgc gttcgagaag 240

gctcacacca tggatccaaa ctcaggtgga cgaggagttc ggcaattcaa aacatacctc 300

ttgcataggc tggagaagga tgaacacgag acacagcgca gacttgcagg aacagatgcg 360

aaagagattc agcggtttta tgagcattat tgtaaaaaaa atcttgtgga cggtcttaag 420

acaaaaaaac cggaggagat ggctagacac tatcagattg cgtccgtcct atatgatgtg 480

ctaaaaaccg tgacacctga aaaatttcac gctgagtttg atatatatgc taaagaggtt 540

gaaaaggaga aagcttcctt ctcacactac aacattctac cccttaatat ttctggtcag 600

cgacaaccag taatggaaat tcctgagatt aaagcagcag tggaccttct tcgcaagata 660

gacggcctcc cgatgccaag gcttgatcca gtttctgctg aaaaagagac agatgtacct 720

actgtccgtg atttgtttga ttggctctgg ctgacatttg gatttcagaa aggcaatgtt 780

gagaatcaga aggagcattt gattttgctg cttgcaaata ttgatatgag aaaaggggct 840

aatgcctacc aaagtgacag acacaatcat gtgatgcata gtgatacagt tagatccttg 900

atgaggaaaa tctttgaaaa ctacatttct tggtgccgat atttacattt ggagtcaaac 960

ataaaaattc caaacgatgc ctccacacaa caacctgaga ttctttacat agggttgtat 1020

ttgctgatct ggggtgaagc ttctaatgtt cgctttatgc ctgaatgtat ttgttatatc 1080

ttccatcata tggcaaggga tttgtatgac atcatatctg atagaagaca agattttgat 1140

ccaccctttc ggcgagaggg gagtgatgat gcctttctac agcttgttat tcaacccatc 1200

tacagtgtta tgaagcagga agctgcaatg aataaacgtg gtaggacaag ccactcaaag 1260

tggagaaact atgatgacct gaatgaatac ttttggtcaa agagatgctt caaacagctt 1320

aaatggccga tggattcagc agctgacttt tttgcggttc ctctgaaaat taaaactgaa 1380

gagcatcatg atcgtgtgat taccagacgg agaataccca aaacaaattt tgttgaagtt 1440

cgtacatttt tgcacctatt cagaagtttt gatcgaatgt gggctttctt tatattagcc 1500

ttccaggcga tggtaattgt tgcttggagc ccttctggat taccgtctgc tatttttgat 1560

cctactgttt tcagaaatgt tttgacaata ttcataacgg ctgcatttct gaacttcctg 1620

caagccacgc ttgagataat tcttaactgg aaagcttgga ggagtctgga gtgctcgcag 1680

atgatacgat atatcctgaa atttgttgta gctgttgctt ggttgataat tcttcctaca 1740

acgtatatga gttctattca aaattccacg ggccttatca agttcttcag cagctggatt 1800

ggaaatctgc agagtgaatc gatatataat tttgccgttg ctctttacat gttaccaaac 1860

atattcagtg ctttgttttt catatttcta ccatttcgaa gggtattgga gcgttcaaat 1920

tctcgcatta ttagattttt tttgtggtgg acacagccaa agctatatgt tgcccgaggc 1980

atgtatgagg atacatgttc acttctaaag tatacattat tctggatact attgctcata 2040

tgcaagctcg ccttcagttt ctatgttgag atttatcctc tcgttggacc aacgaggaca 2100

attatgttct tgggacgagg gcaatacgca tggcatgagt tctttccata cttgcagcat 2160

aatttaggtg ttgtaattac tgtatgggca ccaattgtca tggtatactt catggacaca 2220

caaatatggt atgccatttt ttcaacaata tgtggtggag tgaatggtgc cttcagccgc 2280

ttgggtgaga tccggaccct tggaatgtta agatcacgat tcgaggcaat tccaatagca 2340

tttggcaaac atcttgtgcc tggacatgat agtcaaccaa agagacacga gcatgaggaa 2400

gacaaaatta acaagttctc tgacatatgg aatgcattta ttcactcttt gagagaagaa 2460

gacttaataa gcaataggga gagaaattta ctgattgttc catcatctat gggtgatact 2520

actgtttttc agtggcctcc tttccttctc gctagtaaga ttccaattgc acttgacatg 2580

gctaatagtg tcaaaaaaag ggatgaagaa ttgagaaaga ggataaatca ggatccatat 2640

acctattatg ctgtagtaga atgctaccag acattgttta gtattctaga cagccttatt 2700

gtggaacaaa gtgataagaa agttgttgat agaatacatg ataggattga agatagcata 2760

agacgtcagt cacttgtaaa agagttccga ttggatgaac ttcctcagct aagtgctaag 2820

tttgataagc tgctaaatct attgttgaga actgatgaag acattgaacc gataaagaca 2880

caaattgcca atttgttaca agatataatg gaaatcatca cacaggatat tatgaagaat 2940

ggacaaggta ttttgaagga tgaaaacaga aacaatcaat tgtttgcaaa tataaatctg 3000

gattcagtaa aagataaaac ttggaaggag aagtgtgtta ggcttcaact attattgaca 3060

acgaaagaat ctgcaatata tgtacctaca aacttggatg ctcgtcgcag gatcactttc 3120

tttgcaaact cacttttcat gaaaatgcca aaggctccac aggtccgcag tatgatgtcc 3180

tttagtgttt taactcccta cttcaaagag gaggtgctct tttcagcaga agacctttat 3240

aaaaagaatg aggatggaat atccatactg ttctatctac ggaaaatata tccagatgaa 3300

tggaagaatt ttcttgagag gatagaattt caaccaacgg atgaagaatc actgaaaaca 3360

aagatggatg aaatccggcc ctgggcatct tatagggggc aaacactcac cagaactgta 3420

agaggaatga tgtactaccg cagagcactt gagattcagt gtattcaaga caaaactgat 3480

attgttaaac tggaacatcg tagaacagta gagtcttctc aacaggggtg ggccagtttc 3540

gatatggcac gggcaattgc tgatatcaaa tttacctatg ttgtctcttg tcaagtctat 3600

ggaatgcaaa agacatccaa ggatcccaaa gacaaagctt gctatttaaa catccttaat 3660

ctcatgttaa tgtacccatc gttacgtgtt gcttatattg atgaagtaga agctccagct 3720

ggtaatggga caacagagaa gacttattat tctgttcttg tcaaaggagg tgaaaagtat 3780

gatgaggaaa tttatcgcat caagcttcct ggcaaaccta cagatattgg agagggaaaa 3840

cctgaaaatc aaaaccatgc cattgttttc accaggggag aggcactcca ggccattgat 3900

atgaatcagg ataattacct cgaagaggca tttaaaatga gaaatgtgct ggaggagttt 3960

gagagtgaaa agtatggaaa gagaaaaccc actatattag gcctccgtga gcacattttt 4020

actgggagtg tttcatcact tgcttggttt atgtccaacc aagagaccag ttttgttacc 4080

attgggcaac gagtcttggc taatcctctc aaggttcggt tccattatgg tcatcctgat 4140

attttcgata gactcttcca tattactaga ggtggcataa gtaaagcctc aaagactata 4200

aatctaagtg aagatatatt ttcaggtttt aattcaacaa tgagagaagg gaatgtcaca 4260

catcatgagt atatgcaagt tggtaagggg cgtgatgtgg gaatgaatca aatttcaagc 4320

tttgaagcta aggtggcaaa tggcaatggt gaacaaacat tgagtcgtga tatctatcgg 4380

ctggggcgca gattcgattt ttatagaatg ctatccttct actttactac agttgggttt 4440

tactttagta gcatggttac agtacttaca gtttatgtgt ttctatatgg gaggttatat 4500

ctagttatga gtggtctgga aaggtctatt ttgctggatc cacgtatcga gcagaacatt 4560

aagcctcttg aaaacgcact ggcctcgcag tcttttttcc agctaggttt gctgcttgtt 4620

ctccctatgg taatggaagt tggcttagaa aagggattcc gcacagcatt aggagagttt 4680

gttatcatgc agcttcagct ggcatctgtg tttttcacat tccagcttgg caccaaaacg 4740

cactactacg gaagaacaat actgcatggc ggggctaaat acagacctac aggtcgtgga 4800

tttgttgtct accatgcaaa gtttgctgac aattaccgca tgtactcccg cagccacttt 4860

gttaaaggac ttgaactgtt gatacttctg gtggtttatt tagtgtatgg aagttcctac 4920

cgcagctcaa gcatgtacct atttgtcacc ttctccatat ggttcctggt tgcatcttgg 4980

ctcttcgcac cctttatctt caatccgtca tgcttcgaat ggcagaagac agttgatgac 5040

tggacagatt ggaggaagtg gatggggaac cgtgggggta tcggcatgtc tgtggatcaa 5100

agctgggagg cttggtggat aagtgagcag gagcacctta ggaagactag cattcgctct 5160

ctcctcttgg aaatcattct ttcgctccgc ttcttgatct atcagtacgg tattgtgtac 5220

catctgaaca tagcacgccg cagcaaaagc attctggtat atggattgtc atggctggtt 5280

atgctctcag tcctagtagt tctaaagatg gtttcgattg ggcgacagaa gtttggaaca 5340

gatctgcagc ttatgttccg cattctcaag ggcctcctgt tccttggttt tgtctctgtg 5400

atggctgtat tattcgtcgt ttgtaacctc acaatttcgg atgtttttgc tagtattctt 5460

gggttcatgc ctactggttg gtgcattctt ctgattgggc aggcatgttc gccgttggtg 5520

aagaaggcaa tgctgtggga ttccatcatg gagctcggga ggtcgtacga gaacctgatg 5580

ggactcgtcc tcttcctccc catcggcctc ttgtcatggt tccccttcgt gtccgagttc 5640

cagacacgac tgctcttcaa ccaggccttc agccgtggcc tccagatctc aaggatcctc 5700

gccgggcaaa aggacattgg agaggaatga 5730

<210> 2

<211> 1909

<212> PRT

<213> Oryza sativa L.

<400> 2

Met Ala Thr Gly Gly Gly Gly Leu Ser Gly Pro Gln Pro Ser Leu Arg

1 5 10 15

Arg Gly Leu Ser Arg Ala Phe Thr Met Arg Pro Glu Gly Tyr Ser Gly

20 25 30

Glu Asp Gly Gly Glu Tyr Ser Glu Glu Ser Glu Leu Val Pro Asn Ser

35 40 45

Leu Ala Pro Ile Val Pro Ile Leu Arg Ala Ala Asn Glu Ile Glu Glu

50 55 60

Glu Asn Gln Arg Val Ala Tyr Leu Cys Arg Phe Thr Ala Phe Glu Lys

65 70 75 80

Ala His Thr Met Asp Pro Asn Ser Gly Gly Arg Gly Val Arg Gln Phe

85 90 95

Lys Thr Tyr Leu Leu His Arg Leu Glu Lys Asp Glu His Glu Thr Gln

100 105 110

Arg Arg Leu Ala Gly Thr Asp Ala Lys Glu Ile Gln Arg Phe Tyr Glu

115 120 125

His Tyr Cys Lys Lys Asn Leu Val Asp Gly Leu Lys Thr Lys Lys Pro

130 135 140

Glu Glu Met Ala Arg His Tyr Gln Ile Ala Ser Val Leu Tyr Asp Val

145 150 155 160

Leu Lys Thr Val Thr Pro Glu Lys Phe His Ala Glu Phe Asp Ile Tyr

165 170 175

Ala Lys Glu Val Glu Lys Glu Lys Ala Ser Phe Ser His Tyr Asn Ile

180 185 190

Leu Pro Leu Asn Ile Ser Gly Gln Arg Gln Pro Val Met Glu Ile Pro

195 200 205

Glu Ile Lys Ala Ala Val Asp Leu Leu Arg Lys Ile Asp Gly Leu Pro

210 215 220

Met Pro Arg Leu Asp Pro Val Ser Ala Glu Lys Glu Thr Asp Val Pro

225 230 235 240

Thr Val Arg Asp Leu Phe Asp Trp Leu Trp Leu Thr Phe Gly Phe Gln

245 250 255

Lys Gly Asn Val Glu Asn Gln Lys Glu His Leu Ile Leu Leu Leu Ala

260 265 270

Asn Ile Asp Met Arg Lys Gly Ala Asn Ala Tyr Gln Ser Asp Arg His

275 280 285

Asn His Val Met His Ser Asp Thr Val Arg Ser Leu Met Arg Lys Ile

290 295 300

Phe Glu Asn Tyr Ile Ser Trp Cys Arg Tyr Leu His Leu Glu Ser Asn

305 310 315 320

Ile Lys Ile Pro Asn Asp Ala Ser Thr Gln Gln Pro Glu Ile Leu Tyr

325 330 335

Ile Gly Leu Tyr Leu Leu Ile Trp Gly Glu Ala Ser Asn Val Arg Phe

340 345 350

Met Pro Glu Cys Ile Cys Tyr Ile Phe His His Met Ala Arg Asp Leu

355 360 365

Tyr Asp Ile Ile Ser Asp Arg Arg Gln Asp Phe Asp Pro Pro Phe Arg

370 375 380

Arg Glu Gly Ser Asp Asp Ala Phe Leu Gln Leu Val Ile Gln Pro Ile

385 390 395 400

Tyr Ser Val Met Lys Gln Glu Ala Ala Met Asn Lys Arg Gly Arg Thr

405 410 415

Ser His Ser Lys Trp Arg Asn Tyr Asp Asp Leu Asn Glu Tyr Phe Trp

420 425 430

Ser Lys Arg Cys Phe Lys Gln Leu Lys Trp Pro Met Asp Ser Ala Ala

435 440 445

Asp Phe Phe Ala Val Pro Leu Lys Ile Lys Thr Glu Glu His His Asp

450 455 460

Arg Val Ile Thr Arg Arg Arg Ile Pro Lys Thr Asn Phe Val Glu Val

465 470 475 480

Arg Thr Phe Leu His Leu Phe Arg Ser Phe Asp Arg Met Trp Ala Phe

485 490 495

Phe Ile Leu Ala Phe Gln Ala Met Val Ile Val Ala Trp Ser Pro Ser

500 505 510

Gly Leu Pro Ser Ala Ile Phe Asp Pro Thr Val Phe Arg Asn Val Leu

515 520 525

Thr Ile Phe Ile Thr Ala Ala Phe Leu Asn Phe Leu Gln Ala Thr Leu

530 535 540

Glu Ile Ile Leu Asn Trp Lys Ala Trp Arg Ser Leu Glu Cys Ser Gln

545 550 555 560

Met Ile Arg Tyr Ile Leu Lys Phe Val Val Ala Val Ala Trp Leu Ile

565 570 575

Ile Leu Pro Thr Thr Tyr Met Ser Ser Ile Gln Asn Ser Thr Gly Leu

580 585 590

Ile Lys Phe Phe Ser Ser Trp Ile Gly Asn Leu Gln Ser Glu Ser Ile

595 600 605

Tyr Asn Phe Ala Val Ala Leu Tyr Met Leu Pro Asn Ile Phe Ser Ala

610 615 620

Leu Phe Phe Ile Phe Leu Pro Phe Arg Arg Val Leu Glu Arg Ser Asn

625 630 635 640

Ser Arg Ile Ile Arg Phe Phe Leu Trp Trp Thr Gln Pro Lys Leu Tyr

645 650 655

Val Ala Arg Gly Met Tyr Glu Asp Thr Cys Ser Leu Leu Lys Tyr Thr

660 665 670

Leu Phe Trp Ile Leu Leu Leu Ile Cys Lys Leu Ala Phe Ser Phe Tyr

675 680 685

Val Glu Ile Tyr Pro Leu Val Gly Pro Thr Arg Thr Ile Met Phe Leu

690 695 700

Gly Arg Gly Gln Tyr Ala Trp His Glu Phe Phe Pro Tyr Leu Gln His

705 710 715 720

Asn Leu Gly Val Val Ile Thr Val Trp Ala Pro Ile Val Met Val Tyr

725 730 735

Phe Met Asp Thr Gln Ile Trp Tyr Ala Ile Phe Ser Thr Ile Cys Gly

740 745 750

Gly Val Asn Gly Ala Phe Ser Arg Leu Gly Glu Ile Arg Thr Leu Gly

755 760 765

Met Leu Arg Ser Arg Phe Glu Ala Ile Pro Ile Ala Phe Gly Lys His

770 775 780

Leu Val Pro Gly His Asp Ser Gln Pro Lys Arg His Glu His Glu Glu

785 790 795 800

Asp Lys Ile Asn Lys Phe Ser Asp Ile Trp Asn Ala Phe Ile His Ser

805 810 815

Leu Arg Glu Glu Asp Leu Ile Ser Asn Arg Glu Arg Asn Leu Leu Ile

820 825 830

Val Pro Ser Ser Met Gly Asp Thr Thr Val Phe Gln Trp Pro Pro Phe

835 840 845

Leu Leu Ala Ser Lys Ile Pro Ile Ala Leu Asp Met Ala Asn Ser Val

850 855 860

Lys Lys Arg Asp Glu Glu Leu Arg Lys Arg Ile Asn Gln Asp Pro Tyr

865 870 875 880

Thr Tyr Tyr Ala Val Val Glu Cys Tyr Gln Thr Leu Phe Ser Ile Leu

885 890 895

Asp Ser Leu Ile Val Glu Gln Ser Asp Lys Lys Val Val Asp Arg Ile

900 905 910

His Asp Arg Ile Glu Asp Ser Ile Arg Arg Gln Ser Leu Val Lys Glu

915 920 925

Phe Arg Leu Asp Glu Leu Pro Gln Leu Ser Ala Lys Phe Asp Lys Leu

930 935 940

Leu Asn Leu Leu Leu Arg Thr Asp Glu Asp Ile Glu Pro Ile Lys Thr

945 950 955 960

Gln Ile Ala Asn Leu Leu Gln Asp Ile Met Glu Ile Ile Thr Gln Asp

965 970 975

Ile Met Lys Asn Gly Gln Gly Ile Leu Lys Asp Glu Asn Arg Asn Asn

980 985 990

Gln Leu Phe Ala Asn Ile Asn Leu Asp Ser Val Lys Asp Lys Thr Trp

995 1000 1005

Lys Glu Lys Cys Val Arg Leu Gln Leu Leu Leu Thr Thr Lys Glu Ser

1010 1015 1020

Ala Ile Tyr Val Pro Thr Asn Leu Asp Ala Arg Arg Arg Ile Thr Phe

1025 1030 1035 1040

Phe Ala Asn Ser Leu Phe Met Lys Met Pro Lys Ala Pro Gln Val Arg

1045 1050 1055

Ser Met Met Ser Phe Ser Val Leu Thr Pro Tyr Phe Lys Glu Glu Val

1060 1065 1070

Leu Phe Ser Ala Glu Asp Leu Tyr Lys Lys Asn Glu Asp Gly Ile Ser

1075 1080 1085

Ile Leu Phe Tyr Leu Arg Lys Ile Tyr Pro Asp Glu Trp Lys Asn Phe

1090 1095 1100

Leu Glu Arg Ile Glu Phe Gln Pro Thr Asp Glu Glu Ser Leu Lys Thr

1105 1110 1115 1120

Lys Met Asp Glu Ile Arg Pro Trp Ala Ser Tyr Arg Gly Gln Thr Leu

1125 1130 1135

Thr Arg Thr Val Arg Gly Met Met Tyr Tyr Arg Arg Ala Leu Glu Ile

1140 1145 1150

Gln Cys Ile Gln Asp Lys Thr Asp Ile Val Lys Leu Glu His Arg Arg

1155 1160 1165

Thr Val Glu Ser Ser Gln Gln Gly Trp Ala Ser Phe Asp Met Ala Arg

1170 1175 1180

Ala Ile Ala Asp Ile Lys Phe Thr Tyr Val Val Ser Cys Gln Val Tyr

1185 1190 1195 1200

Gly Met Gln Lys Thr Ser Lys Asp Pro Lys Asp Lys Ala Cys Tyr Leu

1205 1210 1215

Asn Ile Leu Asn Leu Met Leu Met Tyr Pro Ser Leu Arg Val Ala Tyr

1220 1225 1230

Ile Asp Glu Val Glu Ala Pro Ala Gly Asn Gly Thr Thr Glu Lys Thr

1235 1240 1245

Tyr Tyr Ser Val Leu Val Lys Gly Gly Glu Lys Tyr Asp Glu Glu Ile

1250 1255 1260

Tyr Arg Ile Lys Leu Pro Gly Lys Pro Thr Asp Ile Gly Glu Gly Lys

1265 1270 1275 1280

Pro Glu Asn Gln Asn His Ala Ile Val Phe Thr Arg Gly Glu Ala Leu

1285 1290 1295

Gln Ala Ile Asp Met Asn Gln Asp Asn Tyr Leu Glu Glu Ala Phe Lys

1300 1305 1310

Met Arg Asn Val Leu Glu Glu Phe Glu Ser Glu Lys Tyr Gly Lys Arg

1315 1320 1325

Lys Pro Thr Ile Leu Gly Leu Arg Glu His Ile Phe Thr Gly Ser Val

1330 1335 1340

Ser Ser Leu Ala Trp Phe Met Ser Asn Gln Glu Thr Ser Phe Val Thr

1345 1350 1355 1360

Ile Gly Gln Arg Val Leu Ala Asn Pro Leu Lys Val Arg Phe His Tyr

1365 1370 1375

Gly His Pro Asp Ile Phe Asp Arg Leu Phe His Ile Thr Arg Gly Gly

1380 1385 1390

Ile Ser Lys Ala Ser Lys Thr Ile Asn Leu Ser Glu Asp Ile Phe Ser

1395 1400 1405

Gly Phe Asn Ser Thr Met Arg Glu Gly Asn Val Thr His His Glu Tyr

1410 1415 1420

Met Gln Val Gly Lys Gly Arg Asp Val Gly Met Asn Gln Ile Ser Ser

1425 1430 1435 1440

Phe Glu Ala Lys Val Ala Asn Gly Asn Gly Glu Gln Thr Leu Ser Arg

1445 1450 1455

Asp Ile Tyr Arg Leu Gly Arg Arg Phe Asp Phe Tyr Arg Met Leu Ser

1460 1465 1470

Phe Tyr Phe Thr Thr Val Gly Phe Tyr Phe Ser Ser Met Val Thr Val

1475 1480 1485

Leu Thr Val Tyr Val Phe Leu Tyr Gly Arg Leu Tyr Leu Val Met Ser

1490 1495 1500

Gly Leu Glu Arg Ser Ile Leu Leu Asp Pro Arg Ile Glu Gln Asn Ile

1505 1510 1515 1520

Lys Pro Leu Glu Asn Ala Leu Ala Ser Gln Ser Phe Phe Gln Leu Gly

1525 1530 1535

Leu Leu Leu Val Leu Pro Met Val Met Glu Val Gly Leu Glu Lys Gly

1540 1545 1550

Phe Arg Thr Ala Leu Gly Glu Phe Val Ile Met Gln Leu Gln Leu Ala

1555 1560 1565

Ser Val Phe Phe Thr Phe Gln Leu Gly Thr Lys Thr His Tyr Tyr Gly

1570 1575 1580

Arg Thr Ile Leu His Gly Gly Ala Lys Tyr Arg Pro Thr Gly Arg Gly

1585 1590 1595 1600

Phe Val Val Tyr His Ala Lys Phe Ala Asp Asn Tyr Arg Met Tyr Ser

1605 1610 1615

Arg Ser His Phe Val Lys Gly Leu Glu Leu Leu Ile Leu Leu Val Val

1620 1625 1630

Tyr Leu Val Tyr Gly Ser Ser Tyr Arg Ser Ser Ser Met Tyr Leu Phe

1635 1640 1645

Val Thr Phe Ser Ile Trp Phe Leu Val Ala Ser Trp Leu Phe Ala Pro

1650 1655 1660

Phe Ile Phe Asn Pro Ser Cys Phe Glu Trp Gln Lys Thr Val Asp Asp

1665 1670 1675 1680

Trp Thr Asp Trp Arg Lys Trp Met Gly Asn Arg Gly Gly Ile Gly Met

1685 1690 1695

Ser Val Asp Gln Ser Trp Glu Ala Trp Trp Ile Ser Glu Gln Glu His

1700 1705 1710

Leu Arg Lys Thr Ser Ile Arg Ser Leu Leu Leu Glu Ile Ile Leu Ser

1715 1720 1725

Leu Arg Phe Leu Ile Tyr Gln Tyr Gly Ile Val Tyr His Leu Asn Ile

1730 1735 1740

Ala Arg Arg Ser Lys Ser Ile Leu Val Tyr Gly Leu Ser Trp Leu Val

1745 1750 1755 1760

Met Leu Ser Val Leu Val Val Leu Lys Met Val Ser Ile Gly Arg Gln

1765 1770 1775

Lys Phe Gly Thr Asp Leu Gln Leu Met Phe Arg Ile Leu Lys Gly Leu

1780 1785 1790

Leu Phe Leu Gly Phe Val Ser Val Met Ala Val Leu Phe Val Val Cys

1795 1800 1805

Asn Leu Thr Ile Ser Asp Val Phe Ala Ser Ile Leu Gly Phe Met Pro

1810 1815 1820

Thr Gly Trp Cys Ile Leu Leu Ile Gly Gln Ala Cys Ser Pro Leu Val

1825 1830 1835 1840

Lys Lys Ala Met Leu Trp Asp Ser Ile Met Glu Leu Gly Arg Ser Tyr

1845 1850 1855

Glu Asn Leu Met Gly Leu Val Leu Phe Leu Pro Ile Gly Leu Leu Ser

1860 1865 1870

Trp Phe Pro Phe Val Ser Glu Phe Gln Thr Arg Leu Leu Phe Asn Gln

1875 1880 1885

Ala Phe Ser Arg Gly Leu Gln Ile Ser Arg Ile Leu Ala Gly Gln Lys

1890 1895 1900

Asp Ile Gly Glu Glu

1905

<210> 3

<211> 6295

<212> DNA

<213> Oryza sativa L.

<400> 3

cgcgcactcc gcactcacac tcccccctcc ctcccgctta agaagatgcc ttgcccccat 60

ctcctcctcc ccttcctcgc cgatcctcac caccaccacc gccgccaccg ccgccaacgc 120

cgccgcggcg ttggtctcga tcgttgtcga atagggagga gggggtacgt tggtcgtcgt 180

cgtcgttgtc gtagtcgccg ccgcggggcg ggggaggcat ggcgacgggg ggaggggggt 240

tgtcggggcc gcagccgtcg ctgcggcggg gcttgtcgag ggcgttcacc atgaggccgg 300

aggggtactc cggggaggac ggcggggagt acagcgagga gagcgagctg gtgcctaact 360

cgctcgcccc catcgtcccc atcctccgcg ccgccaacga gatcgaggag gagaaccagc 420

gcgtcgccta cctctgtcgg tttaccgcgt tcgagaaggc tcacaccatg gatccaaact 480

caggtggacg aggagttcgg caattcaaaa catacctctt gcataggctg gagaaggatg 540

aacacgagac acagcgcaga cttgcaggaa cagatgcgaa agagattcag cggttttatg 600

agcattattg taaaaaaaat cttgtggacg gtcttaagac aaaaaaaccg gaggagatgg 660

ctagacacta tcagattgcg tccgtcctat atgatgtgct aaaaaccgtg acacctgaaa 720

aatttcacgc tgagtttgat atatatgcta aagaggttga aaaggagaaa gcttccttct 780

cacactacaa cattctaccc cttaatattt ctggtcagcg acaaccagta atggaaattc 840

ctgagattaa agcagcagtg gaccttcttc gcaagataga cggcctcccg atgccaaggc 900

ttgatccagt ttctgctgaa aaagagacag atgtacctac tgtccgtgat ttgtttgatt 960

ggctctggct gacatttgga tttcagaaag gcaatgttga gaatcagaag gagcatttga 1020

ttttgctgct tgcaaatatt gatatgagaa aaggggctaa tgcctaccaa agtgacagac 1080

acaatcatgt gatgcatagt gatacagtta gatccttgat gaggaaaatc tttgaaaact 1140

acatttcttg gtgccgatat ttacatttgg agtcaaacat aaaaattcca aacgatgcct 1200

ccacacaaca acctgagatt ctttacatag ggttgtattt gctgatctgg ggtgaagctt 1260

ctaatgttcg ctttatgcct gaatgtattt gttatatctt ccatcatatg gcaagggatt 1320

tgtatgacat catatctgat agaagacaag attttgatcc accctttcgg cgagagggga 1380

gtgatgatgc ctttctacag cttgttattc aacccatcta cagtgttatg aagcaggaag 1440

ctgcaatgaa taaacgtggt aggacaagcc actcaaagtg gagaaactat gatgacctga 1500

atgaatactt ttggtcaaag agatgcttca aacagcttaa atggccgatg gattcagcag 1560

ctgacttttt tgcggttcct ctgaaaatta aaactgaaga gcatcatgat cgtgtgatta 1620

ccagacggag aatacccaaa acaaattttg ttgaagttcg tacatttttg cacctattca 1680

gaagttttga tcgaatgtgg gctttcttta tattagcctt ccaggcgatg gtaattgttg 1740

cttggagccc ttctggatta ccgtctgcta tttttgatcc tactgttttc agaaatgttt 1800

tgacaatatt cataacggct gcatttctga acttcctgca agccacgctt gagataattc 1860

ttaactggaa agcttggagg agtctggagt gctcgcagat gatacgatat atcctgaaat 1920

ttgttgtagc tgttgcttgg ttgataattc ttcctacaac gtatatgagt tctattcaaa 1980

attccacggg ccttatcaag ttcttcagca gctggattgg aaatctgcag agtgaatcga 2040

tatataattt tgccgttgct ctttacatgt taccaaacat attcagtgct ttgtttttca 2100

tatttctacc atttcgaagg gtattggagc gttcaaattc tcgcattatt agattttttt 2160

tgtggtggac acagccaaag ctatatgttg cccgaggcat gtatgaggat acatgttcac 2220

ttctaaagta tacattattc tggatactat tgctcatatg caagctcgcc ttcagtttct 2280

atgttgagat ttatcctctc gttggaccaa cgaggacaat tatgttcttg ggacgagggc 2340

aatacgcatg gcatgagttc tttccatact tgcagcataa tttaggtgtt gtaattactg 2400

tatgggcacc aattgtcatg gtatacttca tggacacaca aatatggtat gccatttttt 2460

caacaatatg tggtggagtg aatggtgcct tcagccgctt gggtgagatc cggacccttg 2520

gaatgttaag atcacgattc gaggcaattc caatagcatt tggcaaacat cttgtgcctg 2580

gacatgatag tcaaccaaag agacacgagc atgaggaaga caaaattaac aagttctctg 2640

acatatggaa tgcatttatt cactctttga gagaagaaga cttaataagc aatagggaga 2700

gaaatttact gattgttcca tcatctatgg gtgatactac tgtttttcag tggcctcctt 2760

tccttctcgc tagtaagatt ccaattgcac ttgacatggc taatagtgtc aaaaaaaggg 2820

atgaagaatt gagaaagagg ataaatcagg atccatatac ctattatgct gtagtagaat 2880

gctaccagac attgtttagt attctagaca gccttattgt ggaacaaagt gataagaaag 2940

ttgttgatag aatacatgat aggattgaag atagcataag acgtcagtca cttgtaaaag 3000

agttccgatt ggatgaactt cctcagctaa gtgctaagtt tgataagctg ctaaatctat 3060

tgttgagaac tgatgaagac attgaaccga taaagacaca aattgccaat ttgttacaag 3120

atataatgga aatcatcaca caggatatta tgaagaatgg acaaggtatt ttgaaggatg 3180

aaaacagaaa caatcaattg tttgcaaata taaatctgga ttcagtaaaa gataaaactt 3240

ggaaggagaa gtgtgttagg cttcaactat tattgacaac gaaagaatct gcaatatatg 3300

tacctacaaa cttggatgct cgtcgcagga tcactttctt tgcaaactca cttttcatga 3360

aaatgccaaa ggctccacag gtccgcagta tgatgtcctt tagtgtttta actccctact 3420

tcaaagagga ggtgctcttt tcagcagaag acctttataa aaagaatgag gatggaatat 3480

ccatactgtt ctatctacgg aaaatatatc cagatgaatg gaagaatttt cttgagagga 3540

tagaatttca accaacggat gaagaatcac tgaaaacaaa gatggatgaa atccggccct 3600

gggcatctta tagggggcaa acactcacca gaactgtaag aggaatgatg tactaccgca 3660

gagcacttga gattcagtgt attcaagaca aaactgatat tgttaaactg gaacatcgta 3720

gaacagtaga gtcttctcaa caggggtggg ccagtttcga tatggcacgg gcaattgctg 3780

atatcaaatt tacctatgtt gtctcttgtc aagtctatgg aatgcaaaag acatccaagg 3840

atcccaaaga caaagcttgc tatttaaaca tccttaatct catgttaatg tacccatcgt 3900

tacgtgttgc ttatattgat gaagtagaag ctccagctgg taatgggaca acagagaaga 3960

cttattattc tgttcttgtc aaaggaggtg aaaagtatga tgaggaaatt tatcgcatca 4020

agcttcctgg caaacctaca gatattggag agggaaaacc tgaaaatcaa aaccatgcca 4080

ttgttttcac caggggagag gcactccagg ccattgatat gaatcaggat aattacctcg 4140

aagaggcatt taaaatgaga aatgtgctgg aggagtttga gagtgaaaag tatggaaaga 4200

gaaaacccac tatattaggc ctccgtgagc acatttttac tgggagtgtt tcatcacttg 4260

cttggtttat gtccaaccaa gagaccagtt ttgttaccat tgggcaacga gtcttggcta 4320

atcctctcaa ggttcggttc cattatggtc atcctgatat tttcgataga ctcttccata 4380

ttactagagg tggcataagt aaagcctcaa agactataaa tctaagtgaa gatatatttt 4440

caggttttaa ttcaacaatg agagaaggga atgtcacaca tcatgagtat atgcaagttg 4500

gtaaggggcg tgatgtggga atgaatcaaa tttcaagctt tgaagctaag gtggcaaatg 4560

gcaatggtga acaaacattg agtcgtgata tctatcggct ggggcgcaga ttcgattttt 4620

atagaatgct atccttctac tttactacag ttgggtttta ctttagtagc atggttacag 4680

tacttacagt ttatgtgttt ctatatggga ggttatatct agttatgagt ggtctggaaa 4740

ggtctatttt gctggatcca cgtatcgagc agaacattaa gcctcttgaa aacgcactgg 4800

cctcgcagtc ttttttccag ctaggtttgc tgcttgttct ccctatggta atggaagttg 4860

gcttagaaaa gggattccgc acagcattag gagagtttgt tatcatgcag cttcagctgg 4920

catctgtgtt tttcacattc cagcttggca ccaaaacgca ctactacgga agaacaatac 4980

tgcatggcgg ggctaaatac agacctacag gtcgtggatt tgttgtctac catgcaaagt 5040

ttgctgacaa ttaccgcatg tactcccgca gccactttgt taaaggactt gaactgttga 5100

tacttctggt ggtttattta gtgtatggaa gttcctaccg cagctcaagc atgtacctat 5160

ttgtcacctt ctccatatgg ttcctggttg catcttggct cttcgcaccc tttatcttca 5220

atccgtcatg cttcgaatgg cagaagacag ttgatgactg gacagattgg aggaagtgga 5280

tggggaaccg tgggggtatc ggcatgtctg tggatcaaag ctgggaggct tggtggataa 5340

gtgagcagga gcaccttagg aagactagca ttcgctctct cctcttggaa atcattcttt 5400

cgctccgctt cttgatctat cagtacggta ttgtgtacca tctgaacata gcacgccgca 5460

gcaaaagcat tctggtatat ggattgtcat ggctggttat gctctcagtc ctagtagttc 5520

taaagatggt ttcgattggg cgacagaagt ttggaacaga tctgcagctt atgttccgca 5580

ttctcaaggg cctcctgttc cttggttttg tctctgtgat ggctgtatta ttcgtcgttt 5640

gtaacctcac aatttcggat gtttttgcta gtattcttgg gttcatgcct actggttggt 5700

gcattcttct gattgggcag gcatgttcgc cgttggtgaa gaaggcaatg ctgtgggatt 5760

ccatcatgga gctcgggagg tcgtacgaga acctgatggg actcgtcctc ttcctcccca 5820

tcggcctctt gtcatggttc cccttcgtgt ccgagttcca gacacgactg ctcttcaacc 5880

aggccttcag ccgtggcctc cagatctcaa ggatcctcgc cgggcaaaag gacattggag 5940

aggaatgaat gaatggatga atggcccctc ctggcctcgt ctcctccggt gaactcgctt 6000

ggacgaaaaa accatcgatt ttgggcggct agttcgttga tagggccttt tttaaatagt 6060

tctgaacaaa caaatagtag ccggtacatc tgaactgtag tataaatgtt tgttcctctt 6120

tagaacaagg catatatatg tagtaagcaa ttaacataaa tgcagtacgt tggtatattt 6180

ccaagggtcg gcatgtcagg atatattaat tagttagtga ctggctagac atcagtttcc 6240

ttctgttctc gaacgtgtgt tcttctgttc agccgttctg gatgtagcat gtcaa 6295

Claims (6)

1. Use of SEM1 protein in any one of the following P1-P4:

   the application of the P1 and SEM1 proteins in improving the yield of plants;

   the application of the P2 and SEM1 proteins in preparing products for improving the yield of plants;

   the application of the P3 and SEM1 proteins in breeding high-yield plants;

   the application of the P4 and SEM1 proteins in preparing high-yield plant products;

   in P1-P4, the SEM1 protein is the protein of A1) or A2) as follows:

   A1) the amino acid sequence is protein of a sequence 2 in a sequence table;

   A2) a fusion protein obtained by attaching a protein tag to the N-terminus or/and the C-terminus of A1);

   the SEM1 protein is derived from rice, and the plant is rice.
2. 2. The use of the SEM1 protein of claim 1 in any one of the following P5-P8:

   the application of the P5 and SEM1 proteins in improving the transportation capacity of plant sucrose;

   the application of the P6 and SEM1 proteins in preparing products for improving the transportation capacity of plant sucrose;

   the application of the P7 and SEM1 proteins in cultivating plants with high sucrose transport capacity;

   the application of the P8 and SEM1 proteins in preparing plant products with high sucrose transport capacity;

   the plant is rice.
3. 3. Use of a biomaterial associated with the SEM1 protein of claim 1 in any one of the following Q1-Q4:

   use of Q1, the SEM1 protein-related biomaterial for increasing plant yield;

   use of Q2, the SEM1 protein-related biomaterial in the manufacture of a product for increasing plant yield;

   use of Q3, the SEM1 protein-related biomaterial in breeding high-yield plants;

   the application of Q4 and the biological material related to the SEM1 protein in the preparation of high-yield plant products;

   the biomaterial is any one of the following B1) to B4):

   B1) a nucleic acid molecule encoding the SEM1 protein of claim 1;

   B2) an expression cassette comprising the nucleic acid molecule of B1);

   B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2);

   B4) a recombinant microorganism containing B1) the nucleic acid molecule, or a recombinant microorganism containing B2) the expression cassette, or a recombinant microorganism containing B3) the recombinant vector;

   the plant is rice.
4. 4. Use of the biomaterial of claim 3 in any one of the following Q5-Q8:

   the application of Q5 and the biological material related to the SEM1 protein in improving the transportation capability of plant sucrose;

   the application of Q6 and the biological material related to the SEM1 protein in preparing products for improving the transportation capacity of plant sucrose;

   the application of Q7 and the biological material related to the SEM1 protein in cultivating plants with high sucrose transport capacity;

   use of Q8, the SEM1 protein-related biomaterial in the preparation of a high sucrose transport capacity plant product;

   the plant is rice.
5. 5. A method for producing a high-yield and/or high-sucrose transport plant, comprising increasing the expression level and/or activity of SEM1 protein as defined in claim 1 in a plant of interest, resulting in a high-yield and/or high-sucrose transport plant; the high-yield and/or high-sucrose transport capacity plant has a yield and/or sucrose transport capacity higher than that of the target plant, and is rice.
6. 6. The method of claim 5, wherein: the increase of the expression level of the SEM1 protein in the target plant is realized by introducing the biological material related to the SEM1 protein in the claim 3 into the target plant; the plant is rice.

Images