CN112724210A - Plant amyloplast development related protein OsSSG7 and coding gene and application thereof - Google Patents

Abstract

The invention discloses a plant amyloplast development related protein OsSSG7, and a coding gene and application thereof. The protein provided by the invention is the protein of the following (a) or (b): (a) a protein consisting of an amino acid sequence shown in SEQ ID No. 1; (b) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of SEQ ID NO.1, is related to the plant amyloplast development and is derived from the SEQ ID NO. 1. The coding gene of the protein is introduced into the plant with abnormal amyloplast development, so that the plant with normal amyloplast development can be cultivated. The protein and the coding gene thereof can be applied to genetic improvement of crops.

Description

Plant amyloplast development related protein OsSSG7 and coding gene and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and relates to a plant amyloplast development related protein OsSSG7, and a coding gene and application thereof.

Background

Rice (Oryza sativa L.) is one of the most important food crops in the world, more than 50% of the world uses rice as the main ration, and starch in rice grains is used as the most main storage substance and accounts for more than 90% of the dry weight of the rice. With the continuous improvement of living standard of people, the cultivation of high-quality, high-nutrition and various functional rice is becoming an urgent problem. However, the appearance quality of rice depends mainly on whether the amyloplast in the starch endosperm develops well and whether the filling is full. Therefore, deep analysis of the development mechanism of the amyloplast has important significance for improving the taste quality and the nutritional quality of the rice.

Plastids originate from the endosymbiosis of blue-green algae, and differentiate into various forms according to functions of different cells in the life cycle of plants, mainly including forms of chloroplasts, amyloplasts and the like. Dividing the starch granules into composite starch granules and single starch granules according to morphological difference, wherein the composite starch granules contain a plurality of starch granules in one amyloplast and are closely arranged; the single-grain starch grain means that only one starch grain is contained in one amyloplast. Wherein the rice endosperm mainly exists in the form of compound starch granules, and one compound starch granule is also a powder-forming body.

Only 2 proteins that directly regulate the size of starch granules are currently identified in rice endosperm, SSG4 and SSG 6. Wherein SSG4 is predicted to code a new protein with unknown function, and the amino terminal of the new protein is provided with a targeting sequence of amyloplast. SSG4 also contains a DUF490 domain of unknown function which is conserved in rice from bacteria to higher plants, and compared with the control Nipponbare, the chalkiness of SSG4 is increased, the seeds become slightly smaller, the starch granules become larger, the starch content of the seeds is reduced, but the structural characteristics of the starch are not obviously changed; in other tissues where starch accumulates, such as pollen grains, root crowns, and young pericarp, the starch grains of ssg4 were all larger than the control; during the trefoil stage, the ssg4 leaf developed a mottled phenotype, mainly due to the altered size of chloroplasts and amyloplasts in the leaf. Recently, SSG4 was hypothesized to be a protein located in the inner membrane of chloroplast in Arabidopsis thaliana homologous gene TIC236, and regulated the progress of translocation of the proprotein to chloroplast by joining the membrane protein translocation complexes located inside and outside the chloroplast. SSG6 predicts that a membrane protein encoding a class I and II domain comprising a aminotransferase, and a transmembrane domain, may have aminotransferase activity. Its mutant phenotype is similar to SSG 4. In summary, the development mechanism of the amyloplast is basically unknown at present, so that the further development of the regulatory gene of the amyloplast development pathway and the analysis of the amyloplast development mechanism can help us to improve the rice quality by means of genetic engineering.

Disclosure of Invention

The invention aims to provide an amyloplast development related protein and a coding gene and application thereof.

The rice amyloplast development related protein OsSSG7 provided by the invention is derived from rice (Oryzasativa var. W017) and is a protein of the following (a) or (b):

(a) a protein consisting of an amino acid sequence shown by SEQ ID NO.1 in a sequence table;

(b) a protein which is derived from the SEQ ID NO.1 and is related to the development of amyloplasts, wherein the protein is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence of the SEQ ID NO. 1.

SEQ ID No.1 of the sequence Listing consists of 275 amino acid residues, and the 22 nd to 41 th transmembrane domains are from the amino terminal.

In order to facilitate purification of the OsSSG7 protein in (a), a tag as shown in Table 1 can be attached to the N-terminus of the amino acid of the protein consisting of the amino acid sequence shown in SEQ ID NO.1 of the sequence Listing.

TABLE 1 sequences of tags

Label (R)	Residue of	Sequence of
			Poly-His	2-10 (generally 6)	HHHHHH
FLAG	8	DYKDDDDK

The OsSSG7 in the above (b) can be artificially synthesized, or can be obtained by synthesizing the coding gene and then performing biological expression. The gene encoding OsSSG7 in (b) above can be obtained by deleting one or several codons of amino acid residues from the DNA sequence shown in SEQ ID NO.2 or SEQ ID NO.3 of the sequence Listing, and/or performing missense mutation of one or several base pairs, and/or connecting the coding sequence of the tag shown in Table 1 above at its 5 'end and/or 3' end.

The gene (OsSSG7) for coding the protein related to amyloplast development also belongs to the protection scope of the invention.

The gene OsSSG7 can be a DNA molecule of the following 1) or 2) or 3) or 4):

1) DNA molecule shown as SEQ ID NO.2 in the sequence table;

2) a DNA molecule shown as SEQ ID NO.3 in the sequence table;

3) a DNA molecule which hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes said protein;

4) DNA molecule which has more than 90% of homology with the DNA sequence limited by 1) or 2) or 3) and codes the protein related to the amyloplast development.

The sequence 2 in the sequence table is composed of 828 nucleotides.

The stringent conditions can be hybridization and membrane washing at 65 ℃ in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS.

The recombinant expression vector containing any one of the genes also belongs to the protection scope of the invention.

The recombinant expression vector containing the gene can be constructed by using the existing plant expression vector.

The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal can direct polyadenylation to the 3 'end of the mRNA precursor, and untranslated regions transcribed from the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (e.g., nopalin synthase Nos), plant genes (e.g., soybean storage protein genes) all have similar functions.

When the gene is used for constructing a recombinant plant expression vector, any enhanced promoter or constitutive promoter can be added in front of transcription initiation nucleotide, such as cauliflower mosaic virus (CAMV)35S promoter and maize Ubiquitin promoter (Ubiquitin), and the enhanced promoter or constitutive promoter can be used independently or combined with other plant promoters; in addition, when the gene of the present invention is used to construct plant expression vectors, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and screening of transgenic plant cells or plants, plant expression vectors to be used may be processed, for example, by adding a gene encoding an enzyme or a luminescent compound which can produce a color change (GUS gene, luciferase gene, etc.), an antibiotic marker having resistance (gentamicin marker, kanamycin marker, etc.), or a chemical-resistant marker gene (e.g., herbicide-resistant gene), etc., which can be expressed in plants. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

The recombinant expression vector may be a recombinant plasmid obtained by recombinantly inserting the gene (OsSSG7) between the multiple cloning sites KpnI and BamHI of pCUBi1390 vector. The recombinant plasmid can be pCUBi1390-OsSSG 7; the pCUBi1390-OsSSG7 was obtained by inserting the OsSSG7 genomic coding sequence between the pCUBi1390 multiple cloning sites KpnI and BamHI by recombinant technology (Clontech, Infusion recombination kit).

pCUBi1390 containing OsSSG7 was designated pCUBi1390-OsSSG 7.

The expression cassette, the transgenic cell line and the recombinant bacterium containing any one of the genes (OsSSG7) belong to the protection scope of the invention.

Primer pairs for amplifying the full length or any fragment of the gene (OsSSG7) also belong to the protection scope of the invention.

It is another object of the present invention to provide a method for producing transgenic plants with normal amyloplasty.

The method for cultivating the transgenic plant with normal amyloplast development provided by the invention is characterized in that the gene is introduced into the plant with the defect of amyloplast development to obtain the transgenic plant with normal amyloplast development; specifically, the gene is introduced into an amyloplast dysplastic plant through the recombinant expression vector; the amyloplast dysplastic plant may be ssg 7.

The protein, the gene, the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant strain or the method can be applied to rice breeding.

Any vector capable of guiding the expression of the exogenous gene in the plant is utilized to introduce the gene for coding the protein into plant cells, so that a transgenic cell line and a transgenic plant can be obtained. The expression vector carrying the gene can transform plant cells or tissues by using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, agrobacterium mediation, etc., and culture the transformed plant tissues into plants. The plant host to be transformed may be either a monocotyledonous or dicotyledonous plant, such as: tobacco, lotus roots, arabidopsis, rice, wheat, corn, cucumber, tomato, poplar, lawn grass, alfalfa and the like.

The invention discovers, positions and clones a new gene OsSSG7 for regulating the protein related to the development of the amyloplasts for the first time. The coding gene of the protein is introduced into the plant with the development defect of the amyloplast, so that the transgenic plant with normal amyloplast development can be obtained. The protein and the coding gene thereof can be applied to the genetic improvement of crops.

Drawings

Fig. 1 is a phenotype plot of the appearance of wild type W017(WT) and mutant ssg7 mature kernels (scale ═ 1 mm).

Fig. 2 is a scanning electron microscope analysis of cross-section starch granules from mature seeds of wild-type W017(WT) and mutant ssg7 (scale 10 um).

FIG. 3 shows the determination of the content of major storage substances of wild type W017(WT) and mutant ssg 7.

FIG. 4 is a graph of amylopectin chain length profiles of wild-type W017 and mutant ssg 7.

Fig. 5 is a graph of kernel phenotype (scale ═ 1mm) of wild type W017(WT) and mutant ssg7 on different days post anthesis (3DAF,6DAF and 9 DAF).

Fig. 6 shows half-thin sections (20 um scale) of endosperm starch granules from wild type W017(WT) and mutant ssg7 on different days after anthesis (3DAF,6DAF and 9 DAF).

Fig. 7 shows transmission electron microscopy observation of wild type W017(WT) and mutant ssg7 post-anthesis 6DAF, amyloplast ultrastructure (scale 20 um).

FIG. 8 is a schematic diagram of the fine localization and gene structure of OsSSG7 gene.

Fig. 9 is a picture of OsSSG7 transgene complementation verification T2 generation purity and pedigree recovery kernel appearance.

FIG. 10 shows that the transgene complementation family amyloplast size was restored to wild type level.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1 discovery of a protein involved in the development of an amyloplast in a plant endosperm and a gene encoding the same

Phenotype and genetic analysis of rice amyloplast developmental defect mutant ssg7

Non-transparent mutants of seeds are screened from a chemical mutation mutant library of MNU (MNU) of japonica rice variety W017, and the mature seeds are observed through semi-thin slices to find that spherical enlarged powder bodies appear in the mutants and are named ssg 7.

FIG. 1 shows W017 mature seed kernel, showing a completely clear endosperm phenotype, and ssg7 mature seed kernel, showing a floury endosperm phenotype.

FIG. 2 is a scanning electron micrograph of W017 and ssg 7. A scanning electron microscope of W017 mature seeds shows that starch particles are arranged tightly and are uniform in size, however, the starch particles in ssg7 are arranged loosely, so that obvious gaps exist among the particles, starch particles are not filled fully, and the appearance of the sbp1 grains presents an opaque phenotype.

By measuring the main storage substances of the mature grain starch, the contents of amylose, fatty acid and total protein in seeds of the ssg7 mutant are not obviously changed compared with the wild type (figure 3), the total starch content is not obviously changed by measuring the total starch content, and the chain length distribution of amylopectin is further analyzed to show that the short chain with the polymerization degree of 6-8 is increased and the medium chain with the polymerization degree of 10-20 is reduced (figure 4). In conclusion, we found that the mutation of the OsSSG7 gene does not affect the biosynthesis of starch and the accumulation of dry matter.

We observed that there was no significant difference between wild type W017(WT) and mutant at different development stages (FIG. 5), and that the semi-thin section I₂KI staining to observe the morphology of the W017 and ssg7 complex starch granules at different days after the flower. In wild type W017 starch endosperm cells, a plurality of independent starch granules are generated inside each amyloplast, which is a typical composite starch granule structure of rice, and the starch granules are closely arranged (figure 6). However, in mutant ssg7, we found that spherical amyloplasts appeared in the starch endosperm cells at the beginning of starch filling at 3 days, and the spherical amyloplasts continued to grow as the grouting proceeded (fig. 6), we further observed the ultrastructure of the amyloplasts using transmission electron microscopy, and found that the ultrastructure of the amyloplasts did not change significantly between wild type and mutant, and the mutant amyloplasts grew dramatically (fig. 7), consistent with our observation under optical microscope. In conclusion, the SSG7 protein does not influence the biosynthesis of starch and is a novel gene for regulating the development of amyloplasts.

Second, mutant Gene mapping

1. Preliminary mapping of mutant genes

Firstly, positive and negative crossing of wild W017 and mutant ssg7 is constructed, and the obtained seeds of a normal type and a mutant type in the progeny after F1 selfing meet the separation ratio of 3:1, so that the phenotype of amyloplast dysplasia in ssg7 is controlled by a single recessive nuclear gene.

Mutant ssg7 and N22 are hybridized to construct a positioning population, extreme individuals with grain floury (the floury and powder-making body are changed into large phenotypes and are closely linked) similar to the mutant phenotype are randomly selected from an F2 separation population constructed by ssg7 and N22 to sprout, and seedling DNA of 1 week old is extracted. First, polymorphism analysis was performed between W017 and N22 using more than 600 pairs of SSR and Indel primers covering the entire genome of rice, and then a pair of markers polymorphic between the two parents was selected at each physical distance of 3M. The selected primers covering 12 chromosomes and having polymorphism are used for analysis, and finally, the amyloplast development key gene OsSSG7 is positioned in the range of 5M interval between No. 11 chromosome markers RM287 and RM 206.

The method for SSR/Indel marker analysis is as follows:

(1) the total DNA of the selected individual plant is extracted as a template, and the specific method is as follows:

firstly, taking about 0.2g of young and tender rice leaves, placing the young and tender rice leaves in an Eppendorf tube, placing a steel ball in the tube, freezing the Eppendorf tube filled with a sample in liquid nitrogen for 5min, and placing the tube on a 2000 model GENO/GRINDER instrument to crush the sample for 1 min.

② 660 mul of extract (solution containing 100mM Tris-HCl (pH 8.0), 20mM EDTA (pH 8.0), 1.4M NaCl,0.2g/ml CTAB) is added, mixed by intense vortex on a vortex machine, bathed in water at 65 ℃ for 30min, and shaken every 10 min.

③ adding 40 mu L of 20 percent SDS, carrying out warm bath at 65 ℃ for 10min, and slightly reversing and mixing the mixture up and down every two minutes.

Fourthly, 100 mu L of 5M NaCl is added and mixed gently.

Fifthly, 100 mu L of 10 xCTAB is added, the mixture is bathed for 10min at 65 ℃, and the mixture is mixed by intermittently and slightly reversing the upside down.

Sixthly, adding 900 mu L of chloroform, fully and uniformly mixing, and centrifuging at 12000rpm for 3 min.

Seventhly, transferring the supernatant to a 1.5mL Eppendorf tube, adding 600 mu L of isopropanol, uniformly mixing, and centrifuging at 12000rpm for 5 min.

Eighthly, discarding the supernatant, rinsing the precipitate once by using 70 percent (volume percentage) of ethanol, and drying at room temperature.

Ninthly, adding 100. mu.L of 1 XTE (a solution obtained by dissolving 121 g of Tris in 1 liter of water and adjusting pH to 8.0 with hydrochloric acid) to dissolve the DNA.

And (c) taking 2 mu L of red (R) to carry out electrophoresis to detect the quality of DNA, and measuring the concentration by using a DU800 spectrophotometer (BechmanInstrument Inc.U.S.A).

(2) Diluting the extracted DNA to about 20 ng/. mu.L, and performing PCR amplification as a template;

PCR reaction (10. mu.L): 1. mu.L of DNA (20 ng/. mu.L), 1. mu.L of upstream primer (2 pmol/. mu.L), 1. mu.L of downstream primer (2 pmol/. mu.L), 10xBuffer (MgCl)₂free)1μL，dNTP(10mM)0.2μL，MgCl₂(25mM)0.6μL，rTaq(5u/μL)0.1μL，ddH₂O5.1. mu.L, 10. mu.L total.

PCR reaction procedure: denaturation at 94.0 deg.C for 5 min; denaturation at 94.0 deg.C for 30s, annealing at 55 deg.C for 30s, and extension at 72 deg.C for 1min, and circulating for 35 times; extending for 7min at 72 ℃; storing at 10 deg.C. The PCR reaction was performed in an MJ Research PTC-225 thermal cycler.

(3) SSR-tagged PCR product detection

The amplification products were analyzed by 8% native polyacrylamide gel electrophoresis. The molecular weight of the amplified product is compared by taking 50bp DNA Ladder as a control, and silver staining is performed for color development.

2. Fine localization of mutant genes

According to the result of primary positioning, a new molecular marker is developed in the interval of primary linkage 5M, and the molecular marker with polymorphism between W017 and N22 is further screened for fine positioning. F obtained from a W017/N22 hybridization combination₂Sorting out F identified as mutant phenotype in segregating populations₂Seeds for fine localization of the mutation sites. The method comprises the following steps of finely positioning the mutation sites by using molecular markers on a public map and self-developed SSR and Indel molecular markers based on rice genome sequence data, and preliminarily determining the mutation sites according to the positioning result, wherein the specific method comprises the following steps:

(1) SSR marker development

Integrating SSR markers of a public map with a rice genome sequence, and downloading BAC/PAC clone sequences near mutation sites. Searching potential SSR sequences (the repetition times are more than or equal to 6) in the clone by SSR Hunter (Liqiang et al, heredity, 2005, 27(5): 808-; comparing the SSRs and sequences adjacent to 400-500 bp thereof with corresponding indica rice sequences on line at NCBI through a BLAST program, and preliminarily deducing that the PCR product of the SSR primer has polymorphism between indica rice and japonica rice if the SSR repetition times of the SSRs and the sequences are different; then, the SSR primers are designed by using Primer Premier 5.0 software and synthesized by Shanghai Invitrogen/Nanjing Kingsrei Biotech Co. The self-designed SSR paired primers are mixed in equal proportion, the polymorphism between W017 and N22 is detected, and a marker with polymorphism between two parents is selected to be used as a molecular marker for finely positioning the OsSSG7 gene. The molecular markers used for fine localization are shown in table 2.

TABLE 2 molecular markers for fine mapping of OsSSG7 genes

RM287	TTCCCTGTTAAGAGAGAAATC	GTGTATTTGGTGAAAGCAAC
			Hiri5	GTTTGTCTTGCTAGTTGT	ATCGGAGAAGTATTTTAG
R48	GCCTTCATCCGTAAATCCATAA	GAGTACCACATGGCATTATGAGAG
			RM26813	ACTAGTGGCCACCCACTCTATG	GCACGTATATGTGAGAATAGGCTTG
I11-8	ACGGCTAAACGGTACTGCAT	ACACCAAGGGTGAAAAGTGG
			RM229	CACTCACACGAACGACTGAC	CGCAGGTTCTTGTGAAATGT
Yhg-5	AGAGCCAACCCCCTTAATT	TCTGATCTGAGGTGGCGA
			Yhg-6	ATGACGAAAAGTCCAAAACC	TGAAAATTCCAATTCCCACT
YD10	TATGGCATTGCTACGACAA	TATCAGGAGCGACGGGAG
			RM21	ACAGTATTCCGTAGGCACGG	GCTCCATGAGGGTGGTAGAG
RM206	CCCATGCGTTTAACTATTCT	CGTTCCATCGATCCGTATGG

By means of encrypted markers, we finally pinpoint the OsSSG7 gene between two markers RM229 and Yhg-5, the physical distance is about 153kb, and the interval is predicted by websites to contain 8 ORFs (FIG. 8A).

(2) Obtaining of mutant Gene

Sequencing 8 candidate genes in the 153kb interval revealed that a G to A single base mutation in the seventh intron of the OsSSG7 gene resulted in premature termination of translation and translation (FIG. 8B).

Primers were designed based on the mapped sites and the sequences were as follows:

primer1：5'-GGCTATGCTCTCTGGGC-3'(SEQ ID NO.4)

primer2：5'-GGCAGGCTTGAACTCGT-3'(SEQ ID NO.5)

the target gene SSG7 was obtained by PCR amplification using primer1 and primer2 as primers and cDNA of W017 as a template.

The amplification reaction was performed on a PTC-200(MJ Research Inc.) PCR instrument: 3min at 94 ℃; 30sec at 94 ℃, 45sec at 60 ℃, 2min at 72 ℃ and 35 cycles; 5min at 72 ℃. The PCR product was recovered and purified, cloned into a vector pEASY (Beijing Quanji Co., Ltd.), transformed into E.coli DH 5. alpha. competent cells (Beijing Tiangen Co., Ltd., CB101), and positive clones were selected and sequenced. The sequencing result shows that the fragment obtained by PCR reaction has the nucleotide sequence shown as SEQ ID NO.2 in the sequence table and encodes a protein (from ATG to TGA) consisting of 275 amino acid residues (see SEQ ID NO.1 in the sequence table). The protein shown in SEQ ID No.1 is named as OsSSG7 (namely the OsSSG7 gene in the gene mapping), and the coding gene of the protein shown in SEQ ID No.1 is named as OsSSG 7.

Example 2 obtaining and identifying transgenic plants

Construction of recombinant expression vector

Taking cDNA of W017 as a template, carrying out PCR amplification to obtain a coding sequence of the OsSSG7 gene, wherein the sequence of a PCR primer is as follows:

primer3：5'ATGGGCTCCGGCGAGGACAC3'(SEQ ID NO.6)

primer4：5'CTACTGATCATCGATTGCGA 3'(SEQ ID NO.7)

the primers are respectively positioned from the beginning of ATG to the end of TGA of the gene shown in SEQ ID NO.2, the amplification product comprises the whole coding region part of the gene, and the PCR product is recovered and purified. The PCR product was cloned into vector pCUBi1390 using the Infusion recombination kit (Clontech) to construct a pCUBi1390-OsSSG7 recombination reaction system (10.0. mu.L): PCR product 5.4. mu.L (50-100ng), pCUBi1390 vector 1.6. mu.L (30-50ng), 5. mu.L of Infusion buffer, and 1. mu.L of Infusion enzyme mix. After brief centrifugation, the mixed system was subjected to water bath at 37 ℃ for 0.5 hour or more, and 2.5. mu.L of the reaction system was used to transform E.coli DH 5. alpha. competent cells (Beijing Tiangen Co.; CB101) by heat shock method. All the transformed cells were spread evenly on LB solid medium containing 50mg/L kanamycin.

After culturing at 37 ℃ for 16h, clone-positive clones were picked and sequenced. As a result of sequencing, a recombinant expression vector containing the gene shown in SEQ ID NO.3 was obtained, pCUBi1390 containing OsSSG7 was designated pCUBi1390-OsSSG7, and the OsSSG7 gene was inserted between the multiple cloning sites KpnI and BamHI.

Fourth, identification of transgenic plants

1. Identification of hygromycin resistance

In this study, a hygromycin solution of 1% concentration was used to identify transgenic plants. The specific method comprises the following steps: fresh transgenic plant leaves (without the transgenic plant leaves as negative control) are placed in a culture dish, soaked in a new hygromycin solution of 1 per thousand, placed in an incubator at 28 ℃ for dark culture for 48 hours, compared with the control, the leaf necrosis is indicated to be non-resistant, the non-necrotic leaf necrosis is indicated to be resistant, and three families of hygromycin resistance are named as 1390#1, 1390#3 and 1390# 3.

2. Phenotypic identification

Transgenic plants of T0 generation pCUBi1390-OsSSG7, wild type W017 and mutant ssg7 are planted in the field of the soil bridge experimental base of Nanjing agriculture university. 3 independent transgenic lines were identified to have grain restored to the wild type clear phenotype (FIG. 9), and further by half-thin sectioning it was found that the amyloplast-enlarged abnormal phenotype was also restored in the transgenic lines (FIG. 10). In conclusion, the verification of map-based cloning and transgene complementation shows that the powdery phenotype of the amyloplast defect is controlled by the OsSSG7 gene, namely the OsSSG7 gene is a key gene for the amyloplast development.

Sequence listing

<110> Nanjing university of agriculture

<120> plant amyloplast development related protein OsSSG7, and coding gene and application thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 618

<212> PRT

<213> Oryza sativa rice (Oryza sativa var. W017)

<400> 1

Met Ala Ser Pro Thr His Ala Ala Tyr Leu Ala Pro Thr Ala Pro Pro

1 5 10 15

Arg His Leu His Leu Leu Leu Arg Leu Arg Leu Arg Gly Arg Pro Ala

20 25 30

Val Ser Thr Cys Val Arg Ala Thr Ala Arg Gly Gly Asp Gly Gly Ser

35 40 45

Ser Tyr Leu Asp Met Trp Lys Lys Ala Val Glu Arg Glu Arg Arg Ser

50 55 60

Ala Glu Ile Ala His Arg Leu Gln Gln Ser Ser Ser Ala Ala Ala Ala

65 70 75 80

Ala Val Lys Glu Glu Glu Gly Glu Gly Lys Ala Ala Ala Ala Ala Gly

85 90 95

Asp Val Glu Arg Arg Thr Ala Arg Phe Glu Glu Met Leu Arg Val Pro

100 105 110

Arg Glu Glu Arg Asp Arg Val Gln Arg Arg Gln Val Ile Asp Arg Ala

115 120 125

Ala Ala Ala Leu Ala Ala Ala Arg Ala Val Leu Lys Asp Pro Pro Pro

130 135 140

Pro Pro Pro Pro Ser Pro Pro Ser Thr Pro Pro Gln Glu Arg Glu Gln

145 150 155 160

Gln Gln Lys Pro Ala Ala Thr Ala Ile Gln Ala Gly Ser Glu Ser Gly

165 170 175

Leu Val Ser Arg Thr Ala Pro Gly Glu Ser Asp Arg Ala Ser Pro Pro

180 185 190

Pro Pro Val Thr Glu Thr Ala Thr Glu Ala Ala Lys Val Ser Val Pro

195 200 205

Asp Ser Gly Asp Ser Ser Pro Phe Lys Lys Ser Ser Ser Lys Leu Gly

210 215 220

Thr Pro Gly Pro Asp Phe Trp Ser Trp Leu Pro Pro Val Glu Asn Ser

225 230 235 240

Thr Lys Leu Gly Glu Ile Asp Thr Gly Leu Lys Pro Ser Glu Lys Leu

245 250 255

Asp Ser Phe Ala Gly Gln Pro Asp Leu Leu Met Glu Lys Glu Gln Ser

260 265 270

Glu Asp Ile Leu Ser Leu Pro Phe Glu Thr Ser Phe Phe Lys Lys Glu

275 280 285

Asp Arg Ser Leu Pro Pro Phe Gln Ser Phe Ala Glu Pro Glu Asn Val

290 295 300

Glu Ser Glu Pro Ser Ile Thr Ala Asp Ala Glu Glu Thr Phe Glu Asp

305 310 315 320

Gln Phe Ser Lys Asn Ala Ala Glu Ala Ala Arg Ala Leu Ser Ala Ser

325 330 335

Asp Glu Lys Ser Ser His Gly Val Arg Pro Asp Gly Ser Leu Trp Trp

340 345 350

Lys Glu Thr Gly Val Glu Gln Arg Pro Asp Gly Val Thr Cys Lys Trp

355 360 365

Thr Val Ile Arg Gly Val Ser Ala Asp Gly Ala Val Glu Trp Glu Asp

370 375 380

Lys Tyr Trp Glu Ala Ser Asp Arg Phe Asp His Lys Glu Leu Gly Ser

385 390 395 400

Glu Lys Ser Gly Arg Asp Ala Thr Gly Asn Val Trp Arg Glu Tyr Trp

405 410 415

Lys Glu Ser Met Trp Gln Asp Phe Thr Cys Gly Val Met His Met Glu

420 425 430

Lys Thr Ala Asp Lys Trp Gly Gln Asn Gly Lys Gly Glu Gln Trp Gln

435 440 445

Glu Gln Trp Trp Glu His Tyr Asp Ser Ser Gly Lys Ala Glu Lys Trp

450 455 460

Ala Asp Lys Trp Cys Ser Leu Asp Pro Asn Thr Pro Leu Asp Val Gly

465 470 475 480

His Ala His Val Trp His Glu Arg Trp Gly Glu Lys Tyr Asp Gly Cys

485 490 495

Gly Gly Ser Ala Lys Tyr Thr Asp Lys Trp Ala Glu Arg Ser Glu Gly

500 505 510

Asp Gly Trp Ser Lys Trp Gly Asp Lys Trp Asp Glu His Phe Asp Pro

515 520 525

Asn Gly His Gly Val Lys Gln Gly Glu Thr Trp Trp Ala Gly Lys Tyr

530 535 540

Gly Asp Arg Trp Asn Arg Thr Trp Gly Glu His His Asn Cys Thr Gly

545 550 555 560

Trp Val His Lys Tyr Gly Arg Ser Ser Ser Gly Glu His Trp Asp Thr

565 570 575

His Val Pro Gln Asp Thr Trp Tyr Glu Arg Phe Pro His Phe Gly Phe

580 585 590

Glu His Cys Phe Asn Asn Ser Val Gln Leu Arg Ser Val Lys Arg Gln

595 600 605

Thr Pro Lys Asn Thr Lys Pro Glu Lys Asp

610 615

<210> 2

<211> 2125

<212> DNA

<213> Oryza sativa rice (Oryza sativa var. W017)

<400> 2

ctccactccc tccccccaac actcgcctcc actccacctc gaaacccaca aaaatggcgt 60

cgcccaccca cgccgcctac ctcgccccca ccgcccctcc ccgccatctc cacctcctcc 120

tccgcctccg cctccgcggc cgccccgccg tctcaacctg cgtccgcgcc accgcccgcg 180

ggggggatgg cgggtcgtcg tacctggaca tgtggaagaa ggccgtggag agggagcgcc 240

gctcggcgga gatcgcgcac cgcctccagc aatcctcctc cgccgccgcc gccgccgtga 300

aggaggagga gggagagggg aaggctgcgg cggcggcggg ggacgtggag aggaggacgg 360

cgcggttcga ggagatgctg cgggtgccgc gcgaggagcg ggaccgcgtc cagcggcggc 420

aggtcatcga ccgcgccgcc gcggcgctgg cggcggcgcg cgccgtgctc aaggacccgc 480

cgcccccgcc tcccccgtcc ccgccttcca cgccgccgca ggagcgggaa cagcagcaga 540

agccggcggc gaccgcgatc caggccggat cagagagtgg cctggtttcc cgtacggctc 600

cgggggagtc ggatcgggca tccccgccgc cgccggtgac ggagacggcg accgaggcgg 660

cgaaagtttc agtgccggac tctggtgatt catctccttt caagaagtca agttccaagc 720

tcggtactcc aggcccggac ttctggtcgt ggttaccacc tgtggaaaat agcactaaac 780

taggagaaat cgacactggg ttaaaaccat ctgagaaatt agactccttc gccggtcagc 840

ctgatctgct gatggaaaag gaacagtcag aagacatttt atcgctcccg ttcgaaacct 900

ctttcttcaa gaaggaagac cgatctcttc ctcccttcca gtcgtttgct gagcctgaaa 960

atgtggaatc cgagcccagt attactgctg atgcagagga gacattcgaa gatcagtttt 1020

cgaaaaacgc agctgaggca gctagagctc ttagtgcaag cgacgagaag tcatcacatg 1080

gggtgcgtcc agatggttca ttgtggtgga aggagacagg tgtagaacaa aggcctgatg 1140

gtgtaacttg caagtggacc gtgattaggg gagttagtgc tgatggagct gttgaatggg 1200

aggacaagta ttgggaggct tcagaccggt ttgatcacaa agagctaggt tctgagaagt 1260

ctggtcgtga tgctacaggg aatgtttggc gggaatactg gaaagagtct atgtggcagg 1320

atttcacatg tggtgttatg cacatggaga agacggcaga caagtgggga cagaatggta 1380

aaggggagca gtggcaagag cagtggtggg agcattacga ttcaagcggt aaagctgaga 1440

aatgggctga taaatggtgc agcttggatc caaatacacc actagatgtt ggtcacgctc 1500

atgtttggca tgaaaggtgg ggcgagaagt atgatggctg cggaggtagt gcaaaataca 1560

ctgacaaatg ggctgaacga tcagagggtg acgggtggtc aaagtggggc gataagtggg 1620

atgagcattt cgacccgaat ggccatggag tgaagcaagg ggagacctgg tgggcaggca 1680

agtacgggga tcgctggaat cgcacctggg gcgagcatca caactgtact ggttgggtgc 1740

acaagtatgg caggagcagc agcggtgagc actgggacac acacgttccc caggacacct 1800

ggtatgagcg ttttccgcac tttggcttcg agcactgctt caacaactcg gtgcagctcc 1860

ggtctgtgaa gaggcagact ccaaaaaaca ctaagcctga aaaagattag atatttagaa 1920

tagaatctac tcaattgcta tcataaaaaa tagttggcta catggccatc tttcattttt 1980

gatcttgctg aagagcccat gcttgtaaaa taagattgaa tggctgattt cagttgtccg 2040

gttttatgcc aatacctgta ccgagctatg ttatcaaaag ttcatatgct actatgcaat 2100

agaaaggttc cttcttttag tttca 2125

<210> 3

<211> 3420

<212> DNA

<213> Oryza sativa rice (Oryza sativa var. W017)

<400> 3

actcgcctcc actccacctc gaaacccaca aaaatggcgt cgcccaccca cgccgcctac 60

ctcgccccca ccgcccctcc ccgccatctc cacctcctcc tccgcctccg cctccgcggc 120

cgccccgccg tctcaacctg cgtccgcgcc accgcccgcg ggggggatgg cgggtcgtcg 180

tacctggaca tgtggaagaa ggccgtggag agggagcgcc gctcggcgga gatcgcgcac 240

cgcctccagc aatcctcctc cgccgccgcc gccgccgtga aggaggagga gggagagggg 300

aaggctgcgg cggcggcggg ggacgtggag aggaggacgg cgcggttcga ggagatgctg 360

cgggtgccgc gcgaggagcg ggaccgcgtc cagcggcggc aggtcatcga ccgcgccgcc 420

gcggcgctgg cggcggcgcg cgccgtgctc aaggacccgc cgcccccgcc tcccccgtcc 480

ccgccttcca cgccgccgca ggagcgggaa cagcagcaga agccggcggc gaccgcgatc 540

caggccggat cagagagtgg cctggtttcc cgtacggctc cgggggagtc ggatcgggca 600

tccccgccgc cgccggtgac ggagacggcg accgaggcgg cgaaaggtat ggggtgattg 660

gtgcacgtga ggttgcttaa agatcacaag tactctttct tgtgaacgca ttatcttttc 720

gatttctttt ttactagctt tttgaccgtg gctaacatga taattgagct aaaaaggaca 780

actccttttt aatctgacag aatgtatgaa actaacaatc caaccataaa tcccttcctg 840

aggaatagtt gaaaaactgg gaatctattt ttaatctttt ttatgtgtat aatagaagtg 900

tttgatttat gtcaacaaaa aaaagtgttt gattcgattg ataggtgaat ggatttaggg 960

aacttgttag atatttatgg aaaattttga ttgtgtgcac tgccattttt gtctcgccat 1020

tggcaataga aattgtagct gtgcagataa cacacaggtg cctgcagtat tggcatcttg 1080

ttttgttatc catgcatatt tcttcattta tctgggtatc aaacatgaat ttattgtcga 1140

agtgcgatgc tgattccacc aaatgactta ctcccgctgt ccaataaatg tagctaaaag 1200

tagcataaat gcaccaaaat aacacctgta gacattaagc atatagaaaa aaaattatca 1260

gcatttctat tagttgcaag ttgcatctgc attttttttt cagacataca tgtattctta 1320

tgcgggatac acaattaact gcagtatttt agttagtaag gtattgtaaa accatgctgt 1380

tcttaatctg caatctgaca ttagcaatca gtttcagtgc cggactctgg tgattcatct 1440

cctttcaaga agtcaagttc caagctcggt actccaggcc cggacttctg gtcgtggtta 1500

ccacctgtgg aaaatagcac taaactagga gaaatcgaca ctgggttaaa accatctgag 1560

aaattagact ccttcgccgg tcagcctgat ctgctgatgg aaaaggaaca gtcagaagac 1620

attttatcgc tcccgttcga aacctctttc ttcaagaagg aagaccgatc tcttcctccc 1680

ttccagtcgt ttgctgagcc tgaaaatgtg gaatccgagc ccagtattac tgctgatgca 1740

gaggagacat tcgaagatca gttttcgaaa aacgcagctg aggcagctag agctcttagt 1800

gcaagcgacg agaagtcatc acatggggtg cgtccagatg gttcattgtg gtggaaggag 1860

acaggtgtag aacaaaggcc tgatggtgta acttgcaagt ggaccgtgat taggggagtt 1920

agtgctgatg gagctgttga atgggaggac aagtattggg aggcttcaga ccggtttgat 1980

cacaaagagc taggttctga gaagtctggt cgtgatgcta cagggaatgt ttggcgggaa 2040

tactggaaag agtctatgtg gcaggtaaat tgctgtctca tttggtacaa tacaaccatt 2100

tgttccttgt tcatgaaacc tacaggttac aatgttacat cataagcatt aaattatggc 2160

tattgtttct attgaaataa gattatctgg cttgagtgat gcagtcatgt gtagagagat 2220

gtgtctcact gtcatgcgtt gatttactga agtatttctg ttccgacaat actgatttac 2280

taaacttcag atgtaatatg atttgtactg aatgatcgcc ccattactcg ttagaacata 2340

actgagtact gcattttttt tttaatattt gcaggatttc acatgtggtg ttatgcacat 2400

ggagaagacg gcagacaagt ggggacagaa tggtaaaggg gagcagtggc aagagcagtg 2460

gtgggagcat tacgattcaa gcggtaaagc tgagaaatgg gctgataaat ggtgcagctt 2520

ggatccaaat acaccactag atgttggtca cgctcatgtt tggcatgaaa ggtaagagct 2580

gctaaaatag cttctttcag aatgctttct gtccgtactc ttatcttgct tttgtccgta 2640

gtcatatcac attcaagaac caacatttcc tcttgttaaa agaaatgaaa agagcaaata 2700

tttcagcaat cagattgttt gcaacataca tcatttatgc tagtactgtt gtaacatacg 2760

acagcttagt catatcaatc aactcaatac atttctggct catcctctac aggtggggcg 2820

agaagtatga tggctgcgga ggtagtgcaa aatacactga caaatgggct gaacgatcag 2880

agggtgacgg gtggtcaaag tggggcgata agtgggatga gcatttcgac ccgaatggcc 2940

atggagtgaa gcaaggggag acctggtggg caggcaagta cggggatcgc tggaatcgca 3000

cctggggcga gcatcacaac tgtactggtt gggtgcacaa gtatggcagg agcagcagcg 3060

gtgagcactg ggacacacac gttccccagg acacctggta tgagcgtttt ccgcactttg 3120

gcttcgagca ctgcttcaac aactcggtgc agctccggtc tgtgaagagg cagactccaa 3180

aaaacactaa gcctgaaaaa gattagatat ttagaataga atctactcaa ttgctatcat 3240

aaaaaatagt tggctacatg gccatctttc atttttgatc ttgctgaaga gcccatgctt 3300

gtaaaataag attgaatggc tgatttcagt tgtccggttt tatgccaata cctgtaccga 3360

gctatgttat caaaagttca tatgctacta tgcaatagaa aggttccttc ttttagtttc 3420

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

actcgcctcc actccacctc ga 22

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaaactaaaa gaaggaacct t 21

Claims (10)

1. A protein SSG7 for regulating development of amyloplasts, characterized by being selected from any one of the following proteins as shown in (a) or (b):

(a) a protein consisting of an amino acid sequence shown in SEQ ID No. 1;

(b) a protein which is derived from the sequence 1 and is related to the development of amyloplasts by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence of SEQ ID NO. 1.

2. A gene OsSSG7 encoding the protein of claim 1.

3. The gene OsSSG7 according to claim 2, wherein: the gene is the DNA molecule described in the following 1) or 2) or 3) or 4):

1) DNA molecule shown in SEQ ID NO. 2;

2) a DNA molecule shown as SEQ ID NO. 3;

3) a DNA molecule which hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and codes for the protein OsSSG 7;

4) DNA molecule which has more than 90% of homology with the DNA sequence limited by 1) or 2) or 3) and codes the plant amyloplast development related protein.

4. A recombinant expression vector, expression cassette, transgenic cell line or recombinant bacterium comprising the gene of claim 2 or 3.

5. The recombinant expression vector of claim 4, wherein: the recombinant expression vector is a recombinant plasmid obtained by inserting the gene of claim 2 or 3 between the multiple cloning sites KpnI and BamHI of pCUBi1390 vector.

6. A primer set for amplifying the full length of the gene of claim 2 or 3 or any fragment thereof.

7. Use of at least one of the protein of claim 1, the gene of claim 2 or 3, the recombinant expression vector of claim 4, an expression cassette, a transgenic cell line or a recombinant bacterium in plant breeding.

8. The use of claim 7, wherein the use of at least one of the protein of claim 1, the gene of claim 2 or 3, and the recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria of claim 4 in the cultivation of transgenic plants with normal amyloplast development.

9. A method for breeding transgenic plants with normal amyloplast development, which comprises introducing the gene of claim 2 or 3 into plants with abnormal amyloplast development to obtain transgenic plants with normal amyloplast development; the plant with abnormal amyloplast development is a plant with powdery endosperm; the transgenic plant with normal development of the amyloplast is a transgenic plant with transparent and normal endosperm appearance.

10. The method of claim 9, wherein: the gene of claim 2 or 3 is introduced into a plant with amyloplast dysplasia by the recombinant expression vector of claim 4 or 5.

Images