CN106432447A - Plant starch synthesis-related protein OsPKp1 as well as encoding gene and application thereof - Google Patents

Abstract

The invention belongs to the field of genetic engineering and relates to a plant starch synthesis-related protein OsPKp1 as well as an encoding gene and an application thereof. The protein is shown in the following (a) or (b): (a) a protein formed by an amino acid sequence as shown in SEQ ID NO. 1 in a sequence table; (b) a protein derived from SEQ ID NO. 1, associated with plant gluten sorting and obtained after substitution and/or deletion and/or addition of one or several amino acid residues are performed on the amino acid sequence as shown in SEQ ID NO. 1. The plant starch synthesis-related protein has an influence on synthesis of starch in plant endosperm. A starch normally synthesized transgenic plant can be cultivated by transferring the encoding gene of the protein into a starch abnormally synthesized plant. The protein and the encoding gene of the protein can be applied to plant genetic improvement.

Description

A kind of plant amylum synthesis associated protein OsPKp1 and its encoding gene and application

Technical field

The invention belongs to genetic engineering field, it is related to a kind of plant amylum synthesis associated protein OsPKp1 and its encoding gene With application.

Background technology

In plant, starch is main ergastic substances, and the many synzyme in its route of synthesis and regulatory factor are all Through being identified well and being studied.Starch is the topmost constituent of Rice Kernel, and its content and characteristic directly affect rice Every index of quality and final palatability, simultaneously the accumulating level of starch can also affect on the yield of paddy rice, therefore, deeply grind Study carefully the key factor in this unifacial leaf model plant Starch synthesis approach of paddy rice and regulated and control network has important theory significance With using value.

The water-insoluble starch of paddy endosperm is mainly made up of amylose and amylopectin.Amylopectin accounts for more than 75%, , by α -1 of branch, 6 glucosides are bonded, and it is bonded to account for the linear α of a small amount of amylose-Isosorbide-5-Nitrae glucosides for it.A large amount of in plant The key enzyme participating in Starch synthesis is studied.Amylose by granule bound starch synthase (IGBSSI) synthesize, it by Waxy gene code.The synthesis of amylopectin is by starch synthase (SSs), Q-enzyrne (BEs) and starch debranching enzyme (DBEs).SSs in plant, there are multiple isomers SSI-IV, BEI-II, DBE1-3 and DBE in BEs, DBEs.In paddy rice these The mutation of gene, can be all endosperm starch performance off-note.BEIIb mutation performance core white endosperm, amylopectin structure, starch The Effect On Gelatinization Characteristics of particle all change.ALK encodes a gene being predicted as soluble starch synthase IIa, SSIIa key amino The change of acid leads to long-grained nonglutinous rice and the difference of japonica rice amylopectin structure and starch property.

In addition to synzyme, in paddy rice, some other factors participate in the synthesis of starch indirectly.Participate in egg in endoplasmic reticulum Ripe class disulfide bond isomerase (PDIL-1) gene function loses the same synthesis affecting starch in vain, and mutant shows silty embryo Breast and starch granules diminish.MADS29 is the member of paddy rice MADS-BOX family, participates in explanation megarchidium and nucellar projection.Suppression The expression of MADS29 reduces the synthesis of starch and forms abnormal endosperm.Consequently found that and cloning Starch synthesis and regulation and control dependency basis Cause, it will help we are improved to rice by engineered means.

Content of the invention

It is an object of the invention to provide a kind of Starch synthesis GAP-associated protein GAP and its encoding gene and application.

The Starch synthesis GAP-associated protein GAP (OsPKp1) that the present invention provides, from Oryza paddy rice (Oryza sativa var. More light (Koshihikari)), it is the protein of following (a) or (b)：

A protein that () is made up of the amino acid sequence shown in SEQ ID NO.1 in sequence table；

B amino acid sequence shown in SEQ ID NO.1 through the replacement of one or several amino acid residues and/or is lacked by () Lose and/or add and by SEQ ID NO.2 derived from the protein related to Starch synthesis.

SEQ ID NO.1 in sequence table is made up of 578 amino acid residues.

In order that the OsPKp1 in (a) is easy to the subcellular location purifying and studying in rice cell, can be by sequence table The amino terminal of protein of amino acid sequence composition shown in middle SEQ ID NO.1 or carboxyl terminal connect upper such as SEQ ID MBP label shown in NO.8 or the GFP label shown in SEQ ID NO.9.

OsPKp1 in above-mentioned (b) can be artificial synthesized, also can first synthesize its encoding gene, then carry out biological expression and obtain. The encoding gene of the OsPKp1 in above-mentioned (b) can be by lacking one in the DNA sequence dna shown in SEQ ID NO.2 in sequence table Or the codon of several amino acid residue, and/or carry out the missense mutation of one or several base-pairs, and/or its 5 ' end and/ Or 3 ' end connect the coded sequence of the label shown in table 1 and obtain.

The gene (OsPKp1) encoding above-mentioned Starch synthesis GAP-associated protein GAP falls within protection scope of the present invention.

Described gene OSFSE can be following 1) or 2) or 3) or 4) DNA molecular：

1) DNA molecular shown in SEQ ID NO.2 in sequence table；

2) DNA molecular shown in SEQ ID NO.3 in sequence table；

3) under strict conditions with 1) or 2) DNA molecular of the DNA sequence dna hybridization that limits and encoding said proteins；

4) with 1) or 2) or 3) DNA sequence dna that limits has more than 90% homology, and encoding regulator Starch synthesis are related The DNA molecular of albumen.

Described stringent condition can be at 0.1 × SSPE (or 0.1 × SSC), in the solution of 0.1%SDS, hybridizes at 65 DEG C And wash film.

SEQ ID NO.2 is made up of 1737 nucleotides, is the CDS of OsPKp1.

SEQ ID NO.3 is made up of 4639 nucleotides, is the DNA sequence dna of OsPKp1.

Recombinant expression carrier containing gene described in any of the above falls within protection scope of the present invention.

Can use the recombinant expression carrier that existing plant expression vector construction contains described gene.

Described plant expression vector includes double base agrobacterium vector and can be used for carrier of plant micropellet bombardment etc..Described plant Thing expression vector also can comprise 3 ' end untranslated regions of foreign gene, that is, comprise polyadenylation signals and any other participation MRNA processing or the DNA fragmentation of gene expression.The bootable polyadenylic acid of described polyadenylation signals is added to the 3 ' of mRNA precursor End, such as Agrobacterium crown gall nodule induction (Ti) plasmid gene (as kermes synzyme Nos gene), plant gene are (as soybean storage egg White gene) non-translational region of 3 ' end transcriptions is respectively provided with similar functions.

During using described gene constructed recombinant plant expression vector, can be plus any one before its transcription initiation nucleotides Enhancement mode promoter or constitutive promoter, such as cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin promoter of corn (Ubiquitin), they be can be used alone or are used in combination with other plant promoters；Additionally, the gene using the present invention When building plant expression vector, it is also possible to use enhancer, including translational enhancer or transcriptional enhancer, these enhancer regions can To be ATG initiation codon or neighboring region initiation codon etc., but must be identical with the reading frame of coded sequence, whole to ensure The correct translation of individual sequence.The source of described translation control signal and initiation codon is extensive, can be natural, also may be used To be synthesis.Translation initiation region can come from transcription initiation region or structural gene.

For the ease of being identified to transgenic plant cells or plant and screening, plant expression vector used can be carried out Processing, such as add the coding that can express in plant can produce the enzyme of color change or luminophor gene (gus gene, Luciferase genes etc.), there is the antibiotic marker thing (gentamicin label, kanamycins label etc.) of resistance or anti- Chemical reagent marker gene (as anti-herbicide gene) etc..From the security consideration of genetically modified plants, any selectivity can be not added with Marker gene, directly screens transformed plant with adverse circumstance.

Described recombinant expression carrier can be to recombinate to insert between MCS KpnI and BamHI of pCUBi 1390 carrier Enter the recombinant plasmid that described gene (OsPKp1) obtains.Described recombinant plasmid concretely pCUBi 1390 OsPKp1；Described PCUBi 1390-OsPKp1 is to be inserted into the polyclonal position of pCUBi 1390 by OsPKp1 genomic coding sequence by recombinant technique (Clontech company, the Infusion recombination kit) obtaining between point HindIII and BamHI.

PCUBi 1390 containing OsPKp1 is named as pCUBi 1390-OsPKp1.

Expression cassette containing gene described in any of the above (OsPKp1), transgenic cell line and recombinant bacterium belong to the present invention Protection domain.

Expand described gene (OsPKp1) total length or the primer pair of arbitrary fragment falls within protection scope of the present invention；As The primer 2 shown in primer 1/SEQ ID NO.5 shown in SEQ ID NO.4；Primer shown in SEQ ID NO.6 Primer 4 shown in 3/SEQ ID NO.7.

It is a further object to provide a kind of method cultivating the normal genetically modified plants of Starch synthesis.

The method of the cultivation normal genetically modified plants of Starch synthesis that the present invention provides, is to close described channel genes starch Become in the plant of exception, obtain the normal genetically modified plants of Starch synthesis；Described Starch synthesis exception plant shows as endosperm The plant of silty phenotype；The normal genetically modified plants of described Starch synthesis show the genetically modified plants of transparent non-silty for endosperm. Specifically, described gene passes through in described recombinant expression carrier importing Starch synthesis exception plant；Described Starch synthesis are abnormal Plant can be W59.

Described albumen, described gene, described recombinant expression carrier, expression cassette or recombinant bacterium or methods described all can be applicable to Rice breeding.

Can guide, using any one, the carrier that foreign gene expresses in plant, the gene of encoding said proteins is led Enter plant cell, transgenic cell line and transfer-gen plant can be obtained.The expression vector carrying described gene can be by using Ti Plasmid, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, the conventional biology methods such as agriculture bacillus mediated Conversion plant cell or tissue, and the plant tissue of conversion is cultivated into plant.The plant host being converted both can be list Leaf plant or dicotyledon, such as：Tobacco, crowtoe, arabidopsis, paddy rice, wheat, corn, cucumber, tomato, poplar Tree, turfgrass, lucerne place etc..

Beneficial effect：

The Starch synthesis GAP-associated protein GAP of the present invention affects the process of grain starch synthesis in paddy endosperm.Volume by described albumen In the abnormal farinaceous albumen plant of code channel genes Starch synthesis, the genetically modified plants of the transparent non-silty of endosperm can be obtained.Institute State albumen and its encoding gene can apply to genetic modification of plants.

Brief description

Fig. 1 is the seed phenotype of wild type more light and mutant W59.

Fig. 2 is the seed scanning electron microscopic observation of wild type more light and mutant W59.

Fig. 3 is wild type more light and mutant W59 endosperm semithin section is observed.

Fig. 4 is wild type more light and mutant W59 filling rate and mass of 1000 kernel contrast.

Fig. 5 is wild type more light and mutant W59 physicochemical property compares.

Fig. 6 is finely positioning on the 7th chromosome for the mutator.

Fig. 7 is the T turning pCUBi 1390-OsPKp1₀T for plant₁Seed phenotype.

Fig. 8 is the T turning pCUBi 1390-OsPKp1₀T for plant₁Seed leach protein western testing result.

Specific embodiment

Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method, if no special instructions, is conventional method.Test material used in following embodiments, if no special instructions, is certainly Routine biochemistry reagent shop is commercially available.

The discovery of embodiment 1, plant amylum synthesis associated protein and its encoding gene

First, rice fecula synthesis mutant W59 phenotype analytical and its genetic analysis

Japonica rice variety more light is through filtering out seed silty opaque mutant W59 in MNU mutagenesis mutant library.

Fig. 1 left figure is the scanning figure in more light mature seed entirety and cross section, shows as the fully transparent phenotype of endosperm, right Figure is the overall scanning figure with cross section of W59 mature seed, shows as the phenotype of endosperm core white.

Fig. 2 is more light and W59 scanning electron microscope analysis figure.The mature seed ESEM of more light shows as starch granules arrangement Closely, size is homogeneous, and in W59 starch granules arrangement loose so that there is gap between particle.Therefore light by when meeting Scatter, lead to W59 seed outward appearance to assume opaque phenotype.

Using the I after semithin section₂- KI dyes and to observe the form (Fig. 3) of more light and W59 composite starch particle.Out of office In raw type more light endosperm nexine cell, inside each amyloplast, produce multiple self-existent starch granules, this is paddy rice typical case Composite starch grain structure, starch granules arrangement is closely (Fig. 3).Further look at mutant W59, find that its endosperm nexine is thin In the kytoplasm of born of the same parents, there are many little, scattered distribution simple grain starch granules, and between starch granules, arrange not tight, meeting There is cavity, and starch granules bad student's abnormal fusion, show the hysteresis quality (Fig. 3) that in mutant, starch is developed.

In whole Seed development, the filling rate of W59 mutant is significantly lower than wild type (Fig. 4).From Post flowering 5 It starts, and the dry-matter accumulation of mutant starts substantially less than wild type, and this difference is maintained to grouting and terminates.With Filling rate substantially reduces corresponding as a result, the W59 mutant seeds mass of 1000 kernel of maturation is significantly lower than more light (Fig. 4).

The seed of W59 mutant has the fat of lower content, and content of starch significantly reduces (Fig. 5) compared with wild type simultaneously. Correspondingly, amylose content significantly reduces (Fig. 5).

2nd, mutator positioning

1st, mutator Primary Location

Hybridized with mutant W59 and NJ11, in the F of W59/NJ11₂The seed of seed silty is randomly selected in segregating population, After germination, DNA will be extracted after the blade mixed in equal amounts of each strain respectively.First, 565 couples of SSR with covering paddy rice full-length genome draw Thing is carrying out polymorphism analysis more between light and NJ11, selecting a pair at interval of 10cM afterwards has polymorphic drawing between two parents Thing.Two parent DNA amount to three DNA samples together with colony DNA, using the 12 chromosomes of covering of select and have many The primer of state is analyzed, and finally Starch synthesis key gene OsPKp1 is positioned at the 7th chromosome SSR marker N7-9 and N7- Between 15.

The method of above-mentioned SSR marker analysis is as described below：

(1) extract the STb gene of above-mentioned selection individual plant as template, concrete grammar is as follows：

1. take 0.2 gram about of paddy rice young leaflet tablet, be placed in Eppendorf pipe, place a steel ball in pipe, installing The Eppendorf pipe of sample freezes 5min in liquid nitrogen, is placed in pulverizing sample 1min on 2000 type GENO/GRINDER instruments.

2. 660 μ l extracts (Tris-Hcl containing 100mM (PH 8.0), 20mM EDTA (PH 8.0), 1.4M are added The solution of NaCl, 0.2g/ml CTAB), whirlpool device is acutely vortexed and mixes, ice bath 30min.

3. 40 μ l 20%SDS, 65 DEG C of temperature bath 10min, mixing of gently turning upside down every two minutes are added.

4. 100 μ l 5M NaCl are added, gentle mixing.

5. add 100 μ l 10 × CTAB, 65 DEG C of temperature bath 10min, be interrupted mixing of gently turning upside down.

6. add 900 μ l chloroforms, fully mix, 12000rpm is centrifuged 3min.

7. transfer supernatant, to 1.5mL Eppendorf pipe, adds 600 μ l isopropanols, mixes, and 12000rpm is centrifuged 5min.

8. abandon supernatant, precipitate with 70% (volumn concentration) ethanol rinse once, room temperature airing.

9. add 100 μ l 1 × TE (121 grams of Tris are dissolved in 1 liter of water, adjust pH value to 8.0 solution obtaining with hydrochloric acid) molten Solution DNA.

10. 2 μ l electrophoresis detection DNA mass are taken, and with DU800 spectrophotometric determination concentration (Bechman Instrument Inc.U.S.A).

(2) DNA of said extracted is diluted to about 20ng/ μ l, enters performing PCR amplification as template；

PCR reaction system (10 μ l)：DNA (20ng/ul) 1ul, upstream primer (2pmol/ul) 1ul, downstream primer (2pmol/ul) 1ul, 10xBuffer (MgCl₂Free) 1ul, dNTP (10mM) 0.2ul, MgCl₂(25mM) 0.6ul, rTaq (5u/ul) 0.1ul, ddH₂O 5.1ul, common 10ul.

PCR response procedures：94.0 DEG C of denaturation 5min；94.0 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, altogether Circulation 35 times；72 DEG C of extension 7min；10 DEG C of preservations.PCR reaction is carried out in MJ Research PTC-225 thermal cycler.

(3) the PCR primer detection of SSR marker

Amplified production is analyzed with 8% native polyacrylamide gel electrophoresis.With the DNA Ladder of 50bp as contrast ratio Compared with the molecular size range of amplified production, silver staining develops the color.

2nd, mutator finely positioning

According to the result of Primary Location, it is spaced certain section self-developing SSR marker in mutational site region, so that Screen more multiple labeling further positional mutation position point in the relevant portions of this chromosome.Obtain from more light/NJ11 cross combination F₂The F confirming as mutant phenotype is chosen in segregating population₂Seed, for the finely positioning in mutational site.Using on public collection of illustrative plates Molecular labeling and based on Public Rice Genome Sequence Data independently developed SSR, Indel molecular labeling, mutational site is carried out Finely positioning, and mutational site is primarily determined that according to positioning result, concrete grammar is as follows：

(1) SSR marker exploitation

The SSR marker of public collection of illustrative plates and Rice Genome Sequence are integrated, is downloaded the BAC/PAC near mutational site Cloned sequence.With SSRHunter (Li Qiang etc., heredity, 2005,27 (5):808-810) or potential in SSRIT software search clone SSR sequence (number of repetition >=6)；The sequence of these SSR and its neighbouring 400～500bp is existed by blast program in NCBI Line is compared with corresponding long-grained nonglutinous rice sequence, if both SSR numbers of repetition are variant, tentatively infers the PCR of this SSR primer There is polymorphism in product between Xian, round-grained rice；Recycle Primer Premier 5.0 Software for Design SSR primer, and handsome by Shanghai Bioisystech Co., Ltd synthesizes.Paired for the SSR of designed, designed primer equal proportion is mixed, detects it more between light and NJ11 Polymorphism, show polymorphic person be used as finely positioning OsPKp1 gene molecular labeling.Molecular labeling for finely positioning is shown in Table 3.

Table 3 is used for the molecular labeling of finely positioning

Mark	Forward primer	Reverse primer	Physical distance bp	Type
					W59-3	CACCACGATATCCACCTCTAGC	CCTAGGATGAACACTGATGATGG	4660420	InDel
W59-8	CACGTACGCCACCAGCATCC	CACATGGCCTACTCCAAGTTCTGG	3317940	InDel
					W59-11	CTATCTCGCTCTCGCAAACACC	TCACCCTATCAGTGTGGGTAATGG	3770854	InDel
W59-13	CAAGCTGCCGTGTTCTACTGG	GCACACAACAAGAGACAGTAACATGC	4028504	InDel
					W59-14	TCCGGTCGTCCTCATCGTATCC	GCCCTCTTGCTCCCACATCG	4419897	InDel
W59-15	ACAAGTCCACAAGGACCACAACC	TGCTCCACCCAAAGATACAGAGC	4561618	InDel
					W59-16	TTACCGACCGCAGTTATCT	TTGTTTCCCTCAACTCACTG	4346594	InDel
W59-19	CTCAAATCCAAGAACCCATC	GATGGCACAGTACAAGGTTC	4499486	InDel
					W59-34	CCCCCGTAAGTGAAGAG	TGTCGGTGACGGTGAGT	4107398	InDel
W59-35	GCAAAGACCAAAACCCC	TGGGCACGGAAAAAATA	4124772	InDel
					W59-37	GCAACGAAGGACTAGATGTG	AACCTATGACTGGGTGTGAC	4197976	InDel
7-9	TCACTAGCTCTGCCCTGACC	TGATGAGAGTTGGTTGCGAG	2677960	SSR
					N7-12	AGACGTACACCCCGAACTTG	GAGGTGTTCGGAGTGAGGAG	4320108	SSR
N7-15	GAGAGGAATGGAATGGAATGAGG	GAACAGGCATGGTGAAGAGTGC	6765604	SSR

According to F₂The molecular data of endosperm silty individual plant and phenotypic data in colony, according to " the recessive pole of the reports such as Zhang End genes of individuals mapping " method, finally OsPKp1 gene finely positioning between W59-40 and W59-45, physical distance is about 170kb (Fig. 6).Candidate's section gene order-checking shows, in W59, there is the prominent of a base in gene Os07g0181000 Become, A is sported by G, leads to protein translation to terminate in advance.

(3) acquisition of mutator

According to the site design primer of positioning, sequence is as described below：

primer1：5'-AACGCCTCGTCTGAACACAAAACC-3'(SEQ ID NO.4)

primer2：5'-AAAGAATCTTTACTGGGCTC-3'(SEQ ID NO.5)

With primer1 and primer2 as primer, with the cDNA of more light as template, enter performing PCR amplification and obtain genes of interest. This is located at SEQ ID NO.2 upstream 71bp and downstream 335bp to primer, and amplified production is the purpose fragment of 2022bp.

Amplified reaction is carried out in PTC-200 (MJ Research Inc.) PCR instrument：94℃3min；94 DEG C of 30sec, 60 DEG C 45sec, 72 DEG C of 2min, 35 circulations；72℃5min.By PCR primer recovery purifying rear clone to carrier pEASY, (Beijing is complete Formula King Company), conversion bacillus coli DH 5 alpha competent cell (Beijing Tiangen company CB101), after selecting positive colony, enter Row sequencing.Sequencing results show, the fragment that PCR reaction obtains has the nucleotides shown in SEQ ID NO.2 in sequence table Sequence, the protein (from ATG to TGA) (see the SEQ ID NO.1 of sequence table) of 578 amino acid residue compositions of coding.By SEQ Albumen shown in IDNO.1 is named as OsPKp1 (the OsPKp1 gene as described in the assignment of genes gene mapping), by SEQ ID NO.1 institute The encoding gene name OsPKp1 of the albumen showing.

Embodiment 2, the acquisition of genetically modified plants and identification

First, recombinant expression carrier builds

With the cDNA of more light as template, enter the coded sequence that performing PCR amplification obtains OsPKp1 gene, PCR primer sequence is such as Under：

primer3：5'TTCTGCACTAGGTACCATGGCCGCCACCGCCG 3'(SEQ ID NO.6)

primer4：5'GAATTCCCGGGGATCCTCAAGGTACGTTCATG 3'(SEQ ID NO.7)

Above-mentioned primer starts to terminate to TGA positioned at the ATG of gene shown in sequence 2 respectively, and amplified production contains this gene Whole code areas part, by PCR primer recovery purifying.Using Infusion recombination kit (Clontech) by PCR primer It is cloned in carrier pCUBi1390, be built into pCUBi1390-OsPKp1；Recombining reaction system (10.0 μ L)：PCR primer 5.4 μ L (50-100ng), pCUBi1390 carrier 1.6 μ L (30-50ng), 5 × Infusion buffer 2.0 μ L, Infusion enzyme mix 1μL.By 37 DEG C of more than water-bath 0.5h of mixed system after of short duration centrifugation, 2.5 μ L reaction system heat shock methods are taken to turn Change bacillus coli DH 5 alpha competent cell (Beijing Tiangen company；CB101).Cell will be totally converted and be uniformly coated on and contain On the LB solid medium of 50mg/L kanamycins.

After 37 DEG C of culture 16h, picked clones positive colony, it is sequenced.Sequencing result shows, has obtained containing SEQ ID The recombinant expression carrier of gene shown in NO.3, the pCUBi1390 containing OsPKp1 is named as pCUBi1390 OsPKp1, OsPKp1 gene is inserted between MCS KpnI and BamHI.

2nd, the acquisition of recombinational agrobacterium

With electric shocking method by pCUBi1390 OsPKp1 conversion Agrobacterium EHA105 bacterial strain (purchased from handsome company of the U.S.), obtain Recombinant bacterial strain, extracts plasmid and enters performing PCR and digestion identification.PCR and digestion are identified that correct recombinant bacterial strain is named as pCUBi1390–OsPKp1.

3rd, the acquisition of genetically modified plants

PCUBi1390 OsPKp1 untransformed mutants W59 concrete grammar is：

(1) 28 DEG C of culture pCUBi1390 OsPKp1 cultivates 16 hours, collects thalline, and is diluted to containing 100 μm of ol/L In the N6 fluid nutrient medium (Sigma company, C1416) of acetosyringone to concentration be OD₆₀₀≈ 0.5, obtains bacterium solution；

(2) the bacterium solution mixed infection of the W59 Mature Embryos of Rice embryo callus to month and step (1) will be cultivated 30min, filter paper proceeds in co-cultivation culture medium (N6 solid co-cultivation medium, Sigma company) after blotting bacterium solution, train altogether for 24 DEG C Support 3 days；

(3) callus of step (2) is seeded in containing 100mg/L paromomycin (Phyto Technology Laboratories company) N6 solid screening and culturing medium on for the first time screen (16 days)；

(4) picking health callus proceeds to programmed screening on the N6 solid screening and culturing medium containing 100mg/L paromomycin, Every 15 days subcultures are once；

(5) picking health callus proceeds to and screens for the third time on the N6 solid screening and culturing medium containing 50mg/L paromomycin, Every 15 days subcultures are once；

(6) picking kanamycin-resistant callus tissue proceeds to differentiation on differential medium；Obtain the T of seedling differentiation₀For positive plant.

4th, the identification of transfer-gen plant

1st, hygromycin resistance identification

The hygromycin solution utilizing 1 ‰ concentration in this research identifies transfer-gen plant.Concrete grammar：By fresh transgenosis Plant leaf (not having rotaring gene plant blade to do negative control) is placed in culture dish, with newly join 1 ‰ hygromycin solution leaching Bubble, is placed on light culture 48 hours in 28 DEG C of incubators, and compares, and the showing of blade necrosis does not resist, and does not have showing of necrosis Anti-, three familys of hygromycin are named as HB-1, HB-2 and HB-3.

2nd, Western Blot identification

To T₀The T being tied for plant₁For seed extract total protein, Seed Storage Protein extract recipe (5M UREA, 4%SDS, 0.125M Tris-Hcl pH6.8, β-Me 5%, a small amount of bromophenol blue), each seed adds 350ul extract, dries in 50 DEG C Case places 12-16 hour, mixing of turning upside down, and 12000rpm is centrifuged 2 minutes, draws 10ul and carries out SDS-PAGE, goes to Buddhist nun After imperial film, resisted with OsPKp1 mono- and be incubated respectively with rabbit two is anti-.The T1 that T0 generation different family plant are tied in seed, picking The individuality of bleach has band at target location (63kD), as positive complementation family.In Fig. 8, rear 3 swimming lanes are in purpose position It is equipped with band, and content is higher than wild type, show that this two T1 are transgenic positive plant for T0 corresponding to seed for plant, the 1st, 2 swimming lanes are respectively wild type and W59.

3rd, phenotypic evaluation

Respectively by T₀In generation, turns the positive plant of pCUBi1390 OsPKp1, and more light and W59 is planted in Agricultural University Of Nanjing's board Building proving ground.For seed, phenotypic evaluation is carried out to T1, finds (transparent for showing in T1：Silty=3:1) phenotype, transparent The phenotype of seed is identical with more light, and the phenotype of opaque seed is identical with W59 (Fig. 7), illustrates to lead to W59 mutation type surface certain It is that OsPKp1 gene controls, that is, this OsPKp1 gene is Starch-synthesizing genes.

<110>Agricultural University Of Nanjing

<120>A kind of plant amylum synthesis associated protein OsPKp1 and its encoding gene and application

<160> 9

<210> 1

<211> 578

<212> PRT

<213>Oryza paddy rice（Oryza sativa var. more light（Koshihikari））

<220>

<223>Regulation and control Starch synthesis GAP-associated protein GAP OsPKp1 amino acid sequence

<400> 1

Met Ala Ala Thr Ala Ala Ala Ala His Thr Leu Leu His Leu Ala

1 5 10 15

Ala Pro Arg Lys Pro Ser Ala Gly Pro Pro Leu Pro Pro Ala Thr

20 25 30

Leu Arg Leu Pro Ser Arg Arg Leu Ala Arg Leu Thr Ala Ser Cys

35 40 45

Ser Ser Gly Ser Gly Asn Asn Ser Ala Ala Asp Phe Pro Asn Pro

50 55 60

Asn Gly Ile Leu Val Ala Pro Pro Ser Ala Ala Ala Val Ala Ala

65 70 75

Ala Ser Ser His Ile Asp Val Asp Val Ala Thr Glu Ala Asp Leu

80 85 90

Arg Glu Asn Gly Phe Arg Ser Thr Arg Arg Thr Lys Leu Val Cys

95 100 105

Thr Val Gly Pro Ala Thr Cys Gly Ala Asp Glu Leu Glu Ala Leu

110 115 120

Ala Val Gly Gly Met Asn Val Ala Arg Val Asn Met Cys His Gly

125 130 135

Asp Arg Glu Trp His Arg Gly Val Ile Arg Ala Val Arg Arg Leu

140 145 150

Asn Glu Glu Lys Gly Phe Ala Val Ala Val Met Met Asp Thr Glu

155 160 165

Gly Ser Glu Ile His Met Gly Asp Leu Gly Gly Ala Ala Ala Ala

170 175 180

Lys Ala Glu Asp Gly Glu Ile Trp Thr Phe Ser Val Arg Ser Phe

185 190 195

Glu Ala Pro Pro Pro Glu Arg Thr Ile His Val Asn Tyr Glu Gly

200 205 210

Phe Ala Glu Asp Val Arg Val Gly Asp Glu Leu Leu Val Asp Gly

215 220 225

Gly Met Ala Arg Phe Glu Val Val Glu Lys Leu Gly Pro Asp Val

230 235 240

Lys Cys Arg Cys Thr Asp Pro Gly Leu Leu Leu Pro Arg Ala Asn

245 250 255

Leu Thr Phe Trp Arg Asp Gly Ser Ile Val Arg Glu Arg Asn Ala

260 265 270

Met Leu Pro Thr Ile Ser Ser Lys Asp Trp Leu Asp Ile Asp Phe

275 280 285

Gly Ile Ser Glu Gly Val Asp Phe Ile Ala Val Ser Phe Val Lys

290 295 300

Ser Ala Glu Val Ile Asn His Leu Lys Ser Tyr Ile Ala Ala Arg

305 310 315

Ser Arg Gly Ser Asp Ile Ala Val Ile Ala Lys Ile Glu Ser Ile

320 325 330

Asp Ser Leu Lys Asn Leu Glu Glu Ile Ile Arg Ala Ser Asp Gly

335 340 345

Ala Met Val Ala Arg Gly Asp Met Gly Ala Gln Ile Pro Leu Glu

350 355 360

Gln Val Pro Ser Val Gln Gln Lys Ile Val Lys Leu Cys Arg Gln

365 370 375

Leu Asn Lys Pro Val Ile Val Ala Ser Gln Leu Leu Glu Ser Met

380 385 390

Ile Glu Tyr Pro Thr Pro Thr Arg Ala Glu Val Ala Asp Val Ser

395 400 405

Glu Ala Val Arg Gln Arg Ala Asp Ala Leu Met Leu Ser Gly Gly

410 415 420

Ser Ala Met Gly Arg Tyr Pro Glu Lys Ala Leu Ser Val Leu Arg

425 430 435

Ser Val Ser Leu Arg Ile Glu Lys Trp Trp Arg Glu Glu Lys Arg

440 445 450

His Glu Glu Leu Glu Leu Lys Asp Val Ser Ser Ser Phe Ser Asp

455 460 465

Lys Ile Ser Glu Glu Ile Cys Ile Ser Ala Ala Lys Met Ala Asn

470 475 480

Lys Leu Glu Val Asp Ala Val Phe Val Tyr Thr Asn Thr Gly His

485 490 495

Met Ala Ser Leu Leu Ser Arg Cys Arg Pro Asp Cys Pro Ile Phe

500 505 510

Ala Phe Thr Thr Ser Thr Ser Val Arg Arg Arg Leu Asn Leu Gln

515 520 525

Trp Gly Leu Ile Pro Phe Arg Leu Ser Phe Ser Asp Asp Met Glu

530 535 540

Ser Asn Leu Asn Arg Thr Phe Ser Leu Leu Lys Ala Arg Gly Met

545 550 555

Ile Gln Ser Gly Asp Leu Val Ile Ala Leu Ser Asp Met Leu Gln

560 565 570

Ser Ile Gln Val Met Asn Val Pro

575

<210> 2

<211> 1737

<212> DNA

<213>Oryza paddy rice（Oryza sativa var. more light（Koshihikari））

<220>

<223>OsPKp1 gene C DS sequence

<400> 2

atggccgcca ccgccgccgc ggcccacacc ctcctccacc tcgcggcccc gaggaagccc 60

tccgcggggc ccccactccc gcccgccacc ctccgcctcc ccagccgccg cctcgcccgt 120

ctcacggcca gctgcagcag cggctccggg aacaacagcg ccgccgactt ccccaacccc 180

aacgggatcc tcgtcgcgcc cccgtccgcc gcggcggtgg cggcggcgtc gtcgcatatc 240

gatgttgacg tggcgacgga ggccgacctg agggagaacg ggttccggag cacgcggcgc 300

accaagctcg tctgcaccgt ggggcccgcc acctgcggcg ccgacgagct ggaggcgctc 360

gccgtcggcg ggatgaacgt cgcgcgcgtc aacatgtgcc acggggaccg ggagtggcac 420

cggggcgtca tccgcgcggt gcggaggctc aacgaggaga aggggttcgc cgtcgccgtc 480

atgatggaca ccgaggggag cgagatccac atgggggacc tcggcggcgc cgccgccgcc 540

aaggcggagg atggagaaat atggacattt agcgtaagat cctttgaggc acctccccca 600

gaacgaacta ttcatgtgaa ctacgaaggc ttcgctgaag atgtgagagt tggtgatgag 660

cttcttgttg atggtggcat ggctcggttt gaggtggttg agaaattagg accagatgtc 720

aagtgccgtt gcacagatcc tggtttgttg ctgccacgtg ccaatcttac attttggcgg 780

gatggtagta ttgtccgtga gaggaacgct atgctaccta ccatttcatc aaaggattgg 840

cttgacatag actttggaat ttctgaaggc gtagatttta ttgcagtttc gtttgtcaaa 900

tctgcagaag taattaacca tctgaaaagc tatatagctg caaggagccg tggcagcgat 960

atagcagtca ttgccaagat cgagagcatt gactctttga agaacttgga ggagataatc 1020

cgtgcttcag atggtgccat ggtagcccga ggggatatgg gtgcacaaat tcccttggag 1080

caagtcccct cagtacaaca aaagatagtt aaactgtgca ggcagctcaa caagccagtc 1140

attgttgcgt cgcagcttct tgaatcgatg attgagtatc ctacgcccac cagggccgag 1200

gttgctgatg tttctgaagc agttcgtcag cgtgcagatg cgcttatgct ttcaggtgag 1260

tcagcaatgg ggagatatcc agagaaagct cttagtgtcc tccggagtgt tagcctaagg 1320

attgagaagt ggtggagaga ggagaagcgc catgaggaac tggaacttaa agatgtttca 1380

tcttccttct ctgacaaaat atcagaagaa atctgcattt cggccgctaa aatggccaac 1440

aaattggagg tagatgccgt tttcgtctac acaaacactg gccacatggc ctcactgctc 1500

tcgcggtgcc gtcctgactg cccgatcttc gccttcacga cctcgacatc tgtgaggaga 1560

cgattgaacc tccaatgggg cctcatcccc ttccgcctca gcttctcgga cgacatggag 1620

agcaacctga accgtacctt ctcgctgctc aaggccaggg gcatgatcca gtccggcgac 1680

cttgtcatcg cgctctccga catgctgcag tccatccagg tcatgaacgt accttga 1737

<210> 3

<211> 4639

<212> DNA

<213>Oryza paddy rice（Oryza sativa var. more light（Koshihikari））

<220>

<223>OsPKp1 gene

<400> 3

caacgcctcg tctgaacaca aaaccccgta aaaatctccg cctccgccac cgccaccgcc 60

gccgacgccg ccatggccgc caccgccgcc gcggcccaca ccctcctcca cctcgcggcc 120

ccgaggaagc cctccgcggg gcccccactc ccgcccgcca ccctccgcct ccccagccgc 180

cgcctcgccc gtctcacggc cagctgcagc agcggctccg ggaacaacag cgccgccgac 240

ttccccaacc ccaacgggat cctcgtcgcg cccccgtccg ccgcggcggt ggcggcggcg 300

tcgtcgcata tcgatgttga cgtggcgacg gaggccgacc tgagggagaa cgggttccgg 360

agcacgcggc gcaccaagct cgtctgcacc gtggggcccg ccacctgcgg cgccgacgag 420

ctggaggcgc tcgccgtcgg cgggatgaac gtcgcgcgcg tcaacatgtg ccacggggac 480

cgggagtggc accggggcgt catccgcgcg gtgcggaggc tcaacgagga gaaggggttc 540

gccgtcgccg tcatgatgga caccgagggg agcgagatcc acatggggga cctcggcggc 600

gccgccgccg ccaaggcgga ggtgagctta gctgccgctg gattctgcct ttggcattgc 660

cgccttgcta atttgctttc atgcgttcga tggaattcgg cgagtaccgc gtgcgtggtg 720

ctagcaagta cgtgaattca tactactagt gagtaggaat gcgtgcttta ttcgacttgg 780

aattcggata aagaagatgt cctgacaccg tgactcggta gatctagatt tgagctcagg 840

ttcatgtttg cacagtgaag gggaacacta gtattgttat ggaatattct tccatgaaat 900

gctactagca cccaacattc cctggagtgg ggataccagt ttggattttg cgcaacttta 960

tcgcaagttg ggtgataaca tgaatccaga ttctactgca gagaatataa gagatgctca 1020

ggtagatgca aaagagagag ccacatcata atctcacttg agcaagtgct ccagcccctt 1080

ctgggactac catgttatag acctgtcaac aagctaaatt aaccacctat ttaagcgtgt 1140

aaccattcca agtgctggcc tccttgttaa ctattgaata ctctgcaact tttcatgcta 1200

ttgtccacgc tggtagagaa acacagttag tttggcctaa ttgtcagcta tgtatgtgtt 1260

ttgtacatgg cccaacaggc tcttgttcct gtaatgtcag cctatagtgt aaatcttgct 1320

ttccagctga aaaaggaaca ccgcatctga attttgttta ttagattcag cagaagcatg 1380

caggcatctg tagtttgagt tttattgact tggtttggca gtcataagct ctgttcttgc 1440

tctagtaaag aattgaagtt tcacattaaa aaaagggtaa agaaattgaa gttaacaata 1500

tctgatgctc caaagtttct gtatcaccta tgtcaatgaa ccatgacata atcttagaga 1560

ttaatgaatt ctctcatatg actggctcac cactctcaaa aataagattc ttgcataatt 1620

tttttcattt gaaacatatt acaagtggct tgaccgctat ctagcactcc ctcctagtca 1680

tatccaatga taactacttt actttttcta gccatgcctt ttattggttc tttttgggtt 1740

ttcctagtgg caatatgccc ctctaatagt tatttatttt aatccttttt ttttcttttg 1800

ttggatttca caggatggag aaatatggac atttagcgta agatcctttg aggcacctcc 1860

cccagaacga actattcatg tgaactacga aggcttcgct gaaggttatt ttcaagcaga 1920

tctcttctgt tggtcttatt tatatttcta ttcccctctg taatgtgttt tttgaacact 1980

acacagatgt gagagttggt gatgagcttc ttgttgatgg tggcatggct cggtttgagg 2040

tggttgagaa attaggacca gatgtcaagt gccgttgcac agatcctggt ttgttgctgc 2100

cacgtgccaa tcttacattt tggcgggatg gtagtattgt ccgtgagagg aacgctatgc 2160

tacctaccat ttcatcaaag gtaaattcac tagcatggca aatttgttgc tgcaagcctg 2220

taatcaaaaa gtaggctgaa tggttatgtc attttgttgc acaaacagtt catgttttac 2280

atgttactac tgaggtcagc ccaaatgaat tacctggttt actcaaacca ttgtgttgta 2340

atagtgaata atatctgcat atattcgaaa aagtccacca tccatttctt agaaagcttt 2400

atgtggactg ttaccaagag ttattgttgt tgagaaatga tgattcttat ttctgtgcaa 2460

cttctgcagg attggcttga catagacttt ggaatttctg aaggcgtaga ttttattgca 2520

gtttcgtttg tcaaatctgc agaagtaatt aaccatctga aaagctatat agctgcaagg 2580

agccgtggca ggtaagatga gtataaatac tctcttcttg attgagctca tacctccatg 2640

aagctaagta catggtttga tggttgaact gatggcacca tatgtatgac taatactgta 2700

actatccaac tcttgtgcat ttgctgcttt tggttcttgt ccaattctgt ggtaccagtt 2760

gggtaagctt ttcagtcagc tacccctcag atgatcagct tagtatgaac gcactgtttt 2820

taactagtta ttacttaaat gttgagttag ccataacttg ctatagtgtc aactcttttg 2880

caccaacaat cttggttttt attaggacat ggtctctttg ttgttagttt ctccaatcaa 2940

ttttttcgat ttgtagtaga gccaagtgga ctatggcagt aagttctgat gtgttgaaga 3000

ttgtcttggt tgctccatac ctgttcaaac aaaaaaactg atcaatatat tattttgtac 3060

tgtttctagt ttagatttgc agtagtgtag taattcactt ttaggttgct ttacgtgtat 3120

tcttttattt ctagaagagt gaacatgatt aataaaatgc atgaatttag atggcttaag 3180

aaaatggacc atacaaatat atcggtatag tgtatagtgt ttatatgtcc caaagaacca 3240

agaaatatta catatatttc tattaaaaaa gctaggcatt gcattcccga aatattagtt 3300

tcctttttgc taacctttat ggttattgta tattgtcact catcagcgat atagcagtca 3360

ttgccaagat cgagagcatt gactctttga agaacttgga ggagataatc cgtgcttcag 3420

atggtgccat ggtagcccga ggggatatgg gtgcacaaat tcccttggag caagtcccct 3480

cagtacaaca aaagatagtt aaactgtgca ggcagctcaa caagccagtc attgttgcgt 3540

cgcagcttct tgaatcgatg attgagtatc ctacgcccac cagggccgag gttgctgatg 3600

tttctgaagc agttcgtcag cgtgcagatg cgcttatgct ttcaggtgag tcagcaatgg 3660

ggagatatcc agagaaagct cttagtgtcc tccggagtgt tagcctaagg attgagaagt 3720

ggtggagaga ggagaagcgc catgaggaac tggaacttaa agatgtttca tcttccttct 3780

ctgacaaaat atcagaagaa atctgcattt cggccgctaa aatgggtaac cactgccaac 3840

tctacttcta ttgttggact gctgctgtat atatgaatcg ttttttcgct gttacttctt 3900

tttgttattg tgcattgcca tggttattat caactcagac tactgaattt tgccatttgc 3960

atatctgggc aaggcctaac cacagctaat ttgagttgca gccaacaaat tggaggtaga 4020

tgccgttttc gtctacacaa acactggcca catggcctca ctgctctcgc ggtgccgtcc 4080

tgactgcccg atcttcgcct tcacgacctc gacatctgtg aggagacgat tgaacctcca 4140

atggggcctc atccccttcc gcctcagctt ctcggacgac atggagagca acctgaaccg 4200

taccttctcg ctgctcaagg ccaggggcat gatccagtcc ggcgaccttg tcatcgcgct 4260

ctccgacatg ctgcagtcca tccaggtcat gaacgtacct tgagaatcat catgctcccc 4320

tctcgtgttt gtttgttctg cccaaaacgg aacacggctt tagttgacat catcttaagg 4380

gcggttttct ggtttgaaat ttattcgttt gttctccatt gtgttagacg acagaaccag 4440

agaatgttac aacaataatg ctgcaacttc cagcgcgttg taaactctat gctatttagc 4500

ctgatgtata aggccatgaa ctgttttgtc gcttactatg ataggctatg tatttaccaa 4560

taaacccttc tatttaagct atgtaagaat tttcctcatc agaaattact ccttgctaga 4620

gcccagtaaa gattcttta 4639

<210> 4

<211> 24

<212> DNA

<213>Artificial sequence

<220>

<223> primer1

<400> 4

aacgcctcgt ctgaacacaa aacc 24

<210> 5

<211>20

<212> DNA

<213>Artificial sequence

<220>

<223> primer2

<400> 5

aaagaatctt tactgggctc 20

<210> 6

<211>32

<212> DNA

<213>Artificial sequence

<220>

<223> primer3

<400> 6

ttctgcacta ggtaccatgg ccgccaccgc cg 32

<210> 7

<211>32

<212> DNA

<213>Artificial sequence

<220>

<223> primer4

<400> 7

gaattcccgg ggatcctcaa ggtacgttca tg 32

<210> 8

<211>387

<212> DNA

<213>Artificial sequence

<220>

<223>MBP label

<400> 8

Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp

1 5 10 15

Lys Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys

20 25 30

Asp Thr Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu

35 40 45

Glu Lys Phe Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile

50 55 60

Ile Phe Trp Ala His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly

65 70 75

Leu Leu Ala Glu Ile Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu

80 85 90

Tyr Pro Phe Thr Trp Asp Ala Val Arg Tyr Asn Gly Lys Leu Ile

95 100 105

Ala Tyr Pro Ile Ala Val Glu Ala Leu Ser Leu Ile Tyr Asn Lys

110 115 120

Asp Leu Leu Pro Asn Pro Pro Lys Thr Trp Glu Glu Ile Pro Ala

125 130 135

Leu Asp Lys Glu Leu Lys Ala Lys Gly Lys Ser Ala Leu Met Phe

140 145 150

Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro Leu Ile Ala Ala Asp

155 160 165

Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys Tyr Asp Ile Lys

170 175 180

Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly Leu Thr Phe

185 190 195

Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp Thr Asp

200 205 210

Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala Met

215 220 225

Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys

230 23 5 240

Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro

245 250 255

Ser Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala

260 265 270

Ser Pro Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu

275 280 285

Leu Thr Asp Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu

290 295 300

Gly Ala Val Ala Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp

305 310 315

Pro Arg Ile Ala Ala Thr Met Glu Asn Ala Gln Lys Gly Glu Ile

320 325 330

Met Pro Asn Ile Pro Gln Met Ser Ala Phe Trp Tyr Ala Val Arg

335 340 345

Thr Ala Val Ile Asn Ala Ala Ser Gly Arg Gln Thr Val Asp Glu

350 355 360

Ala Leu Lys Asp Ala Gln Thr Asn Ser Ser Ser Asn Asn Asn Asn

365 370 375

Asn Asn Asn Asn Asn Asn Leu Gly Ile Glu Gly Arg

380 385 387

<210> 9

<211> 240

<212> DNA

<213>Artificial sequence

<220>

<223>GFP label

<400> 9

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile

1 5 10 15

Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val

20 25 30

Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu

35 40 45

Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr

50 55 60

Leu Val Thr Thr Phe Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr

65 70 75

Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro

80 85 90

Glu Gly Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly

95 100 105

Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu

110 115 120

Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly

125 130 135

Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Tyr Asn Ser His Asn

140 145 150

Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly Ile Lys Val Asn

155 160 165

Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val Gln Leu Ala

170 175 180

Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu

185 190 195

Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser Lys

200 205 210

Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val

215 220 225

Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Arg Ser

230 235 240

Claims (10)

1. a kind of regulation and control Starch synthesis GAP-associated protein GAP OsPKp1 is it is characterised in that be selected from any one as shown in (a) or (b)：

A protein that () amino acid sequence shown in SEQ ID NO.1 forms；

(b) by the amino acid sequence of SEQ ID NO.1 through the replacement of one or several amino acid residues and/or disappearance and/or Add and by sequence 1 derived from the protein related to Starch synthesis.

2. the gene of albumen described in coding claim 1.

3. gene according to claim 2 it is characterised in that：Described gene is following 1) or 2) or 3) or 4) shown in DNA molecular：

1) DNA molecular shown in SEQ ID NO.2；

2) DNA molecular shown in SEQ ID NO.3；

3) under strict conditions with 1) or 2) the DNA sequence dna hybridization limiting and the DNA that encodes albumen described in SEQ ID NO.1 divide Son；

4) with 1) or 2) or 3) DNA sequence dna that limits has more than 90% homology, and encode the DNA of Starch synthesis GAP-associated protein GAP Molecule.

4. the recombinant expression carrier containing gene described in Claims 2 or 3, expression cassette, transgenic cell line or recombinant bacterium.

5. recombinant expression carrier according to claim 4 it is characterised in that：Described recombinant expression carrier be The restructuring matter that gene described in insertion Claims 2 or 3 between MCS KpnI and BamHI of pCUBi1390 carrier obtains Grain.

6. the total length of gene described in amplification Claims 2 or 3 or the primer pair of its any fragment are it is characterised in that be selected from SEQ ID The primer 2 shown in primer 1/SEQ ID NO.5 shown in the NO.4 or primer 3/SEQ shown in SEQ ID NO.6 Primer 4 shown in ID NO.7.

7. albumen described in claim 1, gene described in Claims 2 or 3, recombinant expression carrier, expression described in claim 4 At least one application in plant breeding in box, transgenic cell line or recombinant bacterium.

8. application according to claim 7 is it is characterised in that albumen described in claim 1, base described in Claims 2 or 3 Cause, at least one in recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterium described in claim 4 is cultivating shallow lake Powder synthesizes the application in normal genetically modified plants.

9. a kind of method cultivating the normal genetically modified plants of Starch synthesis, is by channel genes starch described in Claims 2 or 3 In resulting anomaly plant, obtain the normal genetically modified plants of Starch synthesis；Abnormal plant shows described Starch synthesis for endosperm Plant for silty phenotype；The transgenosis that the normal genetically modified plants of described Starch synthesis show transparent non-silty for endosperm is planted Thing.

10. method according to claim 9 it is characterised in that：Gene described in Claims 2 or 3 pass through claim 4 or Recombinant expression carrier described in 5 imports in the abnormal plant of Starch synthesis.