CN108642065B - Rice endosperm aleurone related gene OsSecY2 and encoding protein and application thereof - Google Patents

Abstract

The invention discloses a rice endosperm aleurone related gene Ossecy2, and a coding protein and application thereof, wherein the gene Ossecy2 provided by the invention is a DNA molecule described in the following 1) or 2) or 3) or 4): 1) DNA molecule shown in SEQ ID NO. 1; 2) DNA molecule shown in SEQ ID NO. 2; 3) a DNA molecule which hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes said protein; 4) DNA molecule which has more than 90% of homology with the DNA sequence limited by 1) or 2) or 3) and codes plant starch synthesis related protein. The invention also provides protein coded by the gene, the protein influences the synthesis of starch in plant endosperm, and the coded gene of the protein is introduced into a plant with abnormal starch synthesis, so that a transgenic plant with normal starch synthesis can be cultivated. The protein and the coding gene thereof can be applied to plant genetic improvement.

Description

Rice endosperm aleurone related gene OsSecY2 and encoding protein and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a rice endosperm aleurone related gene OsSecY2, and a coding protein and application thereof.

Background

Rice is an important food crop and one of the model species for plant research. The rice seeds accumulate a large amount of starch in the maturation process, so that main energy is provided for seed germination and seedling growth and development, and the starch is also an important food source for human beings. The size and weight of the rice seeds are determined by the amount of starch accumulated in the rice seeds, the rice seeds are directly related to the yield of the rice, and meanwhile, the taste quality of the rice is influenced by the content of amylose and the structure of amylopectin in the seeds, so that the research on the synthesis process of the starch in the rice has important application value, the deep research on the synthesis and regulation mechanism of the starch is developed, and the method has important guiding significance for improving the yield of the rice and improving the quality of the rice.

Although many enzymes and regulators involved in the starch synthesis process have been identified, the process still needs further intensive research, and various types of endosperm variant mutants are good materials for studying the process. Rice starch mutants include waxy (wax, wx), sugary (su), floury (flo), shrivel (sh), dark (duml, du), white-heart (wc) and the like. The rice endosperm character mutation mutant is utilized to position and clone a series of starch synthesis and regulation related genes, and a certain foundation is laid for the quality improvement of rice.

Disclosure of Invention

The invention aims to disclose a rice endosperm flour quality related gene Osscy2, and a coding protein and application thereof.

The gene OsSecY2 provided by the invention is a DNA molecule as described in the following 1) or 2) or 3) or 4):

1) DNA molecule shown in SEQ ID NO. 1;

2) DNA molecule shown in SEQ ID NO. 2;

3) a DNA molecule which hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes said protein;

4) DNA molecule which has more than 90% of homology with the DNA sequence limited by 1) or 2) or 3) and codes plant starch synthesis related protein.

SEQ ID NO.1 of the sequence Listing, consisting of 7360 nucleotides.

The invention also provides a protein coded by the gene OsSecY 2.

Specifically, the protein provided by the invention is selected from any one of the following proteins shown as (a) or (b):

(a) a protein consisting of an amino acid sequence shown in SEQ ID No. 3;

(b) a protein derived from the amino acid sequence shown in SEQ ID NO.3, wherein the protein is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO.3 and is related to starch synthesis.

SEQ ID NO.3 of the sequence Listing, consisting of 542 amino acids.

The invention also provides a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the gene OsSecY 2. The recombinant expression vector containing any one of the genes also belongs to the protection scope of the invention.

The recombinant expression vector containing the gene can be constructed by using the existing plant expression vector.

The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal can direct polyadenylation to the 3 'end of the mRNA precursor, and untranslated regions transcribed from the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (e.g., nopalin synthase Nos), plant genes (e.g., soybean storage protein genes) all have similar functions.

When the gene is used for constructing a recombinant plant expression vector, any enhanced promoter or constitutive promoter can be added in front of transcription initiation nucleotide, such as cauliflower mosaic virus (CAMV)35S promoter and maize Ubiquitin promoter (Ubiquitin), and the enhanced promoter or constitutive promoter can be used independently or combined with other plant promoters; in addition, when the gene of the present invention is used to construct plant expression vectors, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and screening of transgenic plant cells or plants, plant expression vectors to be used may be processed, for example, by adding a gene encoding an enzyme or a luminescent compound which can produce a color change (GUS gene, luciferase gene, etc.), an antibiotic marker having resistance (gentamicin marker, kanamycin marker, etc.), or a chemical-resistant marker gene (e.g., herbicide-resistant gene), etc., which can be expressed in plants. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

The recombinant over-expression vector can be a recombinant plasmid obtained by inserting the gene (OsSecY2) into the recombination site of a restriction enzyme XbaI and BamHI double-digestion vector pCAMBIA 1305-GFP. pCAMBIA1305-GFP containing OsSecY2 was designated pCAMBIA1305-GFP-OsSecY 2.

The expression cassette, the transgenic cell line and the recombinant bacteria containing any one of the genes (OsSecY2) belong to the protection scope of the invention.

A Primer pair for amplifying the whole length or any fragment of the gene (OsSecY2) also belongs to the protection scope of the invention, and the Primer pair is preferably Primer1/Primer2 and Primer3/Primer 4.

The primers involved in the fine mapping of the gene (see Table 1) and the InDel primers are self-designed for the needs of the experiment, and the self-designed primers also belong to the protection scope of the invention.

The invention also provides application of at least one of the gene, the protein, the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium in plant breeding.

The invention also provides application of at least one of the gene, the protein, the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium in culturing transgenic plants with normal starch synthesis.

The invention also provides a method for cultivating the transgenic plant with normal starch synthesis, which is to introduce the gene into the plant with abnormal starch synthesis to obtain the transgenic plant with normal starch synthesis.

Specifically, the gene can be introduced into a plant having an abnormal starch synthesis by the recombinant expression vector.

Any vector capable of guiding the expression of the exogenous gene in the plant is utilized to introduce the gene for coding the protein into plant cells, so that a transgenic cell line and a transgenic plant can be obtained. The expression vector carrying the gene can transform plant cells or tissues by using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, agrobacterium mediation, etc., and culture the transformed plant tissues into plants. The plant host to be transformed may be either a monocotyledonous or dicotyledonous plant, such as: tobacco, lotus roots, arabidopsis, rice, wheat, corn, cucumber, tomato, poplar, lawn grass, alfalfa and the like.

Has the advantages that:

the invention discovers, positions and clones a new coding gene OsSecY2 of plant endosperm aleurone related protein for the first time. The plant endosperm aleurone related protein influences the starch synthesis and chloroplast development process of plants. Inhibition of the expression of the protein encoding gene can result in defects in starch synthesis and chloroplast development in plant seeds, thereby allowing the cultivation of endosperm and chloroplast variant transgenic plants. The coding gene of the protein is introduced into a plant with abnormal starch synthesis, so that a plant with normal starch synthesis can be cultivated. The protein and the coding gene thereof can be applied to plant genetic improvement.

Drawings

FIG. 1 shows the plant phenotype (panel A) and the seed phenotype (panel B and panel C) of wild type Dianjianyou No.1 and mutant D138.

FIG. 2 is the scanning electron microscope observation of wild type Dianjianyou No.1 and mutant D138 seed grains.

FIG. 3 shows half-thin section observation of wild type Dianzuyou No.1 and mutant D138 in 10DAF endosperm and chloroplast observation in 3-leaf sheath.

FIG. 4 is a diagram of the fine localization and sequencing differences of the mutant gene on chromosome 5.

FIG. 5 shows T transformed with pCAMBIA1305-GFP-OsSecY2₁T for plant generation₂Grain phenotype.

FIG. 6 shows T transformed with pCAMBIA1305-GFP-OsSecY2₂Semi-thin slice of endosperm and T₁And (4) observing chloroplast of leaf sheath at the 3 rd leaf stage.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1 discovery of Rice starch Synthesis-related site and Gene encoding the same

Phenotypic analysis of Rice endosperm flour mutant D138

An endosperm floury mutant, named D138, is screened from the Dianjianyou No.1 mutant generated by MNU chemical mutagenesis.

Compared with Dianyuan you No.1, D138 is mainly characterized in that: the seed kernel is opaque (see figure 1) and has a plant leaf albino phenotype (see figure 1). This indicates that the gene mutation affects the starch synthesis, resulting in the change of the structure and properties of starch granules, and the endosperm shows great difference in appearance. Meanwhile, the mutation of the gene also influences the development of plant chloroplast, thereby generating a leaf albino phenotype.

The cross sections of the wild type and mutant mature seeds were observed by scanning electron microscopy (see fig. 2), and on the picture magnified by 200 times, the starch sheet structure of the cross section of the wild type seeds is regular and regular, while the mutants are loose. It is concluded that these alterations in the structure and arrangement of the starch granules may be the direct cause of the endosperm exhibiting the floury phenotype.

Half-thin section observations of wild-type and mutant developed 10DAF endosperm revealed that the mutant amyloplasts were larger in area and smaller in number (see FIG. 3). Chloroplasts (3 leaves) in wild type and mutant leaf sheaths were observed simultaneously, and it was found that the mutant chloroplasts had a larger area and a reduced number (see FIG. 3). It is concluded that the mutant endosperm flour phenotype is caused by the enlargement of the amyloplasts and the increase of the pores between the amyloplasts; while the leaf albino phenotype is caused by chloroplast size and number changes.

Second, map-based cloning of mutant Gene loci

1. Location of mutant genes

First, a hybrid combination F of mutant D138 and another wild type N22 was prepared₁After selfing for one generation, F is obtained₂And (4) seeds. F is to be₂Seeds are hulled, 10 extreme individuals are screened by taking phenotypic opacity and leaf whitening as standards to carry out linkage analysis, a target gene is preliminarily determined on the 5 th chromosome long arm of rice, the extreme individuals are increased to 31 individuals, and the target gene is preliminarily positioned between two markers s5-7 and s 5-32. Extreme individuals were added to 257 strains, and the target gene was finally located between the s5-14 and Fy-10 markers at a physical distance of 88kb using a common primer in the laboratory and a self-designed primer (FIG. 4). ,

the method for the SSR marker analysis is as follows:

(1) the total DNA of the selected individual plant is extracted as a template, and the specific method is as follows:

① A sample of young leaf of rice (about 0.2 g) is taken and placed in 2.0mL Eppendorf tube, a steel ball is added, the Eppendorf tube filled with the sample is frozen in liquid nitrogen for 5min, and the sample is crushed for 1min on a GENO/GRINDER 2000 type instrument.

② mu.L of extract (solution containing 100mM Tris-HCl (pH 8.0), 20mM EDTA (pH 8.0), 1.4M NaCl,0.2g/mL CTAB) was added and incubated at 65 ℃ for 30 min.

③ mu.L of 20% SDS was added, and the mixture was incubated at 65 ℃ for 10min and gently inverted and mixed up and down every two minutes.

④ Add 100. mu.L of 5M NaCl and mix gently.

⑤ adding 100 μ L10 × CTAB, warm bathing at 65 deg.C for 10min, and mixing by intermittently and slightly inverting.

⑥ mu.L chloroform was added, mixed well and centrifuged at 12000rpm for 3 min.

⑦ transfer the supernatant to a 1.5mL Eppendorf tube, add 600. mu.L isopropanol, mix well, centrifuge at 12000rpm for 5 min.

⑧ the supernatant was discarded, and the pellet was rinsed once with 70% (v/v) ethanol and dried at room temperature.

⑨ mu.L of 1 XTE (a solution of 121g of Tris in 1 liter of water adjusted to pH 8.0 with hydrochloric acid) was added to dissolve the DNA.

⑩ DNA quality was checked by 2. mu.L electrophoresis and concentration was determined by a Nano Drop spectrophotometer.

(2) Diluting the extracted DNA to about 20 ng/. mu.L, and performing PCR amplification as a template;

PCR reaction (10. mu.L): 1. mu.L of DNA (20 ng/. mu.L), 1. mu.L of upstream primer (2 pmol/. mu.L), 1. mu.L of downstream primer (2 pmol/. mu.L), 10 XBuffer (MgCl)₂free)1μL，dNTP(10mM)0.2μL，MgCl₂(25mM)0.6μL，rTaq(5U/μL)0.1μL，ddH₂O5.1. mu.L, 10. mu.L total.

PCR reaction procedure: denaturation at 94.0 deg.C for 5 min; denaturation at 94.0 deg.C for 30s, annealing at 55 deg.C for 30s, and extension at 72 deg.C for 1min, and circulating for 35 times; extending for 7min at 72 ℃; storing at 10 deg.C. The PCR reaction was performed in a LongGene A200PCR instrument.

(3) SSR-tagged PCR product detection

The amplification products were analyzed by 8% native polyacrylamide gel electrophoresis. The molecular weight of the amplified product is compared by taking 50bp DNA Ladder as a control, and silver staining is performed for color development.

The primer development process is as follows:

(1) SSR marker development

Integrating SSR markers of a public map with a rice genome sequence, and downloading BAC/PAC clone sequences near mutation sites. Searching potential SSR sequences (the repetition times are more than or equal to 6) in the clone by using SSRHUNTER (Liqiang et al, heredity, 2005, 27(5): 808-; comparing the SSRs and sequences adjacent to 400-500 bp thereof with corresponding indica rice sequences on line at NCBI through a BLAST program, and preliminarily deducing that the PCR product of the SSR primer has polymorphism between indica rice and japonica rice if the SSR repetition times of the SSRs and the sequences are different; then, SSR primers are designed by using Primer Premier 5.0 software and synthesized by Shanghai Yingjun biotechnology limited. The SSR paired primers which are designed by self are mixed in equal proportion, the polymorphism between Dianzhiyou No.1 and N22 is detected, and the polymorphism expression person is used as a molecular marker for fine positioning. The molecular markers used for fine localization are shown in table 1.

TABLE 1 molecular markers for Fine localization

Primer name	Upstream primer (5 '-3')	Downstream primer (5 '-3')
			S5-7	GAGAACAATGTGCCGTG	CAGTGGACTTTGAGGGAT
S5-8	ATCCACCTACCACCACTG	CCCCTTACTCTTCCAATG
			S5-41	GTGAACCCTTGTGTAATCGC	GCAGCCACCTGACTACTAAT
Fy-13	AGCTGGTACTAAGAATGCAC	TCCCACAAACACACACGC
			S5-14	GGGGTTTGCTTCAGGTTAG	GCTAAAGCTGGAGCTGATGA
Fy-10	AATCCGATTTAGTACGAGGC	TCCCTTCATATCAGCAAACA
			S5-15	TCACGCCACCACTTGTTG	GCAGAGATGGATGTGCTTCA
S5-20	ACCTCCTACCTCCCGTTGCT	TCCTGTGGTGGAACCTGTC
			S5-32	GCTAAGTTTGGTGGGGTCA	CTCCGACTCCATCCAAAATC
I5-9	CTGCACTGCTGAAATGGAGA	GCTGGGATATCAACCCTACG

2. Obtaining of powdery Gene

Sequencing the 88kb interval to find that the secy2 gene has a single base mutation,

primers were designed based on the published sequences as follows:

primer1：5'CGCCATGCCGCACTCACTCT3'(SEQ ID NO.4)；

primer2：5'TGGTCAACCCGCCAGCCTCT 3'(SEQ ID NO.5)。

primer1 and primer2 are used as primers, and Yunnan Jingyou No.1 developmental embryo cDNA is used as a template to carry out PCR amplification to obtain the target gene. The amplification reaction was performed on a LongGene a200PCR instrument: 3min at 94 ℃; 30s at 94 ℃, 45s at 60 ℃, 10min at 72 ℃ and 35 cycles; 5min at 72 ℃. The PCR product was recovered and purified, and then ligated to pMD18-T (TaKaRa Co., Japan) to transform E.coli DH 5. alpha. competent cells (CB 101, Tiangen, Beijing) and positive clones were selected and sequenced.

The sequence determination result shows that the fragment obtained by PCR reaction has the nucleotide sequence shown in SEQ ID NO.2 and encodes a protein consisting of 542 amino acid residues (see SEQ ID NO.3 of the sequence table). The protein shown in SEQ ID NO.3 was named OsSecY2, and the gene encoding the protein shown in SEQ ID NO.3 was named OsSecY 2.

Example 2 obtaining and identifying transgenic plants

Construction of recombinant expression vector

Taking cDNA of Dianjiyou No.1 (from Nanjing agriculture university Rice institute germplasm resource library) as a template, carrying out PCR amplification to obtain a CDS sequence of the OsSecY2 gene, wherein the PCR primer sequence is as follows:

primer3：

5'CGGAGCTAGCTCTAGAATGCCGCACTCACTCTCCCT3'(SEQ ID NO.6)；

primer4：

5'TGCTCACCATGGATCCGGCACCATATCTCCTTAGAA 3'(SEQ ID NO.7)。

the primers are positioned from the beginning of ATG to the end before TGA of the gene shown in SEQ ID NO.2, the TGA is not included, the amplification product comprises the whole coding region part of the gene, and the PCR product is recovered and purified. The PCR product was cloned into the vector pCAMBIA1305-GFP using the INFUSION recombination kit (TaKaRa, Japan). INFUSION recombination reaction system (10 μ L): PCR product 1.0. mu.L, pCAMBIA1305-GFP 6.0. mu.L, 5 Xinfusion buffer 2.0. mu.L, infusion enzymemix 1. mu.L. After brief centrifugation, the mixed system was washed with water at 50 ℃ for 15 minutes, taken out and placed on ice, and 2.5. mu.L of the reaction system was used to transform E.coli DH 5. alpha. competent cells by heat shock (Beijing Tiangen Co.; CB 101). All the transformed cells were spread evenly on LB solid medium containing 50mg/L kanamycin. After culturing at 37 ℃ for 16h, clone-positive clones were picked and sequenced. As a result of sequencing, a recombinant expression vector containing the gene shown in SEQ ID NO.2 was obtained, pCAMBIA1305-GFP containing OsSecY2 was named pCAMBIA1305-GFP-OsSecY2, and the OsSecY2 gene fragment was inserted between XbaI and BamHI cleavage sites of the vector using an INFUSION recombination kit (TaKaRa, Japan).

II, obtaining recombinant agrobacterium

The pCAMBIA1305-GFP-OsSecY2 is transformed into the Agrobacterium EHA105 strain by a freeze-thaw method (laboratory preservation) to obtain a recombinant strain, and plasmids are extracted for PCR and enzyme digestion identification. The recombinant strain identified correctly by PCR and digestion was named EH-pCAMBIA1305-GFP-OsSecY 2.

The Agrobacterium EHA105 strain was transformed with pCAMBIA1305-GFP as a control vector, and the empty vector control strain was obtained as described above.

Thirdly, obtaining of transgenic plants

The method for transforming the rice endosperm flour mutant D138 by using the EH-pCAMBIA1305-GFP-OsSecY2 and the empty vector control strain comprises the following steps:

(1) culturing EH-pCAMBIA1305-GFP-OsSecY2 (or an empty vector control strain) at 28 ℃ for 16 hours, collecting thalli, diluting the thalli into an N6 liquid culture medium (Sigma company, C1416) until the concentration is OD600 about 0.5, and obtaining a bacterial liquid;

(2) mixing and infecting the D138 rice mature embryo embryonic callus cultured for one month and the bacterial liquid obtained in the step (1) for 30min, sucking the bacterial liquid through filter paper, transferring the bacterial liquid into a co-culture medium (N6 solid co-culture medium, Sigma company), and co-culturing for 3 days at 24 ℃;

(3) inoculating the callus of step (2) on N6 solid screening medium containing 100mg/L hygromycin for the first screening (16 days);

(4) selecting healthy callus, transferring the healthy callus to an N6 solid screening culture medium containing 100mg/L hygromycin for secondary screening, and subculturing once every 15 days;

(5) selecting healthy callus, transferring the healthy callus to an N6 solid screening culture medium containing 50mg/L hygromycin for third screening, and subculturing once every 15 days;

(6) selecting the resistant callus to transfer to a differentiation culture medium for differentiation; obtaining T differentiated into seedlings₀And (5) generating positive plants.

Fourth, identification of transgenic plants

1. PCR molecular characterization

The T obtained in the third step₀Genome DNA is extracted from the generation plant, and amplification is carried out by using the genome DNA as a template and using Primer3 and Primer4 as primers.

And (3) PCR reaction system: 2. mu.L of DNA (20 ng/. mu.L), 2. mu.L of Primer3(10 pmoL/. mu.L), 2. mu.L of Primer4(10 pmoL/. mu.L), 10 XBuffer (MgCl)₂free)2μL，dNTP(10mM)0.4μL，MgCl₂(25mM)1.2μL，rTaq(5U/μL)0.4μL，ddH₂O10. mu.L, total volume 20. mu.L. The amplification reaction was performed on a LongGeneA200PCR instrument with the PCR program: 3min at 94 ℃; 94 ℃ for 30s, 55 ℃ (different primers, adjusted) for 45s, 72 ℃ for 2min, 35 cycles; 5min at 72 ℃.

The PCR product is detected by 1% agarose electrophoresis, a target band with the size of SEQ ID NO.2 can be detected in a positive plant, and the target band cannot be detected in a negative plant.

2. Phenotypic identification

Respectively combine T with₀Transgenic pCAMBIA 1305-GFP-Oscyscy 2 positive plant, T₀The generation-to-empty vector control plant, the mutant D138 and the Dianjiyou No.1 are planted in a transgenic field of the soil bridge rice breeding base of Nanjing agriculture university. After the seeds were matured, the seeds of each material were harvested and clear seeds were observed in the seeds of the pCAMBIA1305-GFP-OsSecY2 plant (FIG. 5), and further observation of the half-thin section and the leaf sheath of rice 3 showed that the morphology and number of starch granules and the morphology and number of leaf sheath chloroplasts of the D138 seeds transferred into pCAMBIA1305-GFP-OsSecY2 were restored to normal levels (FIG. 6). Thus demonstrating that the mutant phenotype in D138 is caused by a mutation in osecy 2. pCAMBIA1305-GFP-OsSecY2 can restore the starch synthesis of strain D138 to normal levels.

Sequence listing

<110> Nanjing university of agriculture

<120> rice endosperm aleurone related gene OsSecY2 and coding protein and application thereof

<160>7

<170>SIPOSequenceListing 1.0

<210>1

<211>7360

<212>DNA

<213> Oryza sativa Rice (Oryza sativa. Dianjingyou1)

<400>1

cggattttgc aatcccatcg gccggcagag cgcgacggcg gcagctcggc caccgccgcg 60

gcatcgccgc catgccgcac tcactctccc tcctgctcgc gcccagccgc gcgctctccc 120

tctcctcccc accgctccgc ctcgccccaa cgcacccacc acttcgcctg caccacgacg 180

gcggccacct cctcgtgggc acgacgaggc ggcaggctcc ctcgcctcgc cgccgccgtc 240

tccatgccgc cagggcttcc gcgccgtccg ccgccgcggc gtcccccgta gggcctgcgg 300

gcgagggtgg cgaggtgggg ggcagggcga ggaaggcggc ggggtaccgg aacaggttcc 360

tggacctggc gcggctgggg gccgtggcgg agagcgcggc ggaggcgctc ttccgcagcg 420

agattcgccg gcggctggcc gtcacggccg tgctcatcct gctcagccgc gtcggctact 480

tcgtcccgct tcccgggttc gaccgacggc tcatccccga ttcctacctc agctttgcac 540

cccttcctgc aggtctcttc cctttacagt cctccgagaa tattagttcg tgctagctgt 600

agtgtatgaa agtgcgcggt cgtttgatca ttttgatggc cttggtgaac tgtttgaaga 660

atgtgcggtg ctctttcggt tgtgcagatg acctcggtga tttttcatcc gaattgaagc 720

tgtcattttt ccagctcgga atcagtcatc agatttcagc atctattgtc atgcaggttc 780

tattttatcc cttgtttggt cctgctcttt tgttttccaa tggcaacgta tgtctcaagt 840

agcagcaatc cgctcaataa cctgttgcaa actgagcctt agttctttta ttctagagtg 900

tgttcgtttt tgctctttaa gagcgttttg catcagttgc ttctaacgtc gtactaaagc 960

ttttctcagt atttggtgat agtaacaaat tgtgattttt aggttctctg tcatgttctt 1020

ccatcacttg aaaaactacg aaaggaaggg ttagatggac atgagaagat caaaggctat 1080

atgtgagtcg agttctcttt cttgaactga attatttgaa aaggggatct tttattttct 1140

ttctcaacat tcatctactt ttaaatttta agtctggtta ttttgatgtt ctagttggtg 1200

gctgtcgctg ggttttgcac ttgtggcggc ttttacagtg tcatgctact cactgcaata 1260

ttctatatat gctgcaagtt acaggtgaca gtatgttagc tctatatgga gaaaaagctt 1320

tactaataat aatttgtttg gactggaagg atgctcatca gtatttcttt acctatacct 1380

ttttttaatc tttcagagtt aagcatgtaa tgataacaag ccttttcctt gttcttggtg 1440

caatgacaat gacatggatc tgtgacacta tatcggaatc tggatttggt aatactctat 1500

atcatgtata tcggaatctt ggatttggta ttctagcatc atctctgcat gctttgatta 1560

tactgtgtta aagctgtatt caatatggca tattatgcca tatccaaact ttaagactaa 1620

actcagctgt tggacatgaa aacatgcatg ctggcatgat ttctttacca tatatctcta 1680

tgattgcgat tcacgtaaat gatcttgtaa agtaaaagca taaaatgatg gttgttatcc 1740

atttagtgca tattttcttg tacttggttg gaacttttgt tcttatattt tcttctatgt 1800

ctttgcatcc aggacatggc tcttccttga ttatctgtgt gggaatattg actggttata 1860

cagacacact ccacaagatg ttaactcaat tttcaggtaa tctttcacga cactaattgc 1920

aacttttcaa ctgctaagtt ttactccttt gagttggatg cgaccagtaa attctaatga 1980

taatgatgtg tatgtactga atttattatc cttgcatctt cttatatctc tttgcggaag 2040

ttttgtggta ggtggagtat ttcaaggcac ttttccaaac tgcattgtca tctatgatga 2100

tcttatactt tgattttttt ttatctgcct gtttggtgcc tcacattgtg ttgccaacca 2160

aaactcattg ttggattgta actcctttaa aggattgaat ttcattacag cttggcataa 2220

ctgttgctca aataaataag aagcaacatg gtctgagtag aatggataat tccattatgc 2280

cactcaaatt ttgccaaacc agggatgtgc tgttatcgta caagtacaat actttaccct 2340

tttatttcat tgcagacaaa attccatcag tcaaatcatg cccaggatgt gcaaagacta 2400

ttttacccct tctctatcag tttcctctgt tttctattgc acttttccat agctgactgg 2460

agagaacgac ctcatctatc ctccaatgac caatggctag tttagagata tgttagtcat 2520

tattcagaga aattaaaaaa tgagagcaaa ggggtaaaat ttgatcaaca agggtagaaa 2580

agggtaatgt tttggtacag tacagtcata tctggagttg gttttcaatg ggatatctag 2640

gctcagacat attgttaatg atatatatgg aattatccct tttcatcttc tattaaatca 2700

ttacaggatg gtgaaatctt attttgcact taaaaatctt ggatggttgt gtctgttata 2760

acctcgtcag tagtgttatc ttagctgatc tacctgagct ccatttctct agctgagcat 2820

aacataatat gcatcgtgca atgttaaggt ttgtttgcac gatcatttgg gcactagcca 2880

gttcatgaag atataatgtt gacatttttg tcagtaacgt gtatatacga actagaattt 2940

taagtcttaa aacacttcac cagtttctac aatacaataa cttgtttacc aagatggatc 3000

agataaacat ttggagaaaa gaaaccgaaa atgtaactcc taatttcttt cggtcatata 3060

cagtatgtac acagacagct gatatgctga gacttctagt gttattttct tttatttgat 3120

atgcctttcg aaacaggaaa ttggtacagc tgttggccct acatcttggg gatagctggg 3180

acttttattt tggttaccat gggagcagta ctggtgactg aagggtgtag gaagataaag 3240

cttcagtact atggatttaa attggcttct ggtgcaaggt aatgataaaa tcaactctac 3300

actcattttt attatcatgt acttttgaat gctatttttg catggagcac ataagaacat 3360

tatccacaca agctgcacat aagaaccttt catgttgccc aaatgcccaa acagaatata 3420

ctttatcaca ttaactgcaa accttttgtt tgaaacatct atttatgtta tttgaaaact 3480

ccagtttgtt atattctgct taagttctaa tttctaaaca atttaacagc acccttctac 3540

cggtattttt agctgcagcc tggcatggtt atatggctca atgatatggt tggatgtgga 3600

ttgacctagc aaaggctact ccatcatcac ctatttgtgc taatactacg ctttatggtt 3660

ttctcaatcc ttttacttat cttatatttg atcattcttt tgtaggagtg agagctcccc 3720

agttacagag gtagagccat atatcccttt taacataaat ccaactggga tgcagccttt 3780

gcttaccacc tcatacttat tagcttttcc aagcattatg gccaggtaat tcattgtgtt 3840

tattttttgg gtatgttttg gttaaaattt ccattctgat tttggaattt ctccagcatt 3900

tttggtacgc aattttggga aagtttgaag gaaacgttga atccaaagac ttcagttggt 3960

ggtggtccat gggtttatta tttgacatat gcatttcttg tcttcgtctt caatattttt 4020

gacattgtaa gttactttct catcttaata actgtctaac tattttattt ttcaggatac 4080

agtcattata ccaatattcc ttctattatc ttgtggtgat gttctcttat agttgctcgt 4140

gaccttgttt tggtgcctgc ggaacctggc tgaccccctt agagaatgca ttgtttaaaa 4200

aattccgtaa tgaattgtgg atgtagcaca cagagtcctt taaacctaca aaaaaaaaat 4260

tcaaattgtc tagatgttga gatacagaaa ggacaagcat acatcacggt attgttcacc 4320

atgaagtagc agtagccgta agacttttcc ttttgtatct tgacatgtag gaaaaaactt 4380

gagttttata tttttcttta cacagagcta ctcatgctac atccatgaat cattttggaa 4440

ttttttaatc atcgcttatg ttgattcatc agattttttt atgggggaca acgaatcccc 4500

tggggaccaa caactatgca taatctaact gttgaaccta gtatcacata caaaactttt 4560

cttaacaatg ctcttgtaga tcttcaaaaa catgacagat atttgtgatg taattttgat 4620

atcagaactc atgttctcaa cattttcagg aagataatat tcttttattt tcttttcatg 4680

attttatttg cacatgcctt atcaaatata gcttaatcta cacattattc actgcaggca 4740

aacttgccaa aagagatatc tgactacctg aataaaatga gtgctagagt accgaagata 4800

aagcctggaa gagcaacagt agagtatctt acaaaaatac aaacatctac acgtttctgg 4860

ggtaggtggc cttcacgaga acttgtagca tggccaaact ttcctctgtt ttgctttatg 4920

ttttttctta tttttaaaaa gtgtttcttt ccttgaattc cagggggtat attgctgagc 4980

ttgttggcga cttcctcttt attacttgac cgatatctca ggcagataaa tgagggattt 5040

tctataggtt tcacgtcggt gttgattatt gtgagtgcat ctcaattata ttcttcatta 5100

tcatttgtca ccatgaagaa gattgatgtt gaattgcatt ttcaatcata ttcttagtta 5160

actatttgcc acttttaaga tgtggcaatt aaggatttgc cactcgcagt ctatgacatc 5220

tgggtccagt ggcaaatcct taagtgtcac ttgtaataat ggcaaatagt taattatctc 5280

ttttcatggt gctatttttt ccaagtattg gcctttttac atgtgttttc tctgaatatc 5340

ttctaggtgc ctgaatctga aattctaaat gaacttaaac ttggtcaagt gactagggat 5400

tttagctgat tatgcacact tccaatgttg accttctgta ttttgttttt tcaatgtttc 5460

tgccttttga tcttcttaaa aatattgata aaatccaaat ggtgtattag atgatttagg 5520

gcttaaggcc tttcgctctg tcaagttaag ccctcctagc tgtccccaca atgcattcct 5580

gctccccaca ggcccacacc cataaaaaat gccattagaa tctctgtttg atgtactatt 5640

tgttgtactt atggaggaag gctgggtgat tttgaccttt gagagatgaa tattatgtaa 5700

ttaaatatta tgtttatgca gtttagcaca ttattgcaag ttgttccata atgcagagcc 5760

cactgctatg cataatttat aaatctagga tatatattta gaaagtaaaa gcacacaatt 5820

tttttattga aaagaacaaa acaactgaag attttgtttc cttaaaatct taaatgaaaa 5880

gcttgagcct atgcagtata ggaatcattt ccagccgtaa tcatattagc agtgaacttg 5940

gcaaatgtgt tagttctttg ccactaaata attaatatgc ttacctgcct atagatagtt 6000

accgtaccga tgtgttcttc catccacaat ttcattttac atggatagct caaagtttgt 6060

gttcatttcc ctctacattg cattttcttt ttattatttt tgtttaaaaa caaaaatgca 6120

tatcaactat aaagaattct attagtgtgc tgcttatttt ctgctgctgc attaggtgtt 6180

ctagcccttt tctaccttca tttacttatg gacattaaat attttttttc tttgatcaaa 6240

tgggacatgt gcgtgatgaa catgtgtttg gataatgaaa ctatatgaag atgattgttc 6300

aggtgggctc aatcatcgag ctgagaaggt cttatcaagc atacaatgtg atgccagcac 6360

taagcaaagt tctaaggaga tatggtgcct gaggttatgt acgccacata tttggttatg 6420

atggtatcat ccacaaggta cttcttcctt tgctgctagt ctttgttaat attaagctaa 6480

gcctgccttt ttcccctttg ttttagaaga agagggccat ttcaaaaaaa cttcagagtt 6540

tacaggctta cagccgacta gatgctgtga ccttgattat tgtcaacaac ttgcagtacg 6600

gtgcagtaag aagagttcta taacccagac caatattgtg cttgggttgg gatgagatta 6660

gtatagtttg atatcaatct tctgtggcat aaactggaac tgaagaacca aggaggatat 6720

tttgttactc atggcacagc aactatgaag agcgtgacct acgaggagct gtgtaattgt 6780

gttgtctttg gccacttctg gaatggttga cggcttgatg caatgcgaac gaaaatttgg 6840

atccaatctc acccagctgt ataattttct gaagatcaga ttgccaaatt gctggctagc 6900

tgcatcacgc ttagtaaatg gtgcggtcag aagtcagaac ctgaagtctg caaaattgct 6960

ggttttgggt tgattgttgg aacgttctac atcagaggct ggcgggttga ccatctggac 7020

ttatccgtgt agcacaatga agatcagctg tcgtgcgttt gctgaccagt agtatctctc 7080

tgtaggctta tgtttttgta aatatatggc ttattaacag tagaacttcc actcctgtcc 7140

tgacttctca aaggctgttc tgttcacttt tccaaaaagc agcttcatat ttacaaaaga 7200

taaagaagca catttttctt ttattgacaa agatatagct gagctgcatg ctgaagaaac 7260

agacgtatca tacaggtcga gcctccaatg tgacattatt gcgctcaatg gcgcgttgta 7320

ccattatcta ctacagtaca tcagtactaa tgtctttcaa 7360

<210>2

<211>1629

<212>DNA

<213> Oryza sativa Rice (Oryza sativa. Dianjingyou1)

<400>2

atgccgcact cactctccct cctgctcgcg cccagccgcg cgctctccct ctcctcccca 60

ccgctccgcc tcgccccaac gcacccacca cttcgcctgc accacgacgg cggccacctc 120

ctcgtgggca cgacgaggcg gcaggctccc tcgcctcgcc gccgccgtct ccatgccgcc 180

agggcttccg cgccgtccgc cgccgcggcg tcccccgtag ggcctgcggg cgagggtggc 240

gaggtggggg gcagggcgag gaaggcggcg gggtaccgga acaggttcct ggacctggcg 300

cggctggggg ccgtggcgga gagcgcggcg gaggcgctct tccgcagcga gattcgccgg 360

cggctggccg tcacggccgt gctcatcctg ctcagccgcg tcggctactt cgtcccgctt 420

cccgggttcg accgacggct catccccgat tcctacctca gctttgcacc ccttcctgca 480

gatgacctcg gtgatttttc atccgaattg aagctgtcat ttttccagct cggaatcagt 540

catcagattt cagcatctat tgtcatgcag gttctctgtc atgttcttcc atcacttgaa 600

aaactacgaa aggaagggtt agatggacat gagaagatca aaggctatat ttggtggctg 660

tcgctgggtt ttgcacttgt ggcggctttt acagtgtcat gctactcact gcaatattct 720

atatatgctg caagttacag agttaagcat gtaatgataa caagcctttt ccttgttctt 780

ggtgcaatga caatgacatg gatctgtgac actatatcgg aatctggatt tggacatggc 840

tcttccttga ttatctgtgt gggaatattg actggttata cagacacact ccacaagatg 900

ttaactcaat tttcaggaaa ttggtacagc tgttggccct acatcttggg gatagctggg 960

acttttattt tggttaccat gggagcagta ctggtgactg aagggtgtag gaagataaag 1020

cttcagtact atggatttaa attggcttct ggtgcaagga gtgagagctc cccagttaca 1080

gaggtagagc catatatccc ttttaacata aatccaactg ggatgcagcc tttgcttacc 1140

acctcatact tattagcttt tccaagcatt atggccagca tttttggtac gcaattttgg 1200

gaaagtttga aggaaacgtt gaatccaaag acttcagttg gtggtggtcc atgggtttat 1260

tatttgacat atgcatttct tgtcttcgtc ttcaatattt ttgacattgc aaacttgcca 1320

aaagagatat ctgactacct gaataaaatg agtgctagag taccgaagat aaagcctgga 1380

agagcaacag tagagtatct tacaaaaata caaacatcta cacgtttctg ggggggtata 1440

ttgctgagct tgttggcgac ttcctcttta ttacttgacc gatatctcag gcagataaat 1500

gagggatttt ctataggttt cacgtcggtg ttgattattg tgggctcaat catcgagctg 1560

agaaggtctt atcaagcata caatgtgatg ccagcactaa gcaaagttct aaggagatat 1620

ggtgcctga 1629

<210>3

<211>542

<212>PRT

<213> Oryza sativa Rice (Oryza sativa. Dianjingyou1)

<400>3

Met Pro His Ser Leu Ser Leu Leu Leu Ala Pro Ser Arg Ala Leu Ser

1 5 10 15

Leu Ser Ser Pro Pro Leu Arg Leu Ala Pro Thr His Pro Pro Leu Arg

20 25 30

Leu His His Asp Gly Gly His Leu Leu Val Gly Thr Thr Arg Arg Gln

35 40 45

Ala Pro Ser Pro Arg Arg Arg Arg Leu His Ala Ala Arg Ala Ser Ala

50 55 60

Pro Ser Ala Ala Ala Ala Ser Pro Val Gly Pro Ala Gly Glu Gly Gly

65 70 75 80

Glu Val Gly Gly Arg Ala Arg Lys Ala Ala Gly Tyr Arg Asn Arg Phe

85 90 95

Leu Asp Leu Ala Arg Leu Gly Ala Val Ala Glu Ser Ala Ala Glu Ala

100 105 110

Leu Phe Arg Ser Glu Ile Arg Arg Arg Leu Ala Val Thr Ala Val Leu

115 120 125

Ile Leu Leu Ser Arg Val Gly Tyr Phe Val Pro Leu Pro Gly Phe Asp

130 135 140

Arg Arg Leu Ile Pro Asp Ser Tyr Leu Ser Phe Ala Pro Leu Pro Ala

145 150 155 160

Asp Asp Leu Gly Asp Phe Ser Ser Glu Leu Lys Leu Ser Phe Phe Gln

165 170 175

Leu Gly Ile Ser His Gln Ile Ser Ala Ser Ile Val Met Gln Val Leu

180 185 190

Cys His Val Leu Pro Ser Leu Glu Lys Leu Arg Lys Glu Gly Leu Asp

195 200 205

Gly His Glu Lys Ile Lys Gly Tyr Ile Trp Trp Leu Ser Leu Gly Phe

210 215 220

Ala Leu Val Ala Ala Phe Thr Val Ser Cys Tyr Ser Leu Gln Tyr Ser

225 230 235 240

Ile Tyr Ala Ala Ser Tyr Arg Val Lys His Val Met Ile Thr Ser Leu

245 250 255

Phe Leu Val Leu Gly Ala Met Thr Met Thr Trp Ile Cys Asp Thr Ile

260 265 270

Ser Glu Ser Gly Phe Gly His Gly Ser Ser Leu Ile Ile Cys Val Gly

275 280 285

Ile Leu Thr Gly Tyr Thr Asp Thr Leu His Lys Met Leu Thr Gln Phe

290 295 300

Ser Gly Asn Trp Tyr Ser Cys Trp Pro Tyr Ile Leu Gly Ile Ala Gly

305 310 315 320

Thr Phe Ile Leu Val Thr Met Gly Ala Val Leu Val Thr Glu Gly Cys

325 330 335

Arg Lys Ile Lys Leu Gln Tyr Tyr Gly Phe Lys Leu Ala Ser Gly Ala

340 345 350

Arg Ser Glu Ser Ser Pro Val Thr Glu Val Glu Pro Tyr Ile Pro Phe

355 360 365

Asn Ile Asn Pro Thr Gly Met Gln Pro Leu Leu Thr Thr Ser Tyr Leu

370 375 380

Leu Ala Phe Pro Ser Ile Met Ala Ser Ile Phe Gly Thr Gln Phe Trp

385 390 395 400

Glu Ser Leu Lys Glu Thr Leu Asn Pro Lys Thr Ser Val Gly Gly Gly

405 410 415

Pro Trp Val Tyr Tyr Leu Thr Tyr Ala Phe Leu Val Phe Val Phe Asn

420 425 430

Ile Phe Asp Ile Ala Asn Leu Pro Lys Glu Ile Ser Asp Tyr Leu Asn

435 440 445

Lys Met Ser Ala Arg Val Pro Lys Ile Lys Pro Gly Arg Ala Thr Val

450 455 460

Glu Tyr Leu Thr Lys Ile Gln Thr Ser Thr Arg Phe Trp Gly Gly Ile

465 470 475 480

Leu Leu Ser Leu Leu Ala Thr Ser Ser Leu Leu Leu Asp Arg Tyr Leu

485 490 495

Arg Gln Ile Asn Glu Gly Phe Ser Ile Gly Phe Thr Ser Val Leu Ile

500 505 510

Ile Val Gly Ser Ile Ile Glu Leu Arg Arg Ser Tyr Gln Ala Tyr Asn

515 520 525

Val Met Pro Ala Leu Ser Lys Val Leu Arg Arg Tyr Gly Ala

530 535 540

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

cgccatgccg cactcactct 20

<210>5

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

tggtcaaccc gccagcctct 20

<210>6

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

cggagctagc tctagaatgc cgcactcact ctccct 36

<210>7

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

tgctcaccat ggatccggca ccatatctcc ttagaa 36

Claims (2)

1, a gene shown as SEQ ID NO.1 or SEQ ID NO.2, a protein shown as SEQ ID NO.3, a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the gene shown as SEQ ID NO.1 or SEQ ID NO.2, and application of the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium in cultivation of rice with normal seed starch synthesis, wherein the rice has the defect of the gene shown as SEQ ID NO. 2.

2. A method for cultivating transgenic plants with normal seed starch synthesis is to introduce genes shown in SEQ ID NO.1 or SEQ ID NO.2 into starch synthesis abnormal rice caused by mutation of the genes shown in SEQ ID NO.2 to obtain transgenic rice with normal seed starch synthesis.

Images