CN106754967B - Rice grain type gene OsLG1 and encoding protein and application thereof - Google Patents

Abstract

The invention discloses a rice grain type gene OsLG1 and a coding protein and application thereof, particularly relates to separation, cloning, functional verification and application, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the cloned gene (OsLG1) is shown as SEQ ID NO: 1, and the amino acid sequence is shown as SEQ ID NO: 3, respectively. According to the invention, the rice seed grain type gene (OsLG1) is cloned and identified, the expression analysis of the gene is carried out, the function of the gene is verified, and the over-expression OsLG1 is found to increase the length and grain weight of rice seeds to a certain extent, so that the gene plays a certain role in breeding high-yield rice varieties.

Description

Rice grain type gene OsLG1 and encoding protein and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a rice grain development related gene OsLG1, and a coding protein and application thereof.

Background

Rice (Oryza sativa L.) is one of the most important food crops in the world. With the reduction of the cultivated land area and the rapid increase of the world population, the improvement of the yield of the rice has very important significance for solving the global food safety crisis in the future. The rice yield is determined by the number of ears per plant, the number of grains per ear and the grain weight. When the number of grains per plant per spike and the number of grains per spike reach a better level, the grain weight becomes a target character for further improving the yield.

Many genes and QTLs involved in regulating rice grain type development have been reported. GW2 is a QTL that controls grain width. GW2 encodes an E3 ubiquitin ligase, whose target protein is degraded by proteasomes, thereby negatively regulating cell division. After the function of GW2 in rice is lost, ubiquitin mark can not be transferred to target protein, so that the target protein which should be degraded can not be identified specifically, and then the division of glumous coat cells is activated, thereby increasing the width of glumous coat. On the other hand, the filling rate is improved, the size of endosperm is increased, and finally the width, the grain weight and the yield of the rice husk are increased. The QTL GW8 for controlling the width of rice grains can control the shape, size and quality of rice grains by influencing the width of rice grains. Near-isogenic line constructed by rice variety Basmati385 (donor parent) and HJX74 (recurrent parent)(NIL) finally GW8 was located in the interval of 7.5Kb for chromosome 8, in which only one ORF, LOC _ Os08g41940, was present. The transgenic result shows that the deletion of 10-bp of the gene promoter region is the reason for narrowing Basmati385 grains, and a yeast system is further utilized to verify that the transcription activation structural domain is positioned at the N end of the gene. By researching the interaction of GW8 and QTL GS3 for controlling grain length and combining a QTL polymerization method, a new rice variety Huabiao 1 with excellent quality and normal yield is created. The comparison of GW8 gene sequences of 115 different rice varieties shows that two bases are inserted into the combination of miRNA156 of a rice variety Amol from IRAN, and the mutated chromosome fragment is introduced into NIL to construct a new NIL, NIL-GW8^Amol. The pedigree has good quality and the yield is similar to HJX74, thereby creating a new pedigree with potential utilization value in breeding, NIL-gw8^Amol. GW5 is also a QTL that controls grain width. GW5 encodes a 144 amino acid nuclear localization protein comprising a nuclear localization signal and an arginine-rich region. Interaction between GW5 and polyubiquitin was confirmed by yeast two-hybrid experiments, indicating that GW5 may regulate grain width and grain weight through ubiquitin proteasome pathway. Therefore GW5 may have a similar effect as GW 2. Researchers screen near 7000 portions of rice germplasm resources, find a super large-grain variety N411, and cross-breed the N411 with N643 to construct F₂In the population, a QTL qGL3(OsPPKL1) for controlling the grain length is found through QTL identification, the QTL qGL3 is further positioned in a 46.6-Kb interval of a third chromosome in a fine positioning mode, and the gene is determined to be OsPPKL1 through sequencing and transgenic analysis. The substitution of two bases in the coding region of the gene results in an amino acid change. The gene has two functional domains of Kelch and PP2A, and the variation of Kelch domain is proved by transgenosis to be the reason for enlarging seeds. By gene sequencing of 94 rice germplasm resources, the variation of Kelch domain in N411 is found to be specific, which indicates that the gene is a rare gene for positively regulating grain size in rice. Through Blast, two alleles of OsPPKL1, OsPPKL2 and OsPPKL3, transgenes are found in riceAs a result, the OsPPKL2 is a positive regulator of cell elongation and cell division, and the OsPPKL1/OsPPKL2 is a negative regulator.

Therefore, the discovery and cloning of a new related gene for regulating and controlling the grain type development of rice can help us to improve the rice yield and relieve the grain crisis by means of genetic engineering.

Disclosure of Invention

The invention aims to provide a nucleotide sequence of a rice grain size related gene OsLG 1. The nucleotide sequence is shown in SEQ ID NO.1 and comprises 4258 nucleotides.

The second object of the invention also provides a protein sequence coded by the rice grain size gene OsLG1, wherein the amino acid sequence of the protein sequence is shown in SEQ ID NO.3 and contains 281 amino acids.

The coding gene of the protein is preferably the DNA molecule as described in 1) or 2) or 3) or 4) below:

1) DNA molecule shown in SEQ ID NO. 1;

2) DNA molecule shown in SEQ ID NO. 2;

3) a DNA molecule which hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes said protein;

4) DNA molecule which has more than 90% homology with the DNA sequence limited by 1) or 2) or 3) and codes the plant seed grain size related protein.

A recombinant expression vector containing any one of the genes OsLG1 also belongs to the protection scope of the invention.

The recombinant expression vector containing the gene can be constructed by using the existing plant expression vector. The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal can direct polyadenylation to the 3 'end of the mRNA precursor, and untranslated regions transcribed from the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (e.g., nopalin synthase Nos), plant genes (e.g., soybean storage protein genes) all have similar functions.

When the gene is used for constructing a recombinant plant expression vector, any enhanced promoter or constitutive promoter can be added in front of transcription initiation nucleotide, such as cauliflower mosaic virus (CAMV)35S promoter and maize Ubiquitin promoter (Ubiquitin), and the enhanced promoter or constitutive promoter can be used independently or combined with other plant promoters; in addition, when the gene of the present invention is used to construct plant expression vectors, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and screening of transgenic plant cells or plants, plant expression vectors to be used may be processed, for example, by adding a gene encoding an enzyme or a luminescent compound which can produce a color change (GUS gene, luciferase gene, etc.), an antibiotic marker having resistance (gentamicin marker, kanamycin marker, etc.), or a chemical-resistant marker gene (e.g., herbicide-resistant gene), etc., which can be expressed in plants. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

The recombinant over-expression vector can be a recombinant plasmid obtained by inserting the gene (OsLG1) into a recombination site of a double-restriction vector pCAMBIA1390 with restriction enzymes KpnI and SpeI. pCAMBIA1390 containing OsLG1 was named pCAMBIA1390-OsLG 1. An expression cassette and a recombinant bacterium containing any one of the genes (OsLG1) belong to the protection scope of the invention.

The primer pair for amplifying the full length or any fragment of the gene (OsLG1) and verifying the T-DNA insertion site also belongs to the protection scope of the invention, and the primer pair is preferably any one pair of POE1/POE2, P1/P2, P1/P3 or PC1/PC 2; wherein, the sequence of POE1 is shown in SEQ ID NO.4, the sequence of POE2 is shown in SEQ ID NO.5, the sequence of P1 is shown in SEQ ID NO.6, the sequence of P2 is shown in SEQ ID NO.7, the sequence of P3 is shown in SEQ ID NO.8, the sequence of PC1 is shown in SEQ ID NO.9, and the sequence of PC2 is shown in SEQ ID NO. 10.

Has the advantages that:

the gene related to the size of the rice seeds influences the shape, size and weight of the rice seeds. Over-expression of the locus gene can cause seed grains to be lengthened and grain weight to be increased. The locus and the coding gene thereof can be applied to genetic improvement of plants so as to obtain transgenic rice plants with longer grains and increased grain weight.

Drawings

FIG. 1 shows seed size phenotype analysis and data statistics of parent Dongjin and Dongjin background T-DNA insertion mutant T250.

Panel a un Hulled represents un-shelled seeds and Hulled represents shelled seeds. The scale in the figure is 5 mm.

B, C, D, E are histograms of statistical analysis of the data measurements of Grain length (Grain length), Grain width (Grain width), Grain thickness (Grain thickness) and thousand seed weight (1,000-Grain weight) of the unhulled seeds. mm, length in millimeters, g, weight in grams.

G, H, I, J are histograms of statistical analysis of data measurements of Grain length (Grain length), Grain width (Grain width), Grain thickness (Grain thickness) and thousand seed weight (1,000-Grain weight) of the de-shelled seeds. mm, length in millimeters, g, weight in grams.

FIG. 2 is a verification diagram of the position of T-DNA insertion.

Panel A is a schematic drawing showing the position of the T-DNA inserted gene (OsLG1) on the chromosome and the position of the T-DNA insertion site in the DNA structure of the gene (OsLG 1).

Panel B is an insertion site verification electropherogram.

FIG. 3 is a plasmid map of over-expression vector pCAMBIA 1390.

FIG. 4 is a seed size phenotype analysis of transgenic over-expressed plants. Dongjin is the parent, T250 is a Dongjin background T-DNA insertion mutant, and OE-3, OE-5 and OE-12 are seeds harvested from three different families of plants over-expressing the gene (OsLG 1). Unhuled seeds represent Unhulled seeds and Hulled seeds represent dehulled seeds. The scale in the figure is 5 mm.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1 discovery of grain size control gene OsLG1 of rice and coding gene thereof

Screening of rice grain size-related mutants

Through identifying the T-DNA insertion mutant of nearly 500 parts of rice variety Dongjin, we obtained a plurality of rice seed size-changing mutants. The material with the number of T250 is selected for further research, namely the rice grain size gene OsLG1 mutant material protected in the patent.

As can be seen from graph a in fig. 1, the seeds of mutant T250 were significantly longer compared to the wild type Dongjin. Further statistical analysis shows that the grain length, the grain width and the grain thickness of the mutant are increased to some extent compared with the wild type, particularly the grain length (B and G graphs in figure 1) is obviously different, and the thousand kernel weight is also obviously increased (E and J graphs in figure 1).

Second, the T-DNA insertion site verification of rice grain size gene OsLG1

According to the information provided by the relevant database, the gene inserted by the T-DNA vector in the mutant T250 is located at the second chromosome end of rice (FIG. 2A), namely the gene OsLG1 described in the patent. The T-DNA vector was inserted into the start of the fifth exon of OsLG1 (FIG. 2A).

In order to verify whether the T-DNA insertion exists in the mutant T250, three primers P1(SEQ ID NO.6), P2(SEQ ID NO.7) and P3(SEQ ID NO.8) were designed according to flanking sequence information provided by a relevant database and DNA sequence information (SEQ ID NO.1) of the gene OsLG1 near the T-DNA insertion site, and through primer combinations P1+ P2 and P1+ P3, DNA of a wild type Dongjin and mutant T250 were used as templates respectively, PCR amplification was performed, and electrophoresis was performed, and as a result, as shown in FIG. 2B, it was confirmed that the T-DNA insertion exists in the mutant T250 and is consistent with information provided by the database.

The specific method of the above analysis process is as follows:

(1) the total DNA of the wild type Dongjin and the mutant T250 is extracted as a template, and the specific method is as follows:

① A sample of young leaf of rice about 0.2g is taken and put in 2.0ml Eppendorf tube, a steel ball is put in the tube, the Eppendorf tube filled with the sample is frozen in liquid nitrogen for 5min, and the sample is crushed for 1min on a model 2000 GENO/GRINDER instrument.

② mu.l of extract (containing 100mM Tris-HCl (pH 8.0), 20mM EDTA (pH 8.0), 1.4 mM NaCl,0.2g/ml CTAB) was added, vortexed vigorously on a vortexer, and mixed in an ice bath for 30 min.

③ mu.l of 20% SDS was added, and the mixture was incubated at 65 ℃ for 10min and gently turned upside down and mixed every two minutes.

④ mu.l of 5M NaCl was added and mixed gently.

⑤ adding 100 μ l 10 × CTAB, warm bathing at 65 deg.C for 10min, and mixing by intermittently and slightly inverting.

⑥ mu.l chloroform was added, mixed well and centrifuged at 12000rpm for 3 min.

⑦ transfer the supernatant to a 1.5mL Eppendorf tube, add 600. mu.L isopropanol, mix well, centrifuge at 12000rpm for 5 min.

⑧ the supernatant was discarded, and the pellet was rinsed once with 70% (v/v) ethanol and dried at room temperature.

⑨ mu.l of 1 XTE (a solution of 121 g of Tris in 1 l of water adjusted to pH 8.0 with hydrochloric acid) was added to dissolve the DNA.

⑩ DNA quality was checked by taking 2. mu.l of the electrophoresis and determining the concentration with a DU800 spectrophotometer (Beckman instruments Inc.U.S.A.).

(2) Diluting the extracted DNA to about 20ng/ul, and performing PCR amplification as a template;

and (3) PCR reaction system: DNA (20ng/ul)2ul, primer P1(10pmol/ul)2ul, primer P2(10pmol/ul)2ul, primer P3(10pmol/ul)2ul, 10xBuffer (MgCl)₂free)2ul，dNTP(10mM)0.4ul，MgCl₂(25mM)1.2ul，rTaq(5u/ul)0.4ul，ddH₂O10 ul, total volume 20 ul.

PCR reaction procedure: denaturation at 94.0 deg.C for 5 min; denaturation at 94.0 deg.C for 30s, annealing at 55 deg.C for 30s, and extension at 72 deg.C for 1min, and circulating for 35 times; extending for 7min at 72 ℃; storing at 10 deg.C. The PCR reaction was performed in an MJ Research PTC-225 thermal cycler.

(3) Primer design

T-DNA insertion site verification primers P1(SEQ ID NO.6), P2(SEQ ID NO.7) and P3(SEQ ID NO.8) were designed using Primer Premier 5.0 software based on flanking sequence information and DNA sequence information (SEQ ID NO.1) of OsLG1 gene near the T-DNA insertion site, and synthesized by Shanghai Jun Biotechnology, Inc. The self-designed primers are mixed in equal proportion according to the primer combination P1+ P2 and P1+ P3, and the PCR amplification result between Dongjin and T250 is detected.

(4) And (3) detecting a PCR product:

the amplification products were analyzed by electrophoresis on a 1% agarose gel. The molecular weight of the amplified product was compared with that of a 2000bp DNA Marker, and the amplified product was stained with EB and photographed under an ultraviolet lamp.

Thirdly, obtaining of rice grain size gene OsLG1

The sequences of the primers used for PCR amplification were as follows:

PC1：

5'—AAGCCATCACAAAACCAGAGAC—3'(SEQ ID NO.9)

PC2：

5'—GGTATTTTCCTATTTCCTAACATCG—3'(SEQ ID NO.10)

the target gene was obtained by PCR amplification using PC1 and PC2 as primers and the cDNA of Dongjin as a template. The pair of primers are positioned at the upstream-123 bp to-100 bp and the downstream 278bp to 302bp of SEQ ID NO.2, and the amplification product contains all coding regions of the gene.

Amplification was carried out by KOD enzyme amplification (available from TOYOBO Co.) in a PTC-200(MJ Research Inc.) PCR instrument at 94 ℃ for 2min, 98 ℃ for 10sec, 55 ℃ for 30sec, 68 ℃ for 2min, 35 cycles, 68 ℃ for 5min, PCR product purification and recovery, according to the procedure of the kit (Beijing Tiangen Co.), PCR product recovery and purification was carried out, and then ligated to vector pMb18T (available from TAKARA Co.), E.coli DH5 α competent cells (available from Tiangen Co.) were transformed, and positive clones were selected and sequenced.

The sequencing result shows that the fragment obtained by PCR reaction contains the nucleotide sequence shown in SEQ ID NO.2 and encodes a protein consisting of 281 amino acid residues (shown in SEQ ID NO. 3). The protein shown in SEQ ID NO.3 was designated OsLG1 (Dongjin).

Example 2 obtaining and identifying transgenic plants

Construction of recombinant overexpression vector

The OsLG1(Dongjin) gene is obtained by PCR amplification with the cDNA of Dongjin as a template, and the PCR primer sequence is as follows:

POE1 (Kpn I recombination site underlined):

5'—CGGGGTACCCCGATGATGGATGGGCGAGGAAG—3'(SEQ ID NO.4)

POE2 (Spe I recombination site underlined sequence):

5'—GGACTAGTCCTTATAATCTTTGCAAGTGTG—3'(SEQ ID NO.5)

the primers are positioned at the initial position of the coding region and the terminator position of the coding region of the gene shown in SEQ ID NO.2, the amplification product contains the complete coding region of the gene, and the PCR product is recovered and purified. By using

The HD Cloning Kit recombination Kit (Takara corporation) clones the PCR product into the vector pCAMBIA1390 (FIG. 3).

In-Fusion recombination reaction system (10 uL), PCR product 10-200ng, recovery of pCAMBIA1390 vector 50-200ng through Kpn I and Spe I double digestion, 5 XIn-Fusion HD Enzyme Premix 2uL, deionmized water to10 uL, blowing tip to mix well, reacting the mixed system at 50 ℃ for 15min, placing on ice, taking 2uL reaction system, transforming Escherichia coli DH5 α competent cells (Tiangen company) through heat shock method, coating all transformed cells on LB solid culture medium containing 100mg/L kanamycin, culturing at 37 ℃ for 12-16h, picking up clone positive clone, sequencing.

As a result of sequencing, a recombinant expression vector containing the OsLG1(Dongjin) gene shown in SEQ ID NO.2 was obtained, and pCAMBIA1390 containing OsLG1(Dongjin) was named pCAMBIA1390-OsLG1 (Dongjin).

II, obtaining recombinant agrobacterium

The Agrobacterium EHA105 strain (purchased from Invitrogen) was transformed with pCAMBIA1390-OsLG1(Dongjin) by electric shock to obtain a recombinant strain, and the plasmid was extracted for PCR and restriction enzyme digestion. The recombinant strain identified correctly by PCR and digestion was designated EH-pCAMBIA1390-OsLG1 (Dongjin).

Thirdly, obtaining of transgenic plants

The method for transforming the rice variety Dongjin by EH-pCAMBIA1390-OsLG1(Dongjin) comprises the following steps:

(1) EH-pCAMBIA1390-OsLG1(Dongjin) was cultured at 28 ℃ for 16 hours, and the cells were collected and diluted to OD 6 liquid medium (Sigma, C1416) containing 100. mu. mol/L₆₀₀The concentration is approximately equal to 0.5, and bacterial liquid is obtained;

(2) mixing and infecting the Dongjin rice mature embryo embryonic callus cultured for one month and the bacterial liquid obtained in the step (1) for 30min, transferring the bacterial liquid into a co-culture medium (N6 solid co-culture medium, Sigma company) after absorbing the bacterial liquid by filter paper, and co-culturing for 3 days at 24 ℃;

(3) inoculating the callus of step (2) on N6 solid screening medium containing 100mg/L paromomycin (Phyto technology laboratories, Inc.) for the first screening (16 days);

(4) selecting healthy callus, transferring the healthy callus to an N6 solid screening culture medium containing 100mg/L paromomycin for secondary screening, and subculturing once every 15 days;

(5) selecting healthy callus, transferring the healthy callus to an N6 solid screening culture medium containing 50mg/L paromomycin for third screening, and subculturing once every 15 days;

(6) selecting the resistant callus to transfer to a differentiation culture medium for differentiation;

obtaining T differentiated into seedlings₀And (5) generating positive plants. Dongjin was used as a negative control.

Fourth, identification of transgenic plants

1. PCR molecular characterization

The T obtained in the third step₀Extracting genome DNA from the positive plant toThe genomic DNA was used as a template, and amplification was carried out using, as a primer pair, the primer POE1 near the left boundary of the insertion site of SEQ ID NO.2 on pCAMBIA1390 and the primer POE2 on SEQ ID NO.2 (POE 1: 5' -)CGGGGTACCCCGATGATGGATGGGCGAGGAAG-3' (SEQ ID NO.4) and POE 2: 5' — (iii) a salt of (I)GGACTAGTCCTTATAATCTTTGCAAGTGTG-3' (SEQ ID NO.5)), and the amplification length is 868 bp. And (3) PCR reaction system: DNA (20ng/ul)2ul, POE1(10pmol/ul)2ul, POE2(10pmol/ul)2ul, 10xBuffer (MgCl)₂free)2ul，dNTP(10mM)0.4ul，MgCl₂(25mM)1.2ul，rTaq(5u/ul)0.4ul，ddH₂O10 ul, total volume 20 ul. The amplification reaction was performed on a PTC-200(MJ Research Inc.) PCR instrument: 3min at 94 ℃; 30sec at 94 ℃, 45sec at 55 ℃, 1min at 72 ℃ and 35 cycles; 5min at 72 ℃.

The PCR product was purified and recovered by using a kit (Beijing Tiangen Co.). The PCR product was detected by electrophoresis in 1% agarose.

2. Phenotypic identification

The T obtained by the above identification is used₀Transferring EH-pCAMBIA1390-OsLG1(Dongjin) positive plant, wild type Dongjin and mutant T250, planting in Nanjing agriculture university rice test station, collecting seeds by single plant, planting for three generations to obtain T₃Transgenic EH-pCAMBIA1390-OsLG1(Dongjin) plants were transformed. As shown in FIG. 4, the grain length of transgenic plants transformed with EH-pCAMBIA1390-OsLG1(Dongjin) is obviously increased. Table 1 shows statistical data for Grain length (Grainlength), Grain width (Grain width) and weight per hundred (100-Grain weight) of the unhulled seeds in FIG. 4. mm, length in millimeters, g, weight in grams. Table 2 shows the statistical data of Grain length (Grain length), Grain width (Grain width) and weight per hundred (100-Grain weight) of the de-husked seeds in FIG. 4. mm, english abbreviation of length unit millimeter. g, english abbreviation of weight unit grams. The statistical analysis data in tables 1 and 2 show that the grain length and the grain weight of transgenic plants of the transgenic EH-pCAMBIA1390-OsLG1(Dongjin) are obviously increased, which indicates that the grain length can be increased and the grain weight can be increased by over-expressing OsLG1 (Dongjin).

TABLE 1

TABLE 2

<110> Nanjing university of agriculture

<120> rice grain type gene OsLG1 and encoding protein and application thereof

<160>10

<210>1

<211>4258

<212>DNA

<213> Oryza sativa Rice (Oryza sativa var. Dongjin)

<220>

<223> gene sequence of grain size related gene OsLG1

<400>1

aagactacta tatgaaagtt gttataaaag aatatcttaa tttattttca aattatctaa 60

ttaataatgt gataattcac cgtcttattt tacgtagtag taaatattac ttctttcact 120

ataaaatata agaatctaat actctcacta ttataaatct aaatagagat tctatctaaa 180

tttataatat taaaatgtgt aagttatatt atattaagat ggagaaaata gagtccacac 240

aagtaccaag cctacacaca actacttcct tttgagtttt tacttgcact gtttgatcac 300

tcgtattatt cttaaaaaaa agttaaaatt attattaatt ttttttgact tactttatta 360

tctaaagtaa ttaaagtaca acttttcgtt ttttatattt acataaaaaa atttaataag 420

acgagacgga gggagtaaac gagtacacga cacagcatat atccatgtcc atgtcttccc 480

acggaaactg gcactgttga gctctgaaag ccgagctcaa cacgccacgc cattaacacc 540

acaccccccc gctcataaat gaaaaccgcg cgaaccagaa ccacccctcc ctccctcctc 600

catcaatgaa cctctccacc ccaccccgcg acgcgacgcg acgagccgta caccgaccgc 660

cccgcgccgc tgctgccgga gccggagaga gaagctgaag ccgaagcaga ggcagccgca 720

gcggcaaaac tcaaaagacg tcgtcaaaag ctctgccgcg cttgcagctt tctcgggctc 780

aaggaaaagc catcacaaaa ccagagacac agagagagag agagagaaac tgaagaaagg 840

tggcaactcc tgcagcagct gcagcagcaa ggtatgggca gctcatgacc agcaacagca 900

gcagcagcgt ccaatttctc gtggcgctcg ctcgccattt ctggagtact taaggagttc 960

ttggttttgt tcgttcgtcc ggtagcgcta gtgtttgtgg tttgctggtg ctgtggcgag 1020

gcgatgatgg atgggcgagg aagccaggag gaggagcacc tggatttgat catgcgacac 1080

cacgccagca tggggctgga tcgctgcgag agcgaggttg gcgtgcggtg tccgcgtttg 1140

attcgatcgg atgctggtgg tgatttggcg gtttgatttg gtgtttggtt ctttttagga 1200

ggcgctgggg tcgtcggagt cggagcagcc caccaggccg gcgcggccgc gcggcaagag 1260

gagccgcgcc gccgaggtgc acaacctctc cgagaaggtt agcccggcga cggcgactgc 1320

tacctctcgt gttcctcttg gtatcagctg attttgtggg attgattttg accacggtaa 1380

tttggtgcag aggaggagga gcagaatcaa tgagaagatg aaggccctgc agagcctcat 1440

tcccaactcc agcaaggtag taaaaaaaat tgtctctctt gtttcttact cgattttttg 1500

ttcaacgatt tatacacact attacttgtg ttgctggaag ctaatctctc gagttaattt 1560

ggcgtttatc ttgtgctgat ggtttcattc accgatgcag acggacaaag cctccatgct 1620

tgacgatgcc atcgagtacc tgaagcagct tcagctccag gtccaggtaa gtgtaatgaa 1680

tgttgcattg ttactgaatt gcttgaggat tattttcgca aatccacaga cttaatgctc 1740

caggtatcga caatggatat gtcaagcgtt ttgaatattg agcagctgtg tgctgaagtg 1800

aaatggtact agcatatatg agttaggaca agcttgaagt tctagcatca aaaagtgtac 1860

attagctatc ctaatcacca ttttctgatg gcttactgtc taagcaagat ttagtcggtt 1920

aggacgtcag aaaagaacat tgatctaatc acagcatgcc acattgttgt ttgcacggca 1980

tttgtaagaa aaacaaaatg tatgtattcc acgttactgc agctaatttc tgtttgattg 2040

ctgaattttt gttccagatg ttgtccatga ggaatggtct atatctgccc ccagtgaact 2100

tatctggggc acctgagcat ctgccgatcc cgcaaatgag tgctgcactt gaccagaata 2160

gtgccaaagc atcagatcct tcagttgttt tgcagccggt gaaccagact tcaggagcac 2220

ttcttccatt tgagctggca agccaacata aacctctatt cttaccaggt gttcctaatg 2280

caaccgctct ggagcctcgg ttccttgtag agtcttcgcg ttccaatctt caatccttac 2340

ggttcactga acccgctgag gtaatccttt ttgtcttgta agatcttcag cagtcagcat 2400

actgaacctc tttccttgct aatagaatag cacttcatat ggtcattttt cacttgttgt 2460

atctatttat gttgaagatg atctatcctg atgagatgat gttaaagcac cgcctgactt 2520

cagctagtga gagcacaatt gtgccaggtt agagaacata aactatttcc aataaccaat 2580

agtagtttca gattgcattt ttggtgaaca tttttttaca ttgactgacc ttccctttgc 2640

ttcttcaata ggaaccgatg agaagtcggt taggcagaac acatacatga tgaatgctga 2700

tcgttttgat agatatgcac tcagcaaaga ccagttgcag cacattatgc cgaaaaacac 2760

agaaagtgta cttgatatgc cacacttgca aaggtaaaag cttcttttgc cacttattta 2820

tagtataatg aaagtaggct ccattttcct tatagatagg attatttctt tatagtacac 2880

cataatactt tcctgtgatc ataagcatat tttaaggaaa ctggatttgg atggcctaaa 2940

gattagcgtg cgcctatttt atcttgtttt ttcattaaca tgtttagtaa taaatgaatg 3000

tcccatagca gcaaggtttc ttggtctgac tatcttattc tgagaaatag agaaaggacc 3060

ctaaaattca agctgtaggt agattaaaca gcaagaacta acataatttt gcaaattaga 3120

ctatgcaact gcaattatta gactatgcaa agagcaaatt tcacttatta aaactagtaa 3180

atcagtttgt gacactgttc tccagaattc tgacaaaggt gttaattgtt tcagattata 3240

agctgacgat tcagcttcca atcttggaca ggttgcaaac cagtgacacc aaagttaggg 3300

tcgagggcag aatcaaagta aacccatgat ctaatttcca attggacttg tggagtgcag 3360

agcagatcaa aatcggtgac tggtgatcat gagcagcacc taatctagca ttttacctct 3420

agaacagtag ttatatcttg ttgtgccatt gtactctggt gtgaagtgct ttgtaaaggg 3480

agatctatct ataagctgcc agtaacaatg aacatatccg atgttaggaa ataggaaaat 3540

accatcaaat caaatctata ttgccaatgt aggccggaat tgggagatgt gagatgcctg 3600

tggccactaa ttgaggctgc atagtttgtc tccactgttt taaaaaaaat catttttcat 3660

agcttgtttt gtttcttatc ggttatcaca ggtgacaaca gagagcctaa aatagatgga 3720

aatttggaag ccttctcaaa gatggaaatt tggctttcac agcttgagga tgatagcaat 3780

tctgggtcca aacactgatg aagttagtgt caacccaaag gaagctcctc tcccaacaaa 3840

tatgtaacaa ccgaattgaa caaacaaaca gcagcacaat catgctacag caatgcagtc 3900

ataaactcac aaatctacta aacctaacat tcatcactgt aaatccaagg atttacagaa 3960

gtcacagata caaaggtaaa aagcattccg tcgtaagcga tgataagcat aacatcattt 4020

tgcttacaaa caattgttaa gcaaaggatg atggtctgaa gactaggggg tattttgtca 4080

tatccttatg cgacaatcac gacttcattt cctcatcttc ttcaatcttt ggcgccagat 4140

aaaatctaat gtagcccatc tctgcaatct tatactcaac caccactggc agctcagatg 4200

aaaggctgat tgtaacttgt tcagagagcg ggcttgcctt ggtgaaggag ttcatgta 4258

<210>2

<211>846

<212>DNA

<213> Oryza sativa Rice (Oryza sativa var. Dongjin)

<220>

<223> CDS sequence of grain size related gene OsLG1

<400>2

atgatggatg ggcgaggaag ccaggaggag gagcacctgg atttgatcat gcgacaccac 60

gccagcatgg ggctggatcg ctgcgagagc gaggaggcgc tggggtcgtc ggagtcggag 120

cagcccacca ggccggcgcg gccgcgcggc aagaggagcc gcgccgccga ggtgcacaac 180

ctctccgaga agaggaggag gagcagaatc aatgagaaga tgaaggccct gcagagcctc 240

attcccaact ccagcaagac ggacaaagcc tccatgcttg acgatgccat cgagtacctg 300

aagcagcttc agctccaggt ccagatgttg tccatgagga atggtctata tctgccccca 360

gtgaacttat ctggggcacc tgagcatctg ccgatcccgc aaatgagtgc tgcacttgac 420

cagaatagtg ccaaagcatc agatccttca gttgttttgc agccggtgaa ccagacttca 480

ggagcacttc ttccatttga gctggcaagc caacataaac ctctattctt accaggtgtt 540

cctaatgcaa ccgctctgga gcctcggttc cttgtagagt cttcgcgttc caatcttcaa 600

tccttacggt tcactgaacc cgctgagatg atctatcctg atgagatgat gttaaagcac 660

cgcctgactt cagctagtga gagcacaatt gtgccaggaa ccgatgagaa gtcggttagg 720

cagaacacat acatgatgaa tgctgatcgt tttgatagat atgcactcag caaagaccag 780

ttgcagcaca ttatgccgaa aaacacagaa agtgtacttg atatgccaca cttgcaaaga 840

ttataa 846

<210>3

<211>281

<212>PRT

<213> Oryza sativa Rice (Oryza sativa var. Dongjin)

<220>

<223> amino acid sequence of grain size related gene OsLG1

<400>3

Met Met Asp Gly Arg Gly Ser Gln Glu Glu Glu His Leu Asp Leu Ile

1 5 10 15

Met Arg His His Ala Ser Met Gly Leu Asp Arg Cys Glu Ser Glu Glu

20 25 30

Ala Leu Gly Ser Ser Glu Ser Glu Gln Pro Thr Arg Pro Ala Arg Pro

35 4045

Arg Gly Lys Arg Ser Arg Ala Ala Glu Val His Asn Leu Ser Glu Lys

50 55 60

Arg Arg Arg Ser Arg Ile Asn Glu Lys Met Lys Ala Leu Gln Ser Leu

65 70 75 80

Ile Pro Asn Ser Ser Lys Thr Asp Lys Ala Ser Met Leu Asp Asp Ala

85 90 95

Ile Glu Tyr Leu Lys Gln Leu Gln Leu Gln Val Gln Met Leu Ser Met

100 105 110

Arg Asn Gly Leu Tyr Leu Pro Pro Val Asn Leu Ser Gly Ala Pro Glu

115 120 125

His Leu Pro Ile Pro Gln Met Ser Ala Ala Leu Asp Gln Asn Ser Ala

130 135 140

Lys Ala Ser Asp Pro Ser Val Val Leu Gln Pro Val Asn Gln Thr Ser

145 150 155 160

Gly Ala Leu Leu Pro Phe Glu Leu Ala Ser Gln His Lys Pro Leu Phe

165 170 175

Leu Pro Gly Val Pro Asn Ala Thr Ala Leu Glu Pro Arg Phe Leu Val

180 185 190

Glu Ser Ser Arg Ser Asn Leu Gln Ser Leu Arg Phe Thr Glu Pro Ala

195 200205

Glu Met Ile Tyr Pro Asp Glu Met Met Leu Lys His Arg Leu Thr Ser

210 215 220

Ala Ser Glu Ser Thr Ile Val Pro Gly Thr Asp Glu Lys Ser Val Arg

225 230 235 240

Gln Asn Thr Tyr Met Met Asn Ala Asp Arg Phe Asp Arg Tyr Ala Leu

245 250 255

Ser Lys Asp Gln Leu Gln His Ile Met Pro Lys Asn Thr Glu Ser Val

260 265 270

Leu Asp Met Pro His Leu Gln Arg Leu

275 280 285

<210>4

<211>32

<212>DNA

<213> Artificial sequence

<220>

<223>POE1

<400>4

cggggtaccc cgatgatgga tgggcgagga ag 32

<210>5

<211>30

<212>DNA

<213> Artificial sequence

<220>

<223>POE2

<400>5

ggactagtcc ttataatctt tgcaagtgtg 30

<210>6

<211>19

<212>DNA

<213> Artificial sequence

<220>

<223>P1

<400>6

atgccacatt gttgtttgc 19

<210>7

<211>19

<212>DNA

<213> Artificial sequence

<220>

<223>P2

<400>7

tctacaagga accgaggct 19

<210>8

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>P3

<400>8

cggcgtggtg tagagcatta 20

<210>9

<211>22

<212>DNA

<213> Artificial sequence

<220>

<223>PC1

<400>9

aagccatcac aaaaccagag ac 22

<210>10

<211>25

<212>DNA

<213> Artificial sequence

<220>

<223>PC2

<400>10

ggtattttcc tatttcctaa catcg 25

Claims (4)

1, the gene shown in SEQ ID NO.1, the protein coded by the gene shown in SEQ ID NO.1, and at least one of a recombinant expression vector, an expression cassette or a recombinant bacterium containing the gene shown in SEQ ID NO.1 is applied to cultivating transgenic rice with lengthened grains and increased grain weight.

2. A method for culturing the paddy rice with long seeds, increased grain weight and high output features that the gene shown by SEQ ID No.1 is introduced to small-grain paddy rice variety to obtain the transgenic paddy rice with long seeds and increased grain weight.

3. The method of claim 2, wherein: the gene shown in SEQ ID NO.1 is introduced into the rice grain through a recombinant expression vector containing the gene.

4. A method for cultivating transgenic plants with longer grains and increased grain weight is characterized in that: overexpresses the gene shown as SEQ ID NO.1 in the target plant to obtain a transgenic plant with lengthened grains and increased grain weight; the target plant is a plant carrying a gene shown by SEQID NO. 1.

Images