CN105950598B

CN105950598B - Rice dormancy-breaking related protein and coding gene and application thereof

Info

Publication number: CN105950598B
Application number: CN201610567000.9A
Authority: CN
Inventors: 万建民; 江玲; 杨春艳; 吴涛; 朱星洁; 王茜; 刘世家; 刘喜; 陈亮明; 田云录; 赵志刚
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2016-07-19
Filing date: 2016-07-19
Publication date: 2019-12-24
Anticipated expiration: 2036-07-19
Also published as: CN105950598A

Abstract

The invention discloses a rice dormancy associated protein, a gene coded by the same and application of the protein. The protein provided by the invention is the protein of the following (a) or (b): (a) a protein consisting of an amino acid sequence shown in SEQ ID No. 1; (b) and (b) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 1, is related to the dormancy of rice seeds and is derived from the protein shown in the SEQ ID NO. 1. The rice seed dormancy associated protein influences the dormancy of the mature seeds. The over-expression of the protein coding gene can lead the dormancy of the transgenic plant seeds to be enhanced, thereby being capable of cultivating the transgenic plants with moderate dormancy so as to reduce the influence of adverse environment on the rice yield. The protein and the coding gene thereof can be applied to plant genetic improvement.

Description

Rice dormancy-breaking related protein and coding gene and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and relates to a rice dormancy-breaking associated protein, and a coding gene and application thereof.

Background

The seed dormancy is ubiquitous, can enable species to escape from natural disasters, reduce competition among individuals in the species and prevent the seeds from germinating in untimely seasons, is adaptive to environment and seasonal changes obtained in the long-term evolution process of the species, is a complex character of higher plants affected by genes and environmental factors together, and has general biological significance. The rice seed dormancy is a complex character controlled by multiple genes and is also an important agronomic character in the rice evolution process, and the seed dormancy has duality in the cultivation process: on one hand, the seeds after sowing are required to germinate rapidly and tidily; on the other hand, the seeds need to have certain dormancy to prevent the seeds from meeting unfavorable weather in the harvest season to generate germination of ears, and the yield and the quality are influenced.

During the maturation of seeds, dormancy of seeds is formed as the accumulation of seed storage substances, the acquisition of dehydration tolerance and the cessation of metabolic activity. The formation of seed dormancy is regulated by a number of regulatory factors, which differ in their mode of action and level of regulation. The plant hormones ABA and GA are major regulators of seed dormancy, and their actions are antagonistic to each other. The content balance of ABA and GA and the response of signal path have important regulation and control functions for the formation and maintenance of seed dormancy. In plant seeds, ABA is involved in the formation of dormancy and maintenance of dormancy, and hormones such as GA are involved in the disruption of dormancy and promotion of seed germination. Seed dormancy and germination are typical quantitative traits regulated by multiple genes and are very easily influenced by external environmental conditions, and Quantitative Trait Locus (QTL) positioning is an effective method for researching complex quantitative traits. For the research of rice dormancy, firstly, the dormancy of each single plant in a group is detected through a separated group constructed by a strong dormancy material and a weak dormancy material, and the site for controlling the dormancy is initially positioned by combining molecular marker analysis. And then selecting sites with high contribution rate for subsequent research. Mainly through carrying out multi-generation backcross with one of the parents to obtain an near-isogenic line (NIL) only containing a target locus, carrying out recombinant screening on an F2 segregation population obtained through backcross of the NIL and the background parent, carrying out phenotype verification on the offspring of the recombinant, and finely positioning the QTL locus by combining the genotype of the recombinant so as to obtain the related genes influencing the dormancy phenotype. In recent years, molecular markers are used for analyzing different genetic groups, more than 100 QTLs related to rice dormancy are initially located and are widely distributed on 12 chromosomes. However, due to the complexity of seed dormancy and the susceptibility to external environment, the detected QTL is often not high in effect value or unstable in expression, which brings difficulty to further fine positioning and map-based cloning. Wild rice and weedy rice have strong seed dormancy, and are often used for research on seed dormancy, but the dormancy is difficult to remove, and the existence of linkage drag phenomenon makes the QTLs difficult to use in practical production. Therefore, the excellent dormancy QTL is excavated, and related genes are researched, which is particularly important for rice production.

Disclosure of Invention

The invention aims to provide a rice dormancy associated protein.

The invention also aims to provide a coding gene and application of the protein.

The protein qSdn-1 related to rice seed dormancy is derived from rice (Oryza sativa var. N22) and has an amino acid residue sequence shown as (a) or (b):

(a) a protein consisting of an amino acid sequence shown in SEQ ID No. 1;

(b) the protein related to rice seed dormancy is derived by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence of SEQ ID NO. 1.

The sequence 1 in the sequence table is composed of 966 amino acid residues and is phosphoenolpyruvate carboxylase family protein.

In order to facilitate the purification of qSdn-1 in (a), a tag as shown in Table 1 may be attached to the amino terminus or the carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO. 1.

TABLE 1 sequences of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The qSdn-1 in the (b) can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression. The gene encoding qSdn-1 in (b) above can be obtained by deleting one or several amino acid residues from the DNA sequence shown in SEQ ID NO.2, and/or performing missense mutation of one or several base pairs, and/or connecting the coding sequence of the tag shown in Table 1 to the 5 'end and/or 3' end thereof.

The gene OsqSdn-1(N22) for encoding the protein related to rice seed dormancy also belongs to the protection scope of the invention.

The gene is preferably a DNA molecule as described in 1) or 2) or 3) below:

1) DNA molecule shown in SEQ ID NO. 2;

2) a DNA molecule shown as SEQ ID NO. 3;

3) a DNA molecule which hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes said protein;

4) a DNA molecule which has more than 90 percent of homology with the DNA sequence limited by 1) or 2) or 3) and codes the plant dormancy associated protein.

The recombinant expression vector containing any one of the genes also belongs to the protection scope of the invention.

The recombinant expression vector containing the gene can be constructed by using the existing plant expression vector.

The plant expression vector can construct a binary agrobacterium vector. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal can direct polyadenylation to the 3 'end of the mRNA precursor, and untranslated regions transcribed from the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (e.g., nopalin synthase Nos), plant genes (e.g., soybean storage protein genes) all have similar functions.

When the gene is used for constructing a recombinant plant expression vector, any enhanced promoter or constitutive promoter can be added in front of transcription initiation nucleotide, such as cauliflower mosaic virus (CAMV)35S promoter and maize Ubiquitin promoter (Ubiquitin), and the enhanced promoter or constitutive promoter can be used independently or combined with other plant promoters; in addition, when the gene of the present invention is used to construct plant expression vectors, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and screening of transgenic plant cells or plants, plant expression vectors to be used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change in plants (GUS gene, luciferase gene, etc.), antibiotic markers having resistance (hygromycin marker, kanamycin marker, etc.), or chemical-resistant marker genes (e.g., herbicide-resistant gene), etc. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

The recombinant expression vector can be a recombinant plasmid obtained by inserting the gene (qSdn-1) into an EcoRI recombination site of a pCUbi1390 vector. pCUbi1390 containing qSdn-1 was named pCUbi 1390-qSdn-1.

The expression cassette, the transgenic cell line and the recombinant bacterium containing any one of the genes (qSdn-1) belong to the protection scope of the invention.

A Primer pair for amplifying the whole length or any fragment of the gene (qSdn-1) is also within the scope of the present invention, and the Primer pair is preferably Primer1/Primer2, Primer3/Primer4 and Primer5/Primer 6.

A rice dormancy site qSdn-1, wherein the site is positioned between Indel markers F19 and F18 and is within a range of 29.8 kb; the upstream primer of the Indel marked F19 is shown as SEQ ID NO.36 in the sequence table, and the downstream primer is shown as SEQ ID NO.37 in the sequence table; the upstream primer marked by Indel F18 is shown as SEQ ID NO.34 in the sequence table, and the downstream primer is shown as SEQ ID NO.35 in the sequence table.

The positioning primers involved in the fine positioning of the gene (see table 2), except primers RM11669 and RM11694, the rest SSR primers and InDel primers are primers designed for the needs of the experiment, and the primers designed by themselves also belong to the protection scope of the invention.

Has the advantages that:

the rice dormancy-resting related protein disclosed by the invention influences the dormancy of rice seeds. Over-expression of the protein can lead to increased seed dormancy. The protein and the coding gene thereof can be applied to genetic improvement of plants so as to obtain a variety with moderate dormancy, and ensure that the yield and the quality of the rice are not or less affected under severe conditions.

Drawings

FIG. 1 shows phenotypic analysis of N22 and Nanjing 35.

a is a strain pattern of N22 and Nanjing 35; b is the germination rate of the two; c is the grouting rate of the two; d is a germination phenotype chart of the two; e is the embryo change condition of the two different imbibition stages.

FIG. 2 shows the NIL construction process.

FIG. 3 is a phenotypic analysis of NIL and Nanjing 35

a is a strain pattern of NIL and Nanjing 35; b is the heading period condition of the two; c. d is the germination condition of the two; e is the embryo change condition of the two different imbibition stages; f-l is the condition of the agronomic character investigation of the two parts.

FIG. 4 is a phenotypic analysis of NIL, Nanjing 35 and their F1.

FIG. 5 is a fine mapping and crossover individual validation of qSdn-1.

a is the fine positioning of qSdn-1; b for verification of the exchanged individuals

FIG. 6 is a plasmid map of overexpression vector pCUbi 1390.

FIG. 7 shows the result of PCR molecular detection of transgenic plants.

Lane 1 shows the cDNA not transferred into OsqSdn-1(N22) as a template, which is amplified as a negative control, and the other 35 transgenic pCUbi1390-qSdn-1(N22) positive plants obtained by transformation except 2, 25, 26 and 30.

FIG. 8 shows the germination of a partially transgenic plant.

The germination rate of the control was about 99%, T₀Germination percentage of-15 of 71%, T₀The germination rate of-9 was 64%.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1 discovery of Rice dormancy-related site and Gene encoding the same

First, rice dormancy identification, near isogenic line construction and genetic analysis

N22 is indica rice with strong dormancy, and Nanjing 35 is non-dormant japonica rice. And respectively collecting N22 seeds and Nanjing 35 seeds 35 days after heading, and selecting mature and full seeds for dormancy detection. 50 replicates of each, three replicates were placed in 10cm petri dishes with two layers of filter paper, 10ml of water was added, and germination was recorded after 7 days of dark culture at 30 ℃. Sprouting was recorded as more than half the length of the root or shoot as seeds. The germination rate of N22 is 0%, and the germination rate of Nanjing 35 is close to 100%. By observing the embryo in the imbibition period by using a stereomicroscope, the embryo of the Nanjing 35 has the phenomena of radicle and embryo elongation after 36h of imbibition, and the embryo of the N22 has no obvious change after 48h of imbibition. However, no significant difference was observed in the swelling rates of the two (see FIG. 1). And (3) carrying out dormancy phenotype identification on the separated population obtained by hybridizing the N22 and the Nanjing 35, analyzing the sites influencing the dormancy of the seeds by combining molecular marker analysis, and then selecting qSdn-1 with higher contribution rate for analysis. Constructing a Near Isogenic Line (NIL) with Nanjing 35 as a background parent and N22(qSdn-1) as an insertion fragment (see figure 2). By analyzing NIL and Nanjing 35, the dormancy of the NIL is stronger than that of the Nanjing 35, and the plant height, heading stage, grouting rate, imbibition rate, tiller number, seed setting rate, thousand-grain weight and other agronomic characters have no obvious difference. When the embryos are observed in the imbibition period, the embryos of the NIL begin to have radicle and embryo changes after 60h of imbibition, and the germination rate of the NIL is about 40% (see figure 3). F1 obtained by backcrossing NIL and Nanjing 35 was analyzed, and the seed dormancy was close to that of NIL, so we considered that the rice seed dormancy was controlled by dominant gene (see FIG. 4)

Second, obtaining rice dormancy site and related gene thereof

1. Fine positioning of rice dormancy site and related gene thereof

F obtained by backcrossing NIL and Nanjing 35₂Isolating 4826 strains of the colony, taking leaves of each strain, extracting DNA respectively, screening the exchanged single strains by using initially positioned SSR markers RM11669 and RM11694, simultaneously carrying out dormancy detection on each single strain, and selecting the exchanged single strains with extreme phenotypes for subsequent tests. Selecting 8248 strains of the segregating population in the next year, dividing the strains into individuals, removing leaves, extracting DNA, carrying out cross-over individual strain screening by using self-developed Indel markers Y25 and Y37, and selecting extreme cross-over individual strains for subsequent tests by combining dormancy phenotypes of the individual strains. By this method, the rice dormancy site qSdn-1 was located between the self-developed Indel markers Y78 and Y75. And carrying out dormancy detection on the screened filial generations of the crossover individual, and combining the genotype of the crossover individual to further finely locate. Finally, the rice dormancy site-qSdn-1 was located between Indel markers F19 and F18, within 29.8kb (see FIG. 5).

The verification method for the filial generation of the exchange individual plant comprises the following steps:

(1) each crossover individual for analysis was planted, 40 plants each

(2) For the offspring generated by exchanging the single plants, the dormancy of each single plant is examined by dividing the single plant

(3) And counting the phenotype distribution of all the offspring of each exchange individual plant, recording the phenotype distribution as H when no dormancy exists, recording the strong dormancy as L, and recording the phenotype segregation of the offspring as S.

The method for the SSR marker analysis is as follows:

(1) the total DNA of the selected individual plant is extracted as a template, and the specific method is as follows:

firstly, taking about 0.2g of young and tender rice leaves, placing the young and tender rice leaves in a 2.0ml Eppendorf tube, placing a steel ball in the tube, freezing the Eppendorf tube filled with a sample in liquid nitrogen for 5min, and placing the Eppendorf tube on a 2000 model GENO/GRINDER instrument to crush the sample for 1 min.

② 660 mul of extract (solution containing 100mM Tris-HCl (pH 8.0), 20mM EDTA (pH 8.0), 1.4M NaCl and 0.2g/ml CTAB) is added, and the mixture is mixed by vigorous vortex on a vortex machine and ice-cooled for 30 min.

③ adding 40 mul of 20 percent SDS, carrying out warm bath at 65 ℃ for 10min, and slightly reversing and mixing the mixture up and down every two minutes.

Fourthly, 100 mul of 5M NaCl is added and mixed gently.

Fifthly, adding 100 mul 10 xCTAB, carrying out warm bath at 65 ℃ for 10min, and intermittently and slightly reversing the upside down and mixing the mixture.

Sixthly, 900 mu l of chloroform is added, fully and evenly mixed, and the mixture is centrifuged at 12000rpm for 3 min.

Seventhly, transferring the supernatant to a 1.5mL Eppendorf tube, adding 600 μ l of isopropanol, mixing uniformly, and centrifuging at 12000rpm for 5 min.

Eighthly, discarding the supernatant, rinsing the precipitate once by using 70 percent (volume percentage) of ethanol, and drying at room temperature.

Ninthly, adding 100. mu.l of 1 XTE (a solution obtained by dissolving 121 g of Tris in 1 liter of water and adjusting pH to 8.0 with hydrochloric acid) to dissolve the DNA.

DNA quality was determined by electrophoresis at 2. mu.l in (R) and concentration was determined by DU800 spectrophotometer (Beckman Instrument Inc.U.S.A.).

(2) Diluting the extracted DNA to about 20ng/ul, and performing PCR amplification as a template;

PCR reaction (10. mu.l): DNA (20ng/ul)1ul, upstream primer (2pmol/ul)1ul, downstream primer (2pmol/ul)1ul, 10xBuffer (MgCl)₂free)1ul，dNTP(10mM)0.2ul，MgCl₂(25mM)0.6ul，rTaq(5u/ul)0.1ul，ddH₂O5.1 ul, 10ul in total.

PCR reaction procedure: denaturation at 94.0 deg.C for 5 min; denaturation at 94.0 deg.C for 30s, annealing at 55 deg.C for 30s, and extension at 72 deg.C for 1min, and circulating for 35 times; extending for 7min at 72 ℃; storing at 10 deg.C. The PCR reaction was performed in an MJ Research PTC-225 thermal cycler.

The primer development process is as follows:

(1) SSR marker development

Integrating SSR markers of a public map with a rice genome sequence, and downloading BAC/PAC clone sequences near mutation sites. Searching potential SSR sequences (the repetition times are more than or equal to 6) in the clone by using SSRHUNTer (Liqiang et al, inheritance, 2005, 27(5): 808-; comparing the SSRs and sequences adjacent to 400-500 bp thereof with corresponding indica rice sequences on line at NCBI through a BLAST program, and preliminarily deducing that the PCR product of the SSR primer has polymorphism between indica rice and japonica rice if the SSR repetition times of the SSRs and the sequences are different; then, SSR primers were designed using Primer Premier 5.0 software and synthesized by Shanghai Invitrogen Biotechnology, Inc. And (3) mixing the self-designed SSR pair primers in equal proportion, detecting the polymorphism between N22 and Nanjing 35, and using the polymorphism representing person as a molecular marker for fine positioning qSdn-1. The molecular markers used for fine localization are shown in table 2.

PCR product detection of SSR markers:

the amplification products were analyzed by 8% native polyacrylamide gel electrophoresis. The molecular weight of the amplified product is compared by taking 50bp DNA Ladder as a control, and silver staining is performed for color development.

(2) InDel marker development

Design of InDel primer: sequencing partial sections of N22 and Nanjing 35 near the position of qSdn-1, comparing, finding SNPs existing between the two sections, designing InDel labels by software based on the SNPs, and designing the corresponding other Primer by using Primer Premier 5.0 software, which is shown in Table 2.

PCR reaction system for InDel marker analysis: 2ul of DNA (20ng/ul), 2ul of Primer1(10pmol/ul), 2ul of Primer2(10pmol/ul), 10xBuffer (MgCl)₂free)2ul，dNTP(10mM)0.4ul，MgCl₂(25mM)1.2ul，rTaq(5u/ul)0.4ul，ddH₂O10 ul, total volume 20 ul.

The amplification reaction was performed on a PTC-200(MJ Research Inc.) PCR instrument: 3min at 94 ℃; 94 ℃ for 30sec, 55 ℃ (primer varied, adjusted) for 45sec, 72 ℃ for 2.5min, 35 cycles; 5min at 72 ℃.

The PCR product was purified and recovered according to the procedure of the kit (Beijing Tiangen Co.). After digestion overnight, the PCR product was separated by electrophoresis on 1-4% agarose gel, stained with EB, and photographed under an ultraviolet lamp. dCAPS was separated on 8% native PAGE gel and silver stained.

TABLE 2 molecular markers for Fine localization

(3) Obtaining of mutant Gene

Primers were designed based on the mapped sites and the sequences were as follows:

primer1：

5'—AGAAGGGGGAAAAGGA—3'(SEQ ID NO.4)

primer2：

5'—CTTAGCATCCCCTTATTTAC—3'(SEQ ID NO.5)

PCR amplification is carried out by taking primer1 and primer2 as primers and cDNA of N22 and Nanjing 35 as templates respectively to obtain the target gene. The pair of primers are positioned at the upstream 44bp and the downstream 104bp of SEQ ID NO.3, and the amplification product contains all coding regions of the gene

The amplification reaction was performed using KOD enzyme amplification (available from TOYOBO corporation) on a PTC-200(MJ Research Inc.) PCR instrument: 94 ℃ for 2 min; 10sec at 98 ℃, 30sec at 60 ℃ and 10min at 68 ℃ for 35 cycles; at 68 ℃ for 20 min. The PCR product was recovered and purified, and ligated to vector pMb18T (purchased from TAKARA), E.coli DH 5. alpha. competent cells (purchased from Tiangen) were transformed, and positive clones were selected and sequenced.

The sequencing result shows that the fragment obtained by PCR reaction contains the nucleotide sequence shown in SEQ ID NO.3 and encodes a protein consisting of 966 amino acid residues (shown in SEQ ID NO. 1). The protein shown by SEQ ID NO.1 was named OsqSdn-1(N22), and the gene encoding the protein shown by SEQ ID NO.1 was named OsqSdn-1 (N22).

Example 2 obtaining and identifying transgenic plants

Construction of recombinant expression vector

Carrying out PCR amplification by taking cDNA of N22 as a template to obtain an OsqSdn-1(N22) gene, wherein the PCR primer sequence is as follows:

primer3 (sequence shown underlined is EcoRI recombination site):

5'—CCATGATTACGAATTCATGGCGCGCAATGCGGCGGAC—3'(SEQ ID NO.6)

primer4 (sequence shown underlined is EcoRI recombination site):

5'—TACCGAGCTCGAATTCCCCAGTGTTCTGCATACCAGCAG—3'(SEQ ID NO.7)

the primers are positioned at the initial 21bp of the coding region of the gene shown in SEQ ID NO.2 and the front 23bp of the terminator of the coding region, the amplification product contains the complete coding region of the gene, and the PCR product is recovered and purified. By usingThe HD Cloning Kit recombination Kit (Takara corporation) clones the PCR product into the vector pCUbi1390 (FIG. 6).

In-Fusion recombination reaction system (10. mu.L): 10-200ng of PCR product, 50-200ng of pCUbi1390 vector, 5 XIn-Fusion HD Enzyme Premix 2. mu.L, deionmized water to 10. mu.L, was recovered by EcoRI digestion. After the tip was blown and mixed, the mixed system was reacted at 50 ℃ for 15min and then placed on ice, and 2. mu.L of the reaction system was used to transform E.coli DH 5. alpha. competent cells (Tiangen Co.) by heat shock. All the transformed cells were spread evenly on LB solid medium containing 100mg/L kanamycin. Culturing at 37 deg.C for 12-16h, selecting clone positive clone, and sequencing. Sequencing results show that a recombinant expression vector containing the OsqSdn-1(N22) gene shown in SEQ ID NO.3 is obtained, and pCUbi1390 containing OsqSdn-1(N22) is named as pCUbi1390-qSdn-1 (N22).

II, obtaining recombinant agrobacterium

pCUbi1390-qSdn-1(N22) is transformed into Agrobacterium EHA105 strain (purchased from Invitrogen, USA) by electric shock method to obtain recombinant strain, and plasmid is extracted for PCR and enzyme digestion identification. The recombinant strain identified correctly by PCR and enzyme digestion was named EH-pCUbi 1390-qSdn-1 (N22).

Thirdly, obtaining of transgenic plants

The method for transforming the EH-pCUbi 1390-qSdn-1(N22) into the rice Nanjing 35 specifically comprises the following steps:

(1) EH-pCUbi 1390-qSdn-1(N22) was cultured at 28 ℃ for 16 hours, and the cells were collected and diluted to OD 6 liquid medium (Sigma, C1416) containing 100. mu. mol/L₆₀₀The concentration is approximately equal to 0.5, and bacterial liquid is obtained;

(2) mixing and infecting the mature embryo callus of the Nanjing 35 rice cultured for one month and the bacterial liquid obtained in the step (1) for 30min, sucking the bacterial liquid through filter paper, transferring the bacterial liquid into a co-culture medium (N6 solid co-culture medium, Sigma company), and co-culturing for 3 days at 24 ℃;

(3) inoculating the callus of step (2) on N6 solid selection medium containing 100mg/L hygromycin (Phyto Technology Laboratories, Inc.) for the first selection (16 days);

(4) selecting healthy callus, transferring the healthy callus to an N6 solid screening culture medium containing 100mg/L hygromycin for secondary screening, and subculturing once every 15 days;

(5) selecting healthy callus, transferring the healthy callus to an N6 solid screening culture medium containing 50mg/L hygromycin for third screening, and subculturing once every 15 days;

(6) selecting the resistant callus to transfer to a differentiation culture medium for differentiation;

obtaining T differentiated into seedlings₀And (5) generating positive plants. Nanjing 35 transfected with pCUbi1390 empty vector was used as a negative control.

Fourth, identification of transgenic plants

1. PCR molecular characterization

The T obtained in the third step₀Genomic DNA was extracted from the generation-positive plants, and amplified (Primer 5: 5'-TTTGTCGGGTCATCTTTTC-3' (SEQ ID NO.8) and Primer 6: 5'-TCAGCCAAGTTTGCCAG-3' (SEQ ID NO.9)) using genomic DNA as a template and Primer pair (Primer5 near the left border of the insertion site of SEQ ID NO.3 on pCUbi1390 and Primer6 on SEQ ID NO. 3) to have an amplification length of 1018 bp. . And (3) PCR reaction system: 2ul of DNA (20ng/ul), 2ul of Primer5(10pmol/ul), 2ul of Primer6(10pmol/ul), 10xBuffer (MgCl)₂free)2ul，dNTP(10mM)0.4ul，MgCl₂(25mM)1.2ul，rTaq(5u/ul)0.4ul，ddH₂O10 ul, total volume 20 ul. The amplification reaction was performed on a PTC-200(MJ Research Inc.) PCR instrument: 3min at 94 ℃; 30sec at 94 ℃, 45sec at 55 ℃, 1min at 72 ℃ and 35 cycles; 5min at 72 ℃.

The PCR product was purified and recovered by using a kit (Beijing Tiangen Co.). The PCR product was detected by electrophoresis in 1% agarose. The result shows that 35 plants with positive PCR detection are obtained. Referring to FIG. 7, lane 1 in FIG. 7 shows the result of using Nanjing 35DNA as a template for amplification as a negative control, and 35 transgenic pCUbi1390-qSdn-1(N22) plants obtained by transformation were used in addition to 2, 25, 26 and 30.

2. Phenotypic identification

Respectively combine T with₀The transgenic EH-pCUbi 1390-qSdn-1(N22) plant, Nanjing 35 and N22 are planted at the rice test station of Nanjing agriculture university, the transgenic plant with 35 days of heading is harvested, and the dormant phenotype is identified. The germination rate of the transgenic plant transformed into the unloaded Nanjing 35 is about 99 percent, and the germination rate of the transgenic plant transformed into the EH-pCUbi 1390-qSdn-1(N22) is separated, wherein T is₀Germination rate of-15 about 71%, T₀The germination rate of-9 was about 64%. It was shown that OsqSdn-1(N22) indeed can influence the dormancy of seeds (see FIG. 8).

Claims

1. The application of at least one of a gene for coding the protein shown by SEQ ID NO.1, a recombinant expression vector containing the gene for coding the protein shown by SEQ ID NO.1, an expression cassette, a transgenic cell line or a recombinant bacterium in the cultivation of rice with moderately dormant seeds.

2. The use according to claim 1, characterized in that the gene sequence encoding the protein shown in SEQ ID No.1 is shown in SEQ ID No.2 or SEQ ID No. 3.

3. A method for cultivating proper dormancy of rice seeds is to introduce a gene of a protein shown by SEQ ID NO.1 into a non-dormant rice variety to obtain transgenic rice with enhanced dormancy; the non-dormancy rice variety is a rice variety with the germination rate close to 100%; the transgenic rice with enhanced dormancy is the transgenic rice with the germination rate of less than 80%.

4. The method according to claim 3, wherein the gene sequence encoding the protein of SEQ ID No.1 is as shown in SEQ ID No.2 or SEQ ID No. 3.

5. The method of claim 4, wherein: the gene of the protein shown by the coded SEQ ID NO.1 is introduced into the non-dormant rice through the recombinant expression vector containing the gene.

6. A method for cultivating transgenic plants with enhanced seed dormancy is to overexpress a gene encoding a protein shown by SEQ ID NO.1 in a target plant to obtain transgenic plants with enhanced seed dormancy; the target plant is a plant carrying a gene for coding the protein shown by SEQ ID NO.1, wherein the plant is rice.