CN107475266A

CN107475266A - A kind of paddy endosperm silty related gene OscyMDH and its encoding proteins matter and application

Info

Publication number: CN107475266A
Application number: CN201710621095.2A
Authority: CN
Inventors: 万建民; 王益华; 滕烜; 江玲; 刘喜; 刘世家; 田云录; 陈亮明; 张文伟; 刘裕强; 赵志刚
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2017-07-27
Filing date: 2017-07-27
Publication date: 2017-12-15
Anticipated expiration: 2037-07-27
Also published as: CN107475266B

Abstract

The present invention disclose a kind of paddy endosperm silty related gene OscyMDH and its encoding proteins matter and application, gene OscyMDH provided by the invention, be it is following 1) or 2) or 3) or 4) described in DNA molecular：1) DNA molecular shown in SEQ ID NO.1；2) DNA molecular shown in SEQ ID NO.2；3) under strict conditions with 1) or 2) the DNA sequence dna hybridization limited and the DNA molecular of encoding said proteins；1) or 2) or 3) 4) DNA sequence dna with limiting has more than 90% homology, and the DNA molecular of coded plant Starch synthesis GAP-associated protein GAP.The present invention also provides the protein of the gene code, and the albumen influences the synthesis of starch in albumen, and the encoding gene of the albumen is imported in the abnormal plant of Starch synthesis, can cultivate the normal genetically modified plants of Starch synthesis.The albumen and its encoding gene can apply to genetic modification of plants.

Description

A kind of paddy endosperm silty related gene OscyMDH and its encoding proteins matter and application

Technical field

The invention belongs to genetic engineering field, and in particular to a kind of paddy endosperm silty related gene OscyMDH and its volume Code protein and application.

Background technology

Rice is important cereal crops, and one of model plant of plant research.Rice paddy seed is in maturation Substantial amounts of starch is accumulated, is sprouted for seed and seedling development provides main energy, while these a considerable number of starch Also the important food source of the mankind is turned into.The number of starch accumulation often determines the size and weight of seed in rice paddy seed, It is directly related with the yield of rice, while the ratio of amylose and amylopectin directly affects the food flavor of rice in seed Quality, therefore the building-up process for studying starch in rice has important application value, carries out its development and hereditary control mechanism Further investigation, to improvement rice quality and improve yield have important directive significance.

In higher plant, starch is the main carbohydrate of plant storage, is largely present in stem tuber, root tuber, seed, Also there is presence in blade, floral organ, it is not only the main energy source of the mankind, and is the important raw material of industry.Starch is Most important ergastic substances in plant, although many enzymes for participating in Starch synthesis process and regulatory factor are accredited out, But the mankind can't utilize vitro system synthetic starch, the synthesis of starch is a complexity and fine in this explanation plant Process, the key factor of new participation Starch synthesis still needs further identification.Starch proportion is most in paddy endosperm Height, and be main energy source, its structure and property determine exterior quality and Cooking Quality of rice etc., therefore embryo The research of newborn mutant amylase body has great importance.

Rice fecula mutant includes waxy (waxy, wx), saccharic (sugary, su), silty (floury, flo), shrinkage The type such as (shrunken, sh), dark-coloured (dull, du), core white (white-core, wc).In rice, screening endosperm is abnormal Mutant (farinaceous albumen) is the important method for finding new Starch synthesis key factor.As molecular biology and molecule are lost The fast development of method and technology is passed, multidigit researcher has carried out assignment of genes gene mapping research to rice silty Endosperm Traits.So far Untill, there are some rice silty genes by finely positioning and clone, but the regulatory mechanism of rice fecula synthesis is also unclear Chu, this just needs us to position and clone more Starch synthesis genes further to disclose the mechanism of rice fecula synthesis.

The content of the invention

It is an object of the invention to disclose a kind of paddy endosperm silty related gene OscyMDH and its encoding proteins matter and answer With.

Gene OscyMDH provided by the invention, for it is following 1) or 2) or 3) or 4) described in DNA molecular：

1) DNA molecular shown in SEQ ID NO.1；

2) DNA molecular shown in SEQ ID NO.2；

3) under strict conditions with 1) or 2) the DNA sequence dna hybridization limited and the DNA molecular of encoding said proteins；

1) or 2) or 3) 4) DNA sequence dna with limiting has more than 90% homology, and coded plant Starch synthesis correlation The DNA molecular of albumen.

SEQ ID NO.1 in sequence table, are made up of 3936 nucleotides.

Present invention also offers a kind of protein of said gene OscyMDH codings.

Specifically, protein provided by the invention, selected from any as shown in (a) or (b)：

(a) protein being made up of the amino acid sequence shown in SEQ ID NO.3；

(b) by substitution of the SEQ ID NO.3 amino acid sequence by one or several amino acid residues and/or missing And/or addition and the protein as derived from SEQ ID NO.3 related to Starch synthesis.

SEQ ID NO.3 in sequence table, are made up of 332 amino acid.

Present invention also offers the recombinant expression carrier containing the gene OscyMDH, expression cassette, transgenic cell line or Recombinant bacterium.Recombinant expression carrier containing gene described in any of the above falls within protection scope of the present invention.

The recombinant expression carrier of the gene can be contained with existing plant expression vector construction.

The plant expression vector includes double base agrobacterium vector and the carrier available for plant micropellet bombardment etc..The plant Thing expression vector can also include 3 ' end untranslated regions of foreign gene, i.e., comprising polyadenylation signals and any other participation MRNA is processed or the DNA fragmentation of gene expression.The bootable polyadenylic acid of polyadenylation signals is added to the 3 ' of mRNA precursor End, such as Agrobacterium crown gall nodule induction (Ti) plasmid gene (such as kermes synzyme Nos genes), plant gene (such as soybean storage egg White gene) 3 ' end transcription non-translational region be respectively provided with similar functions.

During using the gene constructed recombinant plant expression vector, any one can be added before its transcription initiation nucleotides Enhanced promoter or constitutive promoter, such as the ubiquitin promoter of cauliflower mosaic virus (CAMV) 35S promoter, corn (Ubiquitin), they can be used alone or are used in combination with other plant promoters；In addition, the gene using the present invention When building plant expression vector, enhancer, including translational enhancer or transcriptional enhancer, these enhancer regions also can be used Can be ATG initiation codon or neighboring region initiation codon etc., but must be identical with the reading frame of coded sequence, to protect Demonstrate,prove the correct translation of whole sequence.The source of the translation control signal and initiation codon is extensive, can be natural Or synthesis.Translation initiation region can come from transcription initiation region or structural gene.

For the ease of transgenic plant cells or plant are identified and screened, plant expression vector used can be carried out Processing, as add the coding that can be expressed in plant can produce color change enzyme or luminophor gene (gus gene, Luciferase genes etc.), resistant antibiotic marker (gentamicin label, kanamycins label etc.) or Anti- chemical reagent marker gene (such as anti-herbicide gene).From the security consideration of genetically modified plants, any selection can be not added with Property marker gene, directly with adverse circumstance screen transformed plant.

The restructuring over-express vector can be in restriction enzyme HindIII and BamHI double digestion carrier PCAMBIA1390 recombination site inserts the recombinant plasmid that the gene (OscyMDH) obtains.It will contain OscyMDH's PCAMBIA1390 is named as pCAMBIA1390-OscyMDH.

Expression cassette, transgenic cell line and recombinant bacterium containing gene described in any of the above (OscyMDH) belong to this hair Bright protection domain.

The primer pair for expanding the gene (OscyMDH) total length or any fragment falls within protection scope of the present invention, institute Primer pair preferred Primer1/Primer2, the Primer3/Primer4 stated.

The positioning primer (being shown in Table 1) being related to during finely positioning this gene, InDel primers be this experiment needs and The primer of designed, designed, the primer of these designed, designeds fall within protection scope of the present invention.

Present invention also offers the gene, the protein, the recombinant expression carrier, expression cassette, transgenic cell The application of at least one of system or recombinant bacterium in plant breeding.

Present invention also offers the gene, the protein, the recombinant expression carrier, expression cassette, transgenic cell The application of at least one of system or recombinant bacterium in the normal genetically modified plants of Starch synthesis are cultivated.

It is by the channel genes present invention also offers a kind of method for cultivating the normal genetically modified plants of Starch synthesis In Starch synthesis exception plant, the normal genetically modified plants of Starch synthesis are obtained.

Specifically, the gene can be imported in the abnormal plant of Starch synthesis by the recombinant expression carrier.

Using any carrier that foreign gene can be guided to be expressed in plant, the gene of encoding said proteins is led Enter plant cell, transgenic cell line and transfer-gen plant can be obtained.The expression vector for carrying the gene can be by using Ti The conventional biology side such as plasmid, Ri plasmids, plant viral vector, directly delivered DNA, microinjection, conductance, agriculture bacillus mediated Method converts plant cell or tissue, and the plant tissue of conversion is cultivated into plant.The plant host being converted both can be single Cotyledon plant or dicotyledon, such as：Tobacco, crowtoe, arabidopsis, rice, wheat, corn, cucumber, tomato, Willow, turfgrass, lucerne place etc..

Beneficial effect：

Present invention firstly discovers that, position and clone to obtain the gene of a new albumen silty GAP-associated protein GAP OscyMDH.The albumen silty GAP-associated protein GAP of the present invention influences the Starch synthesis process of plant.Suppress the encoding histone base The expression of cause can cause the obstacle of Starch synthesis in vegetable seeds, so as to cultivate the genetically modified plants of endosperm variation and plant The genetically modified plants that thing content of starch reduces.The encoding gene of the albumen is imported in the plant that content of starch reduces, can be with Cultivate the normal plant of content of starch.The albumen and its encoding gene can apply to genetic modification of plants.

Brief description of the drawings

The content of starch that Fig. 1 is wild type N22 and mutant N65 determines.

Fig. 2 is wild type N22 and mutant N65 seed external form.

Fig. 3 is wild type N22 and mutant N65 seed scanning electron microscopic observations.

Fig. 4 is finely positioning of the mutator on the 10th chromosome.

Fig. 5 is the T for turning pCAMBIA1390-OscyMDH₀For the T of plant₁Seed phenotype.

Fig. 6 is the T for turning pCAMBIA1390-OscyMDH₀For the T of plant₁Seed scanning electron microscopic observation.

Embodiment

Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method, it is conventional method unless otherwise specified.Test material used in following embodiments, unless otherwise specified, it is It is commercially available from routine biochemistry reagent shop.

The discovery of embodiment 1, rice fecula synthesis related locus and its encoding gene

First, paddy endosperm silty mutant N65 content of starch distributional analysis and genetic analysis

In using N22 mutant caused by MNU mutagenesises, an endosperm silty mutant is filtered out, is named as N65。

Compared with N22, N65's is mainly characterized by：Content of starch declines (see Fig. 1) in seed, while has seed impermeable Bright phenotype (see Fig. 2).A figures show that N22 has translucent endosperm, and B figures show that N65 endosperm is opaque.This explanation Gene mutation have impact on the synthesis of starch, and the structure and property for causing amylum body are changed, and endosperm is showed on apparent Go out huge difference.

Scanning electron microscopic observation (see Fig. 3) is carried out to the cross section of wild type and mutant N65 seeds, from 200 times of amplification Photo on, the starch lamellar structure comparison rule of the cross section of wild type seeds is neat, and mutant is more open.Thus It is inferred that the change of these starch granule structures and arrangement may cause the phenotype of middle endosperm presentation silty.

2nd, the map based cloning of mutant gene locus

1st, the positioning of mutator

First, mutant N65 and another wild type Nipponbare cross combination F have been prepared₁, obtained after being selfed a generation F₂Seed.By F₂Seed shells, and determines target gene for 10 plants of extremists progress of standard screening are chain so that phenotype is opaque On the chromosome of rice the 10th, using the common primers in laboratory, increase extremists quantity reduces location area section to 125 plants To 570 kb, complete just to position.

Select the F consistent with mutation type surface₂Seed sends out seedling, obtains the blade of 1509 plants of recessive extremists, utilizes public affairs With primer and self-designed primer, most target gene is determined between 188-2 and 188-12 is marked at last, sector sizes 79kb (Fig. 4).

The method of above-mentioned SSR marker analysis is as described below：

(1) STb gene for extracting above-mentioned selection individual plant is as follows as template, specific method：

1. taking 0.2 gram or so of rice young leaflet tablet, it is placed in 2.0mL Eppendorf pipes, a steel ball is placed in pipe, The Eppendorf pipes for installing sample are freezed 5min in liquid nitrogen, is placed on 2000 type GENO/GRINDER instruments and crushes sample 1min。

2. add 660 μ L extract solutions (Tris-HCl containing 100mM (pH 8.0), 20mM EDTA (pH 8.0), 1.4M NaCl, 0.2g/mL CTAB solution), acutely it is vortexed on whirlpool device and mixes, ice bath 30min.

3. add 40 μ L 20%SDS, 65 DEG C of warm bath 10min, mixing of gently being turned upside down every two minutes.

4. 100 μ L 5M NaCl are added, it is gentle to mix.

5. adding 100 μ L 10 × CTAB, 65 DEG C of warm bath 10min, it is interrupted mixing of gently turning upside down.

6. adding 900 μ L chloroforms, fully mix, 12000rpm centrifugations 3min.

7. shifting supernatant into 1.5mL Eppendorf pipes, 600 μ L isopropanols are added, are mixed, 12000rpm centrifugations 5 min。

8. abandoning supernatant, precipitation is rinsed once with 70% (volumn concentration) ethanol, room temperature airing.

9. it is molten to add 100 1 × TE of μ L (121g Tris are dissolved in 1 liter of water, and pH value is adjusted to 8.0 obtained solution with hydrochloric acid) Solve DNA.

10. 2 μ L electrophoresis detection DNA mass are taken, and with DU800 spectrophotometric determinations concentration (Beckman Instrument Inc. U.S.A)。

(2) DNA of said extracted is diluted to about 20ng/ μ L, enters performing PCR amplification as template；

PCR reaction systems (10 μ L)：DNA (20ng/ μ L) 1 μ L, sense primer (2pmol/ μ L) 1 μ L, anti-sense primer (2 Pmol/ μ L) 1 μ L, 10 × Buffer (MgCl₂Free) 1 μ L, dNTP (10mM) 0.2 μ L, MgCl₂(25mM) 0.6 μ L, rTaq (5U/ μ L) 0.1 μ L, ddH₂The μ L of O 5.1, totally 10 μ L.

PCR response procedures：94.0 DEG C of denaturation 5min；94.0 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, altogether Circulation 35 times；72 DEG C of extension 7min；10 DEG C of preservations.PCR reactions are carried out in MJ Research PTC-225 thermal cyclers.

(3) the PCR primer detection of SSR marker

Amplified production is analyzed with 8% native polyacrylamide gel electrophoresis.Using 50bp DNA Ladder as contrast ratio Compared with the molecular size range of amplified production, silver staining colour developing.

Above-mentioned primer development process is as follows：

(1) SSR marker is developed

The SSR marker of public collection of illustrative plates is integrated with Rice Genome Sequence, downloads the BAC/PAC near mutational site Cloned sequence.With SSRHunter (Li Qiang etc., heredity, 2005,27 (5):808-810) or SSRIT online softwares (http:// Archive.gramene.org/db/markers/ssrtool) potential SSR sequences (number of repetition >=6) in search clone； These SSR and its neighbouring 400~500bp sequence are carried out with corresponding long-grained nonglutinous rice sequence online in NCBI by blast program Compare, if both SSR numbers of repetition it is variant, tentatively infer the SSR primers PCR primer exist between Xian, round-grained rice it is polymorphic Property；The Software for Design SSR primers of Primer Premier 5.0 are recycled, and are synthesized by Shanghai Ying Jun Bioisystech Co., Ltd. The paired primer equal proportions of the SSR of designed, designed are mixed, detect its polymorphism between N22 and Nipponbare, performance is more State person is used as the molecular labeling of finely positioning.Molecular labeling for finely positioning is shown in Table 1.

Table 1 is used for the molecular labeling of finely positioning

2nd, the acquisition of silty gene

By to the sequencing in 79kb sections, it was found that the mutation of a single base be present in cyMDH genes,

It is as described below according to the primers announced on the net, sequence：

primer1：5'CTCCTCCTCCTCCCTAAC 3'(SEQ ID NO.4)；

primer2：5'TCACTATCTGTCCCTCTGG 3'(SEQ ID NO.5).

Using primer1 and primer2 as primer, using endosperm cDNA in N22 development as template, enter performing PCR amplification and obtain Target gene.Amplified reaction is carried out in PTC-200 (MJ Research Inc.) PCR instrument：94℃3min；94 DEG C of 30sec, 60 DEG C of 45sec, 72 DEG C of 10min, 35 circulations；72℃5min.PMD18-T (Japan will be connected to after PCR primer recovery purifying In Takara companies), conversion bacillus coli DH 5 alpha competent cell (Beijing Tiangen company CB101), select positive colony Afterwards, it is sequenced.

Sequencing results show that the fragment that PCR reactions obtain has the nucleotide sequence shown in SEQ ID NO.2, compiles The protein of 332 amino acid residue compositions of code (see the SEQ ID NO.3 of sequence table).By the albumen shown in SEQ ID NO.3 OscyMDH is named as, the encoding gene of the albumen shown in SEQ ID NO.3 is named into OscyMDH.

Embodiment 2, the acquisition and identification of genetically modified plants

First, recombinant expression carrier is built

Using N22 (coming from rice institute of Agricultural University Of Nanjing germplasm resource bank) genomic DNA as template, enter performing PCR amplification OscyMDH genes are obtained, PCR primer sequence is as follows：

primer3：

5'CCGGCGCGCCAAGCTTAAGTAATTTGGGAAAGAGG 3'(SEQ ID NO.6)；

primer4：

5'GAATTCCCGGGGATCCTTAGTTGAGGCATGAGTAAG 3'(SEQ ID NO.7)。

Above-mentioned primer is located at the upstream 2kb of gene and downstream 1.5kb, amplified production shown in SEQ ID NO.2 and contains this The startup subdivision of gene, by PCR primer recovery purifying.Will using INFUSION recombination kits (Japanese Takara companies) PCR primer is cloned into carrier pCAMBIA1390.INFUSION recombining reactions system (10 μ L)：The μ L of PCR primer 1.0, The μ L of 6.0 μ L, 5 × infusion buffer of pCAMBIA1305,2.0 μ L, infusion enzyme mix 1.After of short duration centrifugation By the water-bath 15 minutes of 37 DEG C of mixed system, then 50 DEG C of water-baths 15 minutes, 2.5 μ L reaction systems heat shock methods are taken to convert large intestine Bacillus DH5 α competent cells (Beijing Tiangen companies；CB101).Cell will be totally converted and be uniformly coated on card containing 50mg/L On the LB solid mediums of that mycin.After 37 DEG C of culture 16h, picked clones positive colony, it is sequenced.Sequencing result shows, The recombinant expression carrier containing gene shown in SEQ ID NO.1 has been obtained, the pCAMBIA1390 containing OscyMDH has been named as PCAMBIA1390-OscyMDH, OscyMDH genetic fragment are inserted using INFUSION recombination kits (Japanese Takara companies) Enter between HindIII the and BamHI restriction enzyme sites of the carrier..

2nd, the acquisition of recombinational agrobacterium

PCAMBIA1390-OscyMDH is converted into Agrobacterium EHA105 bacterial strains (being purchased from handsome company of the U.S.) with electric shocking method, Recombinant bacterial strain is obtained, extraction plasmid enters performing PCR and digestion identification.PCR and digestion are identified that correct recombinant bacterial strain is named as EH-pCAMBIA1390-OscyMDH。

Agrobacterium EHA105 bacterial strains are converted by the use of pCAMBIA1390 as control vector, method is same as above, obtains turning empty carrier pair According to bacterial strain.

3rd, the acquisition of genetically modified plants

EH-pCAMBIA1390-OscyMDH is dashed forward with the reduction of empty vector control bacterial strain rice transformation content of starch is turned respectively Variant N65, specific method are：

(1) 28 DEG C is cultivated EH-pCAMBIA1390-OscyMDH (or turning empty vector control bacterial strain) 16 hours, collects thalline, And it is OD600 ≈ 0.5 to be diluted in N6 fluid nutrient mediums (Sigma companies, C1416) to concentration, bacterium solution is obtained；

(2) the bacterium solution mixed infection to the N65 Mature Embryos of Rice embryo callus of one month and step (1) will be cultivated 30min, filter paper are transferred in co-cultivation culture medium (N6 solid co-cultivation mediums, Sigma companies) after blotting bacterium solution, and 24 DEG C altogether Culture 3 days；

(3) callus of step (2) is seeded on the N6 solid screening and culturing mediums containing 100mg/L hygromycin and sieved for the first time Select (16 days)；

(4) picking health callus is transferred to programmed screening on the N6 solid screening and culturing mediums containing 100mg/L hygromycin, often 15 days subcultures are once；

(5) picking health callus is transferred on the N6 solid screening and culturing mediums containing 50mg/L hygromycin and screened for the third time, often 15 days subcultures are once；

(6) picking kanamycin-resistant callus tissue is transferred on differential medium and broken up；Obtain the T of seedling differentiation₀For positive plant.

4th, the identification of transfer-gen plant

1st, PCR Molecular Identifications

Hygromycin marker identification transfer-gen plant is utilized in this research.

The PCR reaction systems of labeled analysis：DNA (20ng/ μ L) 2 μ L, Primer3 (10pmoL/ μ L) 2 μ L, Primer4 (10pmol/ μ L) 2 μ L, 10xBuffer (MgCl₂Free) 2 μ L, dNTP (10mM) 0.4 μ L, MgCl₂(25mM) 1.2 μ L, rTaq (5U/ μ L) 0.4 μ L, ddH₂The μ L of O 10, the μ L of cumulative volume 20.

Amplified reaction is carried out in PTC-200 (MJ Research Inc.) PCR instrument：94℃3min；94 DEG C of 30sec, 55 DEG C (primer different, adjusted) 45sec, 72 DEG C of 2.5min, 35 circulations；72℃5min.

PCR primer purifying recovery, is carried out by kit (Beijing Tiangen companies) step.With 8% Native PAGE glue Separation, silver staining.Determine transgenic positive plant.

2nd, phenotypic evaluation

Respectively by T₀In generation, turns pCAMBIA1390-OscyMDH positive plants, T₀In generation, turns empty vector control plant, mutant N65 It is planted in N22 in the transgenosis field of Agricultural University Of Nanjing's soil bridge rice breeding base.After seed maturity, each material seed is collected, It was observed that occur transparent seed (Fig. 5), further ESEM in the seed of pCAMBIA1390-OscyMDH plant Analysis display, the starch granule morphology for being transferred to pCAMBIA1390-OscyMDH N65 seeds recover to normal level (Fig. 6). Hence it is demonstrated that the mutant phenotype in N65 is as caused by OscyMDH mutation.PCAMBIA1390-OscyMDH can make N65 The Starch synthesis of strain recovers to normal level.

Sequence table

<110>Agricultural University Of Nanjing

<120>A kind of paddy endosperm silty related gene OscyMDH and its encoding proteins matter and application

<160> 7

<210> 1

<211> 3936

<212> DNA

<213>Oryza rice（Oryza sativa var.N22）

<220>

<223>Endosperm silty gene OscyMDH gene order

<400> 1

ctcgcaaaac tcacccaaaa gagcagcgtc gcctctcctc ctcctcccta acccctacgc 60

ttccagaacc ttctcgaagc tcccgctccc cccccccttc cgctccaatg gcgaaggaac 120

cgatgcgcgt gctcgtcacc ggcgccgcag gtacggacgg cgtcgcgctc gcctcacttc 180

cccctcgttc tcttggtttg ccgacgcgat ctcgtgcggg gggcggtggc tcggatctgg 240

ctgcagatcc gcgccgatcc agtggagggt ttcgagtgtg gtggttgtag atagctagat 300

ctcgttgtgt ggcggttgat ctggttgggg ggggggtgcg gattatttag tgggagaagg 360

tcactggcgt gatttgattt cggtactaag ttttgtggtt cgtggattgg atgagctcat 420

ctgatggtgg gttgtattag atctggttat tatggtcgct tgatctggtt ttcgggggac 480

tgattttgct tagtttgtga tagttgactc gagtttgtgt taagtctgtg catgaggttt 540

tagtgggggt ttagtggaga tccatgtgta tttcttttga tctgtagggg tttgagtggt 600

ttgaaatgga tcatggtgtc gatttgatga gtgggagtgt gggattccat agttagaggt 660

gggaggttag tcttataggt taaaagggtt taggagggtt tacctattaa tctgttaatc 720

aaatgatccg atgggagcta gtcacagttg tgagcttggt tctcaaagac atacactgat 780

aacttgagat gtttgtcttg aaacatgcat ttaatttagt ttagctctgg agggtgtgtc 840

ccttcaattt ggccccacaa aactgtttgg gatcgggttt gtattccgtc aagttctggc 900

atgtcttatc ccagctcagg attcaactgc aaaaattatc atgcatccat atagtgatag 960

tgactttgat ccaaaattcc gtcgtagatt ctccatctgg gatttggcag gatatcttgg 1020

catttaaaca tttaaatcta aataattaaa ttgcattgca catgcttaat aagtgggatt 1080

agcaccaaat tgtagggtac taataaggaa aaggctatgc atactaactt tttcttacta 1140

aattcttatt actaacactg atatgtcatg ctatgagtgc gtctaaattt tttataactt 1200

ccatctacta aaatcaaatg gttgagatga ttgttagtaa aagtttagta agaaaaattt 1260

agtatgtgta gcagtgctcg tgctaaaaat tgatctacac aagttggggt tcttaaacca 1320

agatataaat ggtttttgtt tatccatctc attctaatct cttgtctagt gtgatccata 1380

gttagaattg ctaaattgct ataaatattt tctttcaaca gctgaaaact atcactgtct 1440

tgttaactta aactagtttg ccttcattgt tatgaaagct tcatttttct gatgtatgct 1500

tatgccagat gggaacctag ctggcaatta attgaattag ttagttcaat ctgatgtggt 1560

gtgcacttca caaacacttt tgtaatgtgg tctgaggtcc tcttgtacgt ggaaaggggt 1620

gctttgttct ccacttagga gctcgggcat tggaaatgta actgattgtt ggttagtaca 1680

ctctgaatcc cactcttagc caggttggat caggtgaagc cctgaggagg ggccactagc 1740

tttcttttgg gtgctttcac gaatgatgat aataggtgat atggtaatca gcatgaaaac 1800

aaatgtattt ttttatgctc atctggaaat gtagcagtat ttgaaagctg atggtttgca 1860

cttcatatgg aatgcaatac cattgttgct tgtgtgtctt aagaaatttg cacccagggg 1920

ctttcttttg tgagctaatt cattctttta ttccgcagga caaattggat atgctcttgt 1980

ccccatgatt gctaggggtg tgatgttggg tgctgaccag cctgttattc tacacatgct 2040

tgacattcca ccagctactg aatctcttaa tggccttaag atggagctgg ttgatgctgc 2100

atttcctctt ttgaagggta agctggttca ttgaactcaa tttgttttta aactgtcagc 2160

atccttgctg atgtttaaac ttttctgttt tggtgttgta ggaattgtcg caacaactga 2220

tgttgtggag gcctgcactg gtgtgaatgt tgcggttatg gttggtgggt tccccaggaa 2280

ggagggaatg gaaaggaagg atgttatgtc aaaaaatgtc tccatctaca aatcccaagc 2340

ttctgctctt gaggctcatg cagcccctaa ctgcaaggta tggaaatatt tcaaatgtag 2400

tttgcaattt actgcaatga ttgtcaagtt gccagcattg ctctcacctt gagtagcaat 2460

cacatgtaat gctataatgc ataataattc agtcttatca tcatttatag tttatgagat 2520

tgatcactcc attattttcc tatttgatta tgcattacca aattcaatta ttttaaactt 2580

gaaaaagcac ttatcaaatt caattatttt gaagttgcct gtaaatccat gtgaagttaa 2640

ttctttctca actttctaat tagagattta taatgttcgg ctgtaccttt tatttttcag 2700

gttctggtag ttgccaatcc agcaaacacc aacgctctca tcttaaaaga attcgctcca 2760

tccatccctg agaagaacat tacttgcctc acccgtcttg accacaacag ggcacttggc 2820

cagatctctg aaaaacttaa tgtccaagtt actgatgtga agaatgcgat catctggggc 2880

aaccactcat ccacccagta ccctgatgtt aaccacgcca ctgtgaagac tcccagtgga 2940

gagaagcctg tcagggaact cgttgctgat gatgagtggt aaatcagaaa tgctgcatat 3000

attaaaaaaa agtagttttt gtttttgttc atatttccat tgcatatgga tttaatggtg 3060

gtctctcaaa caggttaaat acggaattca tctctaccgt ccagcagcgt ggtgccgcca 3120

tcatcaaggc gaggaagcaa tccagtgccc tatctgctgc cagctctgca tgcgatcaca 3180

ttcgtgactg ggttcttggc actcctgagg tctgtttggc cttttgacat tccatgtctt 3240

ttcctcctaa ttttacttta gacatttccc tcaattcggt cctaattatt catcaacacg 3300

ttcaactttt caccacaggg aacatttgtc tccatgggtg tgtactctga tggttcgtat 3360

ggtgtgcctg ctggtctgat ctactcgttc ccgagtaaca tgcagtggtg gcgaatggac 3420

gattgttcag ggtatgcttg cttaccttct ttctacatgt tcatgggctg tctgttaaaa 3480

tgtgccaatg tatagagtat tgcgctgatt atgtcgcaac agtttacaaa tgcctgatga 3540

tctatcgttt cttacaggtc tcccgatcga cgagttctca aggaagaaga tggacgcgac 3600

tgcccaggag ctgtcggagg agaagacgct cgcttactca tgcctcaact aaaactaagc 3660

aatacccaga gggacagata gtgagcgatt gcccgctccc gtgtttttga ataaaagaga 3720

cttttaagtt ccatcacata gaaactgttt atctcagacc gctgcacatc gcgagatgtg 3780

gagcgcagat gccgttgctg gttttactcc agtgtgtatt gaggctttgt actagctccc 3840

ttttttttgc ctggtgattc gcaggacatt tgctgaaaac attgaaccca tttgacatct 3900

gatggaatca tggaccagta gcaagtacat tttgcg 3936

<210> 2

<211> 999

<212> DNA

<213>Oryza rice（Oryza sativa var.N22）

<220>

<223>Endosperm silty gene OscyMDH CDS sequences

<400> 2

atggcgaagg aaccgatgcg cgtgctcgtc accggcgccg caggacaaat tggatatgct 60

cttgtcccca tgattgctag gggtgtgatg ttgggtgctg accagcctgt tattctacac 120

atgcttgaca ttccaccagc tactgaatct cttaatggcc ttaagatgga gctggttgat 180

gctgcatttc ctcttttgaa gggaattgtc gcaacaactg atgttgtgga ggcctgcact 240

ggtgtgaatg ttgcggttat ggttggtggg ttccccagga aggagggaat ggaaaggaag 300

gatgttatgt caaaaaatgt ctccatctac aaatcccaag cttctgctct tgaggctcat 360

gcagccccta actgcaaggt tctggtagtt gccaatccag caaacaccaa cgctctcatc 420

ttaaaagaat tcgctccatc catccctgag aagaacatta cttgcctcac ccgtcttgac 480

cacaacaggg cacttggcca gatctctgaa aaacttaatg tccaagttac tgatgtgaag 540

aatgcgatca tctggggcaa ccactcatcc acccagtacc ctgatgttaa ccacgccact 600

gtgaagactc ccagtggaga gaagcctgtc agggaactcg ttgctgatga tgagtggtta 660

aatacggaat tcatctctac cgtccagcag cgtggtgccg ccatcatcaa ggcgaggaag 720

caatccagtg ccctatctgc tgccagctct gcatgcgatc acattcgtga ctgggttctt 780

ggcactcctg agggaacatt tgtctccatg ggtgtgtact ctgatggttc gtatggtgtg 840

cctgctggtc tgatctactc gttcccggta acatgcagtg gtggcgaatg gacgattgtt 900

cagggtctcc cgatcgacga gttctcaagg aagaagatgg acgcgactgc ccaggagctg 960

tcggaggaga agacgctcgc ttactcatgc ctcaactaa 999

<210> 3

<211> 332

<212> PRT

<213>Oryza rice（Oryza sativa var.N22）

<220>

<223>Endosperm silty gene OscyMDH amino acid sequences

<400> 3

Met Ala Lys Glu Pro Met Arg Val Leu Val Thr Gly Ala Ala Gly Gln

1 5 10 15

Ile Gly Tyr Ala Leu Val Pro Met Ile Ala Arg Gly Val Met Leu Gly

20 25 30

Ala Asp Gln Pro Val Ile Leu His Met Leu Asp Ile Pro Pro Ala Thr

35 40 45

Glu Ser Leu Asn Gly Leu Lys Met Glu Leu Val Asp Ala Ala Phe Pro

50 55 60

Leu Leu Lys Gly Ile Val Ala Thr Thr Asp Val Val Glu Ala Cys Thr

65 70 75 80

Gly Val Asn Val Ala Val Met Val Gly Gly Phe Pro Arg Lys Glu Gly

85 90 95

Met Glu Arg Lys Asp Val Met Ser Lys Asn Val Ser Ile Tyr Lys Ser

100 105 110

Gln Ala Ser Ala Leu Glu Ala His Ala Ala Pro Asn Cys Lys Val Leu

115 120 125

Val Val Ala Asn Pro Ala Asn Thr Asn Ala Leu Ile Leu Lys Glu Phe

130 135 140

Ala Pro Ser Ile Pro Glu Lys Asn Ile Thr Cys Leu Thr Arg Leu Asp

145 150 155 160

His Asn Arg Ala Leu Gly Gln Ile Ser Glu Lys Leu Asn Val Gln Val

165 170 175

Thr Asp Val Lys Asn Ala Ile Ile Trp Gly Asn His Ser Ser Thr Gln

180 185 190

Tyr Pro Asp Val Asn His Ala Thr Val Lys Thr Pro Ser Gly Glu Lys

195 200 205

Pro Val Arg Glu Leu Val Ala Asp Asp Glu Trp Leu Asn Thr Glu Phe

210 215 220

Ile Ser Thr Val Gln Gln Arg Gly Ala Ala Ile Ile Lys Ala Arg Lys

225 230 235 240

Gln Ser Ser Ala Leu Ser Ala Ala Ser Ser Ala Cys Asp His Ile Arg

245 250 255

Asp Trp Val Leu Gly Thr Pro Glu Gly Thr Phe Val Ser Met Gly Val

260 265 270

Tyr Ser Asp Gly Ser Tyr Gly Val Pro Ala Gly Leu Ile Tyr Ser Phe

275 280 285

Pro Val Thr Cys Ser Gly Gly Glu Trp Thr Ile Val Gln Gly Leu Pro

290 295 300

Ile Asp Glu Phe Ser Arg Lys Lys Met Asp Ala Thr Ala Gln Glu Leu

305 310 315 320

Ser Glu Glu Lys Thr Leu Ala Tyr Ser Cys Leu Asn

325 330

<210> 4

<211> 18

<212> DNA

<213>Artificial sequence

<220>

<223> Primer1

<400> 4

ctcctcctcc tccctaac 18

<210> 5

<211> 19

<212> DNA

<213>Artificial sequence

<220>

<223> Primer2

<400> 5

tcactatctg tccctctgg 19

<210> 6

<211> 35

<212> DNA

<213>Artificial sequence

<220>

<223> Primer3

<400> 6

ccggcgcgcc aagcttaagt aatttgggaa agagg 35

<210> 7

<211> 36

<212> DNA

<213>Artificial sequence

<220>

<223> Primer4

<400> 7

gaattcccgg ggatccttag ttgaggcatg agtaag 36

Claims

A kind of 1. gene, it is characterised in that：The gene be it is following 1) or 2) or 3) or 4) shown in DNA molecular：

1) DNA molecular shown in SEQ ID NO.1；

2) DNA molecular shown in SEQ ID NO.2；

1) or 2) 3) DNA points with albumen described in the DNA sequence dna hybridization limited and coding SEQ ID NO.3 under strict conditions Son；

1) or 2) or 3) 4) DNA sequence dna with limiting has more than 90% homology, and the DNA of coding Starch synthesis GAP-associated protein GAP Molecule.
2. the protein of gene code described in claim 1.
3. a kind of protein, it is characterised in that selected from any as shown in (a) or (b)：

(a) protein being made up of the amino acid sequence shown in SEQ ID NO.3；

(b) by SEQ ID NO.3 amino acid sequence by one or several amino acid residues substitution and/or missing and/or Addition and the protein as derived from SEQ ID NO.3 related to Starch synthesis.
4. recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterium containing gene described in claim 1.
5. recombinant expression carrier according to claim 4, it is characterised in that：The recombinant expression carrier be The restructuring that gene described in inserting claim 1 between the multiple cloning sites HindIII and BamHI of pCAMBIA1390 carriers obtains Plasmid.
6. expand described in the total length of gene described in claim 1 or the primer pair of its any fragment or finely positioning claim 1 Positioning primer involved by gene.
7. gene described in claim 1, protein described in Claims 2 or 3, recombinant expression carrier, expression described in claim 4 The application of at least one of box, transgenic cell line or recombinant bacterium in plant breeding.
8. application according to claim 7, it is characterised in that gene described in claim 1, egg described in Claims 2 or 3 White matter, at least one of recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterium are being cultivated described in claim 4 Application in the normal genetically modified plants of Starch synthesis.
9. a kind of method for cultivating the normal genetically modified plants of Starch synthesis, is to close channel genes starch described in claim 1 Into in abnormal plant, the normal genetically modified plants of Starch synthesis are obtained.
10. according to the method for claim 9, it is characterised in that：Gene described in claim 1 passes through the institute of claim 4 or 5 Recombinant expression carrier is stated to import in the abnormal plant of Starch synthesis.