CN108795949A - A kind of Rice Leaf tone control related gene OsWSL6 and its coding protein and application - Google Patents

Abstract

The present invention discloses a kind of Rice Leaf tone control related gene OsWSL6 and its coding protein and application, gene OsWSL6 provided by the invention, for it is following 1) or 2) or 3) or 4) described in DNA molecular：1) DNA molecular shown in SEQ ID NO.1；2) DNA molecular shown in SEQ ID NO.2；1) or 2) 3) hybridize under strict conditions with the DNA sequence dna limited and the DNA molecular of encoding said proteins；1) or 2) or 3) 4) there is 90% or more homology with the DNA sequence dna limited, and encodes the DNA molecular of Rice Leaf tone control GAP-associated protein GAP.The present invention also provides the protein of the gene code, the albumen influences plant leaf color, the encoding gene of the albumen is imported in the plant of leaf color albefaction exception, can cultivate the normal genetically modified plants of leaf color.The albumen and its encoding gene can be applied to genetic modification of plants.

Description

A kind of Rice Leaf tone control related gene OsWSL6 and its coding protein and application

Technical field

The invention belongs to genetic engineering fields, and in particular to a kind of Rice Leaf tone control related gene OsWSL6 and its coding Protein and application.

Background technology

Rice is important in the world one of cereal crops, and the whole world has more than the population of half using rice as staple food.? China has more than 60% people using rice as staple food, is important cereal crops.Therefore, the stable high yield of rice is to China's grain Food safety is of great significance.Blade is that plant carries out photosynthetic major organs, and the 95% of rice yield comes from blade Photosynthesis, and it is photosynthetic efficiently dependent on chlorophyll synthesis and chloroplaset normal development.Leaf color is chloroplaset In various pigments general performance, normal rice leaf Determination of Chlorophyll is dominant, is usually expressed as green.

The characteristics of leaf color mutant is that leaf color is changed, and these leaf color changes all occur in seedling stage mostly, It is divided into according to the leaf color difference leaf color mutant in seedling stage：Green changing type (virescent), striped (stripe), albefaction (albino), 6 types such as yellow (chlorina), zebra-stripe (zebra) and yellow spotting (yellow variegated).Leaf variegation is The frequency of mutation is higher in rice and the mutant character of easy identification, mutator often directly or indirectly influence chlorophyll Synthesis and degradation, change chlorophyll content, so leaf color mutant is also referred to as chlorophyll mutation, therefore also someone leaf color Mutant is divided into 4 types：Chlorophyll type is lacked, chlorophyll a type is lacked, lacks chlorophyll b type and chlorophyll increment type.The leaf reported Color mutant, which has, to be much temperature dependent, different according to the response to temperature, and leaf color mutant is divided into：High temperature inducible is low Warm induction type and the blunt type of temperature.

Leaf color mutant phenotype is easy to find, mutator directly or indirectly influences synthesis or the drop of chlorophyll mostly Solution.Leaf color mutant all shows as chlorophyll content decline mostly, and photosynthetic efficiency is lower, and crop yield reduces.With in recent years The utility value of the development of functional genomics and gene design and context, leaf color mutant increasingly attracts attention, and has passed through It is widely used in basic research and production practices.

Invention content

It is an object of the invention to disclose a kind of Rice Leaf tone control related gene OsWSL6 and its coding protein and answer With.

The present invention provides gene OsWSL6, for it is following 1) or 2) or 3) or 4) described in DNA molecular：

1) DNA molecular shown in SEQ ID NO.1；

2) DNA molecular shown in SEQ ID NO.2；

1) or 2) 3) hybridize under strict conditions with the DNA sequence dna limited and the DNA molecular of encoding said proteins；

1) or 2) or 3) 4) there is 90% or more homology with the DNA sequence dna limited, and the regulation and control of coded plant leaf color are related The DNA molecular of albumen.

SEQ ID NO.1 in sequence table, are made of 2994 nucleotide.

The present invention also provides a kind of protein of said gene OsWSL6 codings.

It is any shown in such as (a) or (b) specifically, protein provided by the invention：

(a) protein that amino acid sequence forms shown in SEQ ID NO.3；

(b) substitution by the amino acid sequence of SEQ ID NO.3 by one or several amino acid residues and/or missing And/or it adds and regulates and controls the relevant protein derived from SEQ ID NO.3 with leaf color.

SEQ ID NO.3 in sequence table, are made of 423 amino acid.

The present invention also provides the recombinant expression carrier containing the gene OsWSL6, expression cassette, transgenic cell line or Recombinant bacterium.Recombinant expression carrier containing any description above gene also belongs to protection scope of the present invention.

The recombinant expression carrier of the gene can be contained with existing plant expression vector construction.

The plant expression vector includes double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.The plant Object expression vector also may include 3 ' end untranslated regions of foreign gene, that is, include polyadenylation signals and any other participation MRNA is processed or the DNA fragmentation of gene expression.The bootable polyadenylic acid of polyadenylation signals is added to the 3 ' of mRNA precursor End, such as Agrobacterium crown gall nodule induction (Ti) plasmid gene (such as kermes synzyme Nos genes), plant gene (such as soybean storage egg White gene) 3 ' end transcription non-translational region all have similar functions.

In addition, when using gene constructed plant expression vector of the invention, enhancer, including translational enhancer also can be used Or transcriptional enhancer, these enhancer regions can be ATG initiation codon or neighboring region initiation codon etc., but must be with The reading frame of coded sequence is identical, to ensure the correct translation of entire sequence.The translation control signal and initiation codon Source is extensive, can be natural, can also be synthesis.Translation initiation region can come from transcription initiation region or knot Structure gene.

For the ease of transgenic plant cells or plant are identified and screened, plant expression vector used can be carried out Processing, as be added the coding that can be expressed in plant can generate color change enzyme or luminophor gene (gus gene, Luciferase genes etc.), resistant antibiotic marker (gentamicin marker, kanamycins marker etc.) or anti- Chemical reagent marker gene (such as anti-herbicide gene).From the security consideration of genetically modified plants, any selectivity can be not added with Marker gene directly screens transformed plant with adverse circumstance.

The recombination over-express vector can be in restriction enzyme XbaI and BamHI double digestion carrier The recombination site of pCAMBIA1305.1-GFP is inserted into the recombinant plasmid that the gene (OsWSL6) obtains.It will contain OsWSL6's PCAMBIA1305.1-GFP is named as pCAMBIA1305.1-GFP-OsWSL6.

Expression cassette, transgenic cell line and recombinant bacterium containing any description above gene (OsWSL6) belong to the present invention Protection domain.

The primer pair for expanding the gene (OsWSL6) overall length or any segment also belongs to protection scope of the present invention, described Primer pair preferred Primer1/Primer2, Primer3/Primer4.

The positioning primer (being shown in Table 1) being related to during this gene of finely positioning, InDel primers for this experiment need and The primer of the primer of designed, designed, these designed, designeds also belongs to protection scope of the present invention.

The present invention also provides the gene, the protein, the recombinant expression carrier, expression cassette, transgenic cell The application of at least one of system or recombinant bacterium in plant breeding.

The present invention also provides the gene, the protein, the recombinant expression carrier, expression cassette, transgenic cell The application of at least one of system or recombinant bacterium in cultivating the normal genetically modified plants of rice leaf color.

The present invention also provides a kind of methods for cultivating the normal genetically modified plants of leaf color, are by the channel genes leaf color In abnormal plant, the normal genetically modified plants of leaf color are obtained.

Specifically, the gene can be imported by the recombinant expression carrier in the plant of leaf color exception.

The carrier that foreign gene is expressed in plant can be guided using any type, the gene of encoding said proteins is led Enter plant cell, transgenic cell line and transfer-gen plant can be obtained.The expression vector for carrying the gene can be by using Ti The conventional biology methods such as plasmid, Ri plasmids, plant viral vector, directly delivered DNA, microinjection, conductance, agriculture bacillus mediated Plant cell or tissue are converted, and the plant tissue of conversion is cultivated into plant.The plant host being converted is either list Leaf plant can also be dicotyledon, such as：Tobacco, crowtoe, arabidopsis, rice, wheat, corn, cucumber, tomato, poplar Tree, turfgrass, lucerne place etc..

Advantageous effect：

The present invention is cloned into the gene of control rice leaf color by map-based cloning from rice leaf color mutant OsWSL6 function complementation experiments prove that OsWSL6 is the gene for controlling rice leaf color.Blade transmission electron microscope observing proves the present invention gram Grand gene can influence Development of Chloroplasts, and then regulate and control the color of blade.Therefore using the gene regulation rice chloroplast Development improves photosynthetic efficiency, increases rice yield.In addition to this gene mutation body inheritance stability can be used as label For in production practices.

Description of the drawings：

Fig. 1 is the leaf color phenotype of wild type NIP and mutant wsl6.

Fig. 2 is the measuring chlorophyll content of wild type NIP and mutant wsl6.

Fig. 3 is wild type NIP and mutant wsl6 chloroplaset transmission electron microscope observings.

Fig. 4 is finely positionings of the OsWSL6 on Chromosome 5 of Rice.

Fig. 5 is the large fragment insertion point of wsl6 genes in mutant.

Fig. 6 is the T for turning pCAMBIA1305.1-GFP-OsWSL6₀For the phenotype of plant.

Specific implementation mode

Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly What routine biochemistry reagent shop was commercially available.

The discovery of embodiment 1, rice fecula synthesis related locus and its encoding gene

One, the phenotype of rice leaf color mutant wsl6 and genetic analysis

In the leaf color mutant that tissue cultures generate, a leaf color albino mutant is filtered out, wsl6 is named as.

Compared with Nipponbare (NIP), wsl6's is mainly characterized by：Seedling shows the phenotype of albefaction leaf color (see figure 1), while blade Determination of Chlorophyll content declines (see Fig. 2).Green is presented in the seedling of NIP, and white is presented in wsl6 seedling.This explanation Gene mutation affects the content of seedling Determination of Chlorophyll, leads to the phenotype for blade albefaction occurred.

Transmission electron microscope observing (see Fig. 3) is carried out to wild type and mutant wsl6 seedling, it can be seen that the leaf of wild type Green volume morphing is normal, structural integrity, and thylakoid membrane stacks to form fine and close basal granule, and shows as seeing in the seedling chloroplaset of albefaction The presence less than Thylakoids structure is examined, while a large amount of vacuole structure occurs.

Two, the map based cloning of mutant gene locus

1, the positioning of mutator

First, the cross combination F of mutant wsl6 and another wild type N22 have been prepared₁, F is obtained after being selfed a generation₂Kind Son.By F₂Under seed kind, exist by 10 plants of chain determine target gene of extremists progress of standard screening of seedling stage albefaction blade On Chromosome 5 of Rice, using the common primers in laboratory, increases extremists quantity to 46 plants, reduce location area section extremely 10cM completes just positioning.

The blade for obtaining 580 plants of recessive extremists in F2 altogether finally will using common primers and self-designed primer Target gene determination is between marking 5Y-34 and 5Y-37, sector sizes 52kb (Fig. 4).

The method of above-mentioned SSR marker analysis is as described below：

(1) total DNA of above-mentioned selection single plant is extracted as template, and the specific method is as follows：

1. the rice young leaflet tablet for taking 0.2 gram or so is placed in 2.0mL Eppendorf pipes, a steel ball is placed in pipe, The Eppendorf pipes for installing sample are freezed 5min in liquid nitrogen, is placed on 2000 type GENO/GRINDER instruments and crushes sample 1min。

2. 660 μ L extracting solutions (Tris-HCl containing 100mM (pH 8.0), 20mM EDTA (pH 8.0), 1.4M is added The solution of NaCl, 0.2g/mL CTAB), be acutely vortexed in vortex device mixing, ice bath 30min.

3. 40 μ L 20%SDS, 65 DEG C of warm bath 10min are added, every two minutes mixings that gently turn upside down.

4. 100 μ L 5M NaCl, mild mixing is added.

5. 100 μ L 10 × CTAB, 65 DEG C of warm bath 10min are added, it is interrupted the mixing that gently turns upside down.

6. 900 μ L chloroforms are added, mix well, 12000rpm centrifuges 3min.

7. shifting in supernatant to 1.5mL Eppendorf pipes, 600 μ L isopropanols, mixing, 12000rpm centrifugations is added 5min。

8. abandoning supernatant, 70% (volumn concentration) ethyl alcohol of precipitation rinses primary, room temperature airing.

9. it is molten that 100 1 × TE of μ L (121g Tris are dissolved in 1L water, the solution obtained with hydrochloric acid tune pH value to 8.0) are added Solve DNA.

10. taking 2 μ L electrophoresis detection DNA mass, DU800 spectrophotometric determinations concentration (Beckman Instrument are used in combination Inc.U.S.A)。

(2) DNA of said extracted is diluted to about 20ng/ μ L, PCR amplification is carried out as template；

PCR reaction systems (10 μ L)：DNA (20ng/ μ L) 1 μ L, sense primer (2pmol/ μ L) 1 μ L, downstream primer (2pmol/ μ L) 1 μ L, 10 × Buffer (MgCl₂Free) 1 μ L, dNTP (10mM) 0.2 μ L, MgCl₂(25mM) 0.6 μ L, rTaq (5U/ μ L) 0.1 μ L, ddH₂5.1 μ L of O, totally 10 μ L.

PCR response procedures：94.0 DEG C of denaturation 5min；94.0 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, altogether Cycle 35 times；72 DEG C of extension 7min；10 DEG C of preservations.PCR reactions carry out in 96 hole PCR instruments of ABI veriti.

(3) the PCR product detection of SSR marker

Amplified production is analyzed with 8% native polyacrylamide gel electrophoresis.Using the DNA Ladder of 50bp as contrast ratio Compared with the molecular size range of amplified production, silver staining colour developing.

Above-mentioned primer development process is as follows：

(1) SSR marker is developed

The SSR marker of public collection of illustrative plates is integrated with Rice Genome Sequence, downloads the BAC/PAC near mutational site Cloned sequence.With SSRHunter (Li Qiang etc., heredity, 2005,27 (5):808-810) or SSRIT online softwares (http:// Archive.gramene.org/db/markers/ssrtool) potential SSR sequences (number of repetition >=6) in search clone； The sequence of these SSR and its neighbouring 400~500bp are carried out with corresponding long-grained nonglutinous rice sequence in NCBI by blast program online Compare, if the SSR numbers of repetition of the two are variant, tentatively inferring the PCR products of the SSR primers, there are polymorphic between Xian, round-grained rice Property；5.0 Software for Design SSR primers of Primer Premier are recycled, and are synthesized by Shanghai Ying Jun Bioisystech Co., Ltd. The pairs of primer equal proportions of the SSR of designed, designed are mixed, its polymorphism between N22 and Nipponbare is detected, performance is more State person is used as the molecular labeling of finely positioning.Molecular labeling for finely positioning is shown in Table 1.

Table 1 is used for the molecular labeling of finely positioning

Primer	Sense primer (5 ' -3 ')	Downstream primer (5 ' -3 ')
			New5-34	CGCCTGCAAAAAAGGTAGAG	GATCAAAGGAACCCCCGTAG
Indel5-13	TGAGTTTCCGGTGTTCCATA	AAGGCAAAGTCGTTCAGCTT
			5Y-26	AAAACCTGCGACCGAATA	AGGCCAAGGGCTTAGTTG
5Y-29	CGATGGGCTGGAATAGGG	CACGGCGGCTTACAAGAG
			5Y-34	TCCTCCTCCACAATCCATCC	GGTTTCGGCTGCTTCCACT
5Y-37	ATTATTGCACATGGATGC	ATGGACCTTAAGTGTACAGAG
			B-10	ACCTTCCACATACGAGTTTG	GTTCACCATACTTTTCTTCG
B-11	GTAGGACGAGGAGTGTGAT	CCTGGCTAACACAAGAACATC

2, the acquisition of leaf color gene

By to the sequencing in the sections 52kb, it was found that there are a 3655bp pieces in OsWSL6 gene third exons The insertion (Fig. 5) of section.

According to the primers announced on the net, sequence is as described below：

primer1：5'ATGGAGCTAGGCCTCGCGCT 3'(SEQ ID NO.4)；

primer2：5'TCATAGTGCTTGAATCTCCC 3'(SEQ ID NO.5).

Using primer1 and primer2 as primer, the cDNA extracted using the seedling of NIP carries out PCR amplification acquisition as template Target gene.Amplified reaction carries out in 96 hole PCR instruments of ABI veriti：94℃3min；94 DEG C of 30sec, 60 DEG C of 45sec, 72 DEG C 10min, 35 cycles；72℃5min.

It will be connected to after PCR product recovery purifying on pEASY-Blunt (Beijing Quan Shijin biotech companies), conversion is big Enterobacteria DH5 α competent cells (Beijing Tiangen company CB101), after selecting positive colony, are sequenced.

Sequencing results show that the segment that PCR reactions obtain has nucleotide sequence shown in SEQ ID NO.2, compile The protein of code 423 amino acid residues composition (see the SEQ ID NO.3 of sequence table).By albumen shown in SEQ ID NO.3 It is named as OsWSL6, the encoding gene of albumen shown in SEQ ID NO.3 is named into OsWSL6.

The acquisition and identification of embodiment 2, genetically modified plants

One, recombinant expression carrier is built

Using the cDNA of NIP as template, carries out PCR amplification and obtain OsWSL6 genes, PCR primer sequence is as follows：

primer3：

5'CGGAGCTAGCTCTAGAATGGAGCTAGGCCTCGCGCT 3'(SEQ ID NO.6)；

primer4：

5'TGCTCACCATGGATCCTAGTGCTTGAATCTCCCCTC 3'(SEQ ID NO.7)。

Above-mentioned primer is located at the ends 5' and 3' of gene shown in SEQ ID NO.2, by PCR product recovery purifying.Using PCR product is cloned into carrier pCAMBIA1305.1-GFP by Infusion recombination kits (Japanese TaKaRa companies). Infusion recombining reactions system (10 μ L)：PCR product 1.0 μ L, pCAMBIA1305.1-GFP 6.0 μ L, 5 × infusion 2.0 μ L, infusion enzyme mix of buffer, 1 μ L.By the water-bath 15 minutes of 37 DEG C of mixed system after of short duration centrifugation, then 50 DEG C of water-baths 15 minutes take 2.5 μ L reaction system heat shock methods conversion bacillus coli DH 5 alpha competent cell (Beijing Tiangen Company；CB101).Cell will be totally converted to be uniformly coated on the LB solid mediums of the kanamycins containing 50mg/L.37 DEG C of cultures After 16h, picking positive colony is sequenced.Sequencing result shows to have obtained the recombination containing gene shown in SEQ ID NO.1 PCAMBIA1305.1-GFP containing OsWSL6 is named as pCAMBIA1305.1-GFP-OsWSL6, OsWSL6 by expression vector Genetic fragment is inserted into XbaI the and BamHI digestions position of the carrier using INFUSION recombination kits (Japanese TaKaRa companies) Between point.

Two, the acquisition of recombinational agrobacterium

PCAMBIA1305.1-GFP-OsWSL6 conversion Agrobacterium EHA105 bacterial strains (are purchased from the handsome public affairs in the U.S. with freeze-thaw method Department), recombinant bacterial strain is obtained, extraction plasmid carries out PCR and digestion identification.PCR and digestion are identified into correct recombinant bacterial strain name For EH-pCAMBIA1305.1-GFP-OsWSL6.

With pCAMBIA1305.1-GFP, carrier converts Agrobacterium EHA105 bacterial strains as a contrast, and method is same as above, and obtains turning sky Vehicle Control bacterial strain.

Three, the acquisition of genetically modified plants

EH-pCAMBIA1305.1-GFP-OsWSL6 and empty vector control bacterial strain rice transformation leaf color mutant will be turned respectively WSL6, specific method are：

(1) 28 DEG C is cultivated EH-pCAMBIA1305.1-GFP-OsWSL6 (or turning empty vector control bacterial strain) 16 hours, is collected Thalline, and be diluted in N6 fluid nutrient mediums (Sigma companies, C1416) to a concentration of OD600 ≈ 0.5, obtain bacterium solution；

(2) by culture to the bacterium solution mixed infection of one month wsl6 Mature Embryos of Rice embryo callus and step (1) 30min, filter paper are transferred to after blotting bacterium solution in co-cultivation culture medium (N6 solid co-cultivation mediums, Sigma companies), 24 DEG C of trainings altogether It supports 3 days；

(3) callus of step (2) is seeded on the N6 solid screening and culturing mediums containing 100mg/L hygromycin and is sieved for the first time It selects (16 days)；

(4) picking health callus is transferred to programmed screening on the N6 solid screening and culturing mediums containing 100mg/L hygromycin, often Subculture is primary within 15 days；

(5) picking health callus is transferred on the N6 solid screening and culturing mediums containing 50mg/L hygromycin and screens for the third time, often Subculture is primary within 15 days；

(6) picking kanamycin-resistant callus tissue is transferred on differential medium and breaks up；Obtain the T of seedling differentiation₀For positive plant.

Four, the identification of transfer-gen plant

1, PCR Molecular Identifications

In this research transfer-gen plant is identified using Hygromycin marker.

The PCR reaction systems of labeled analysis：DNA (20ng/ μ L) 2 μ L, Primer3 (10pmoL/ μ L) 2 μ L, Primer4 (10pmol/ μ L) 2 μ L, 10xBuffer (MgCl₂Free) 2 μ L, dNTP (10mM) 0.4 μ L, MgCl₂(25mM) 1.2 μ L, rTaq (5U/ μ L) 0.4 μ L, ddH₂10 μ L of O, 20 μ L of total volume.

Amplified reaction carries out in 96 hole PCR instruments of ABI veriti：94℃3min；94 DEG C of 30sec, 55 DEG C (primer is not Together, adjusted) 45sec, 72 DEG C of 2.5min, 35 cycles；72℃5min.

PCR product purifying recycling, is carried out by kit (Beijing Tiangen companies) step.With 8% Native PAGE glue Separation, silver staining.Determine transgenic positive plant.

2, phenotypic evaluation

T₀The green of normal plant is shown for pCAMBIA1305.1-GFP-OsWSL6 positive plants in transfer-gen plant, are turned Color leaf morphology, the adjoining tree for turning sky pCAMBIA1305.1-GFP carriers still show as the leaf morphology (Fig. 6) of albefaction.Cause This proves that the mutant phenotype in wsl6 is as caused by the mutation of OsWSL6.PCAMBIA1305.1-GFP-OsWSL6 can make The leaf color of wsl6 strains is restored to normal level.

Sequence table

<110>Agricultural University Of Nanjing

<120>A kind of Rice Leaf tone control related gene OsWSL6 and its coding protein and application

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2994

<212> DNA

<213>Oryza rice (Oryza sativavar.Nipponbare)

<400> 1

tttattgggc cggcccaaga gaagaaaaac gagtggcaaa taggcggtat catctcgcat 60

ttcactattt gccactcgtg tgtctatgac atgtgggccc gggacccaca tgtcataatc 120

cctcttatcc ccttctgctg cggcgagcca cactcccaag ccgaggagct ctcgcttgcg 180

acagccatgg agctaggcct cgcgctgcgg ctcgtcgcgc cgccgcctcg tctcccctgt 240

agagctctcc agccgccgcc gatgccttgt ttctctccgt gtgcggcccg aagaagccgc 300

atccgctcct cgaggttgga gcgcagggtt ggggttgttg tatccggtgg gagtatggct 360

tccttggcaa tggaggagga ggaagaggaa gagtgggaag aagcggagga agaagcggaa 420

ggatggcaag aggaggaggc tgcagtggtg acgacgaggc cgcgtctgga gctcatcgag 480

aagccggacc ggagcctgtg tctgctcgac gagtacgagt cggaggagct aggcacctct 540

cattgtgcca accaccgcag cggtgaggct tctagcttct gtgaaattca cctcttcatt 600

tcgattctga aataacagcc tttttagttt atgatctcca aatgaaacta ttctgcagat 660

gaatattttt tcatgttgtt gtaatattga tataccatgt gtttgcacag gttatgttgc 720

tgtattagga aagccaaatg ttggaaagag caccctaatt aaccaaattg ttggtcagaa 780

actttcaatt gtgacagaca aaccgcaaac cacacggcat cgcattcttg gtatatgttc 840

tgaaccagaa taccaggtat caccttttag tttctaaagc tttaggatta tagactatga 900

aagggggaaa tgttaatttc tcactgctaa tctgagttat catttagttt gcagataata 960

ctttatgaca cgccaggtgt catcaaaaag gaaatgcata agctagacac aatgatgatg 1020

aagaatgtta ggagtgccgt tggcagtgca gattgtgtgc ttgttgttgt tgatgcttgc 1080

aaaatgcctg aaaaggtatt gcaacatagg aaagagatga ctgaattatg aaaaaaaaat 1140

tattatgcca atatacaatc taaaattctg acatttgtac cttttagatt gatgaaatac 1200

tggaagaagg tgtggggaac aaagatactg agcttccagt actgttggta ttaaacaaga 1260

aagatctcat aaagccagga gaaattgcaa agaaacttga ggtaaaatat cgttacaaaa 1320

atttggagat ggttttgttt ttccctctac ttcgatgtaa ttgatttact ggctacgatt 1380

ttcacagtgg tatcaaaaat tcactaatgc tgatgacgtc atacctataa gtgctaaatt 1440

tgggcatgga gtggatgata tcaaggagtg gatattatca aagctccctc tggggcctgc 1500

ttactatcca aaggtattgg tgtattagat gaattttttt ttcttattct atttctgcaa 1560

gtgtttcttc atctttggca caaatttttc tgtactcatg taaaaccaga tagccatagt 1620

gtgactataa tatgtctttt ccatagcatc atgtttgttc tttagatagt gctactcacg 1680

atatccagtg cttgctttga tgtttaactg cagccaataa atactgatac tacaagatat 1740

caaatatatt tgttcatgtg attctcgttc caggacatag ctagtgagca ccctgagaga 1800

ttttttgtgg gggaaatagt gagagaaaag atttttcttc agtatcgtca agaaattcca 1860

tatgcttgtc aggtatatct tctggtgctt gcacctatca attttgtgcg gcatttttct 1920

gccagcatgt gtcagatgtg cgactttgtt tatgacaggt taatgtcata agttacaaga 1980

gcagacctac agccaaggat tttattcaag ttgagatact cgttgagaag gaatcacaaa 2040

gaagcattat acttgggaag gtaaaaaaaa tagtaaaaca gtacctttgt gcgcctgaat 2100

atttcaggat tttatggtta cgaaatcagt taagtttaat ctttttcaag ttaacattga 2160

gtatagctaa ggaaaatacc ataacttggg gtgcatattt gggtagaatg aagcagtttc 2220

atgaaatcat cttatttgca ttgctttagt gggatatatt tttgtaacat gtttggcaac 2280

tgcaggatgg aaaagcaatc aagatgctag caacagcatc aagacttgat atcgaggatt 2340

tcctacaaaa gaaggtctat cttgaggtag taactgcttc ctttgtttgg aggctgtgaa 2400

attttgatct accttgagga tttgttctga gcagtttcct aatatcaaat atactatata 2460

ttggacagat aatggtcaag gtgaaggaaa actggcggca ggatgaactt cttttgaagc 2520

gttatggcta tggaggggag attcaagcac tatgaccatc agattgttat gcaggctgtc 2580

acagctagga gtaatttacc tttttttttc tgttagcttt gtttatgatt gaggtgatga 2640

gtgaaggtcg aattagctcg gtaattagtg aggtatctcc acaaaatttt gtgtgcccac 2700

tctattattg catagatgta catctgttgt atcatgaaac tgatgtttct aatagaaaga 2760

aacatagttc tggtctgtat cattggatgg ttgaaagcca agtcagtact agtagctgat 2820

tggaggcaat ccttttgcga gataaaaccc aaggagaaga gaaaagaaaa tactggggca 2880

cttatagcct gatgggacat ttggcttgag aaaaatgtaa agtttttgaa tatgttcatc 2940

aacatgtaga cggcggcttt ggtgataaac atgtagacgg cggctttggt gata 2994

<210> 2

<211> 1272

<212> DNA

<213>Oryza rice (Oryza sativavar.Nipponbare)

<400> 2

atggagctag gcctcgcgct gcggctcgtc gcgccgccgc ctcgtctccc ctgtagagct 60

ctccagccgc cgccgatgcc ttgtttctct ccgtgtgcgg cccgaagaag ccgcatccgc 120

tcctcgaggt tggagcgcag ggttggggtt gttgtatccg gtgggagtat ggcttccttg 180

gcaatggagg aggaggaaga ggaagagtgg gaagaagcgg aggaagaagc ggaaggatgg 240

caagaggagg aggctgcagt ggtgacgacg aggccgcgtc tggagctcat cgagaagccg 300

gaccggagcc tgtgtctgct cgacgagtac gagtcggagg agctaggcac ctctcattgt 360

gccaaccacc gcagcggtta tgttgctgta ttaggaaagc caaatgttgg aaagagcacc 420

ctaattaacc aaattgttgg tcagaaactt tcaattgtga cagacaaacc gcaaaccaca 480

cggcatcgca ttcttggtat atgttctgaa ccagaatacc agataatact ttatgacacg 540

ccaggtgtca tcaaaaagga aatgcataag ctagacacaa tgatgatgaa gaatgttagg 600

agtgccgttg gcagtgcaga ttgtgtgctt gttgttgttg atgcttgcaa aatgcctgaa 660

aagattgatg aaatactgga agaaggtgtg gggaacaaag atactgagct tccagtactg 720

ttggtattaa acaagaaaga tctcataaag ccaggagaaa ttgcaaagaa acttgagtgg 780

tatcaaaaat tcactaatgc tgatgacgtc atacctataa gtgctaaatt tgggcatgga 840

gtggatgata tcaaggagtg gatattatca aagctccctc tggggcctgc ttactatcca 900

aaggacatag ctagtgagca ccctgagaga ttttttgtgg gggaaatagt gagagaaaag 960

atttttcttc agtatcgtca agaaattcca tatgcttgtc aggttaatgt cataagttac 1020

aagagcagac ctacagccaa ggattttatt caagttgaga tactcgttga gaaggaatca 1080

caaagaagca ttatacttgg gaaggatgga aaagcaatca agatgctagc aacagcatca 1140

agacttgata tcgaggattt cctacaaaag aaggtctatc ttgagataat ggtcaaggtg 1200

aaggaaaact ggcggcagga tgaacttctt ttgaagcgtt atggctatgg aggggagatt 1260

caagcactat ga 1272

<210> 3

<211> 423

<212> PRT

<213>Oryza rice (Oryza sativavar.Nipponbare)

<400> 3

Met Glu Leu Gly Leu Ala Leu Arg Leu Val Ala Pro Pro Pro Arg Leu

1 5 10 15

Pro Cys Arg Ala Leu Gln Pro Pro Pro Met Pro Cys Phe Ser Pro Cys

20 25 30

Ala Ala Arg Arg Ser Arg Ile Arg Ser Ser Arg Leu Glu Arg Arg Val

35 40 45

Gly Val Val Val Ser Gly Gly Ser Met Ala Ser Leu Ala Met Glu Glu

50 55 60

Glu Glu Glu Glu Glu Trp Glu Glu Ala Glu Glu Glu Ala Glu Gly Trp

65 70 75 80

Gln Glu Glu Glu Ala Ala Val Val Thr Thr Arg Pro Arg Leu Glu Leu

85 90 95

Ile Glu Lys Pro Asp Arg Ser Leu Cys Leu Leu Asp Glu Tyr Glu Ser

100 105 110

Glu Glu Leu Gly Thr Ser His Cys Ala Asn His Arg Ser Gly Tyr Val

115 120 125

Ala Val Leu Gly Lys Pro Asn Val Gly Lys Ser Thr Leu Ile Asn Gln

130 135 140

Ile Val Gly Gln Lys Leu Ser Ile Val Thr Asp Lys Pro Gln Thr Thr

145 150 155 160

Arg His Arg Ile Leu Gly Ile Cys Ser Glu Pro Glu Tyr Gln Ile Ile

165 170 175

Leu Tyr Asp Thr Pro Gly Val Ile Lys Lys Glu Met His Lys Leu Asp

180 185 190

Thr Met Met Met Lys Asn Val Arg Ser Ala Val Gly Ser Ala Asp Cys

195 200 205

Val Leu Val Val Val Asp Ala Cys Lys Met Pro Glu Lys Ile Asp Glu

210 215 220

Ile Leu Glu Glu Gly Val Gly Asn Lys Asp Thr Glu Leu Pro Val Leu

225 230 235 240

Leu Val Leu Asn Lys Lys Asp Leu Ile Lys Pro Gly Glu Ile Ala Lys

245 250 255

Lys Leu Glu Trp Tyr Gln Lys Phe Thr Asn Ala Asp Asp Val Ile Pro

260 265 270

Ile Ser Ala Lys Phe Gly His Gly Val Asp Asp Ile Lys Glu Trp Ile

275 280 285

Leu Ser Lys Leu Pro Leu Gly Pro Ala Tyr Tyr Pro Lys Asp Ile Ala

290 295 300

Ser Glu His Pro Glu Arg Phe Phe Val Gly Glu Ile Val Arg Glu Lys

305 310 315 320

Ile Phe Leu Gln Tyr Arg Gln Glu Ile Pro Tyr Ala Cys Gln Val Asn

325 330 335

Val Ile Ser Tyr Lys Ser Arg Pro Thr Ala Lys Asp Phe Ile Gln Val

340 345 350

Glu Ile Leu Val Glu Lys Glu Ser Gln Arg Ser Ile Ile Leu Gly Lys

355 360 365

Asp Gly Lys Ala Ile Lys Met Leu Ala Thr Ala Ser Arg Leu Asp Ile

370 375 380

Glu Asp Phe Leu Gln Lys Lys Val Tyr Leu Glu Ile Met Val Lys Val

385 390 395 400

Lys Glu Asn Trp Arg Gln Asp Glu Leu Leu Leu Lys Arg Tyr Gly Tyr

405 410 415

Gly Gly Glu Ile Gln Ala Leu

420

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

atggagctag gcctcgcgct 20

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

tcatagtgct tgaatctccc 20

<210> 6

<211> 36

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

cggagctagc tctagaatgg agctaggcct cgcgct 36

<210> 7

<211> 36

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

tgctcaccat ggatcctagt gcttgaatct cccctc 36

Claims (10)

1. a kind of gene, it is characterised in that：The gene be it is following 1) or 2) or 3) or 4) shown in DNA molecular：

1) DNA molecular shown in SEQ ID NO.1；

2) DNA molecular shown in SEQ ID NO.2；

1) or 2) 3) hybridize under strict conditions with the DNA sequence dna limited and the DNA for encoding albumen described in SEQ ID NO.3 divides Son；

1) or 2) or 3) 4) there is 90% or more homology with the DNA sequence dna limited, and encodes Rice Leaf tone control GAP-associated protein GAP DNA molecular.

2. the protein of gene code described in claim 1.

3. a kind of protein, it is characterised in that any shown in such as (a) or (b)：

(a) protein that amino acid sequence forms shown in SEQ ID NO.3；

(b) by the amino acid sequence of SEQ ID NO.3 by one or several amino acid residues substitution and/or missing and/or Addition and with the relevant protein derived from SEQ ID NO.3 of Rice Leaf tone control.

4. the recombinant expression carrier, expression cassette, transgenic cell line containing gene described in claim 1 or recombinant bacterium.

5. recombinant expression carrier according to claim 4, it is characterised in that：The recombinant expression carrier be The weight that gene obtains described in claim 1 is inserted between the multiple cloning sites XbaI and BamHI of pCAMBIA1305.1-GFP carriers Group plasmid.

6. expanding described in the overall length of gene or the primer pair of its arbitrary segment or finely positioning claim 1 described in claim 1 Positioning primer involved by gene.

7. gene described in claim 1, protein described in Claims 2 or 3, recombinant expression carrier, expression described in claim 4 The application of at least one of box, transgenic cell line or recombinant bacterium in plant breeding.

8. application according to claim 7, it is characterised in that the plant is monocotyledon or dicotyledon.

9. a kind of method of genetically modified plants that cultivating the improvement of rice leaf color, is by channel genes Rice Leaf described in claim 1 In piece albino plant, the normal genetically modified plants of leaf color are obtained.

10. according to the method described in claim 9, it is characterized in that：Gene described in claim 1 passes through claim 4 or 5 institutes Recombinant expression carrier is stated to import in the plant of blade albefaction.