CN105950598A - Rice dormancy interacting protein and encoding gene and application thereof - Google Patents
Rice dormancy interacting protein and encoding gene and application thereof Download PDFInfo
- Publication number
- CN105950598A CN105950598A CN201610567000.9A CN201610567000A CN105950598A CN 105950598 A CN105950598 A CN 105950598A CN 201610567000 A CN201610567000 A CN 201610567000A CN 105950598 A CN105950598 A CN 105950598A
- Authority
- CN
- China
- Prior art keywords
- seq
- gene
- dormancy
- rice
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/8267—Seed dormancy, germination or sprouting
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/01—Carboxy-lyases (4.1.1)
- C12Y401/01031—Phosphoenolpyruvate carboxylase (4.1.1.31)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Physiology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses rice dormancy interacting protein and an encoding gene and application thereof. The protein is a or b, wherein a is composed of an amino acid sequence as shown in SEQ ID NO.1, and b is derived from SEQ ID NO.1 through substitution and/or deficiency and/or addition of one or more amino acid residues and related to rice seed dormancy. The rice seed dormancy interacting protein affects the dormancy of matured seeds. Overexpression of the protein-coding gene can cause increase of dormancy of transgenic plant seeds, so that transgenic plants with proper dormancy can be cultivated and the influence of poor environments on rice yield is reduced. The protein and the encoding gene thereof can be applied to plant genetic improvement.
Description
Technical field
The invention belongs to genetic engineering field, relate to an Oryza sativa L. dormant trait associated protein and encoding gene thereof and application.
Background technology
Seed dormancy generally exists, and species can be made to escape natural disaster, reduces kind of interior competition among individuals and prevents seed not
Opportune season sprouts, be species obtains during long-term evolution a kind of to environment and the adaptability of seasonal variety, be height
Deng plant by gene and the complex character of envirment factor joint effect, there is universal biological significance.Rice paddy seed dormancy is by many
The complex character of Gene Handling, is also economical character important in Oryza sativa L. evolutionary process, and seed dormancy has dual in the course of cultivation
Property: on the one hand, it is desirable to after planting seed can germinate rapidly, neatly；On the other hand, need seed to have certain dormant trait, anti-
Only seed runs into unfavorable weather in the harvest season and produces Spike sprouting, affects yield and quality.
During seed maturity, along with the accumulation of seed storage material, the acquisition of Desiccation-tolerance and the stopping of metabolic activity, seed
Dormancy is formed.Seed dormant formation is regulated and controled jointly by a lot of regulatory factors, the model of action of these regulatory factors and regulation and control water
Flat is different.Phytohormone ABA and GA is seed dormant major regulator, and their effect is mutual antagonism.
The content balance of ABA and GA and the response of signal pathway have important regulating and controlling effect for seed dormant formation, maintenance.?
In plant seed, the hormones such as ABA participates in the maintenance of formation and the dormancy of dormancy, GA then participate in seed dormant abolishing and promoting to plant
Son germinates.Seed germination and dormancy is the quantitative trait typically regulated and controled by polygenes, is highly susceptible to external environmental condition impact,
And quantitative trait locus (QTL) location is the effective ways of research complexity quantitative trait.For the research of Oryza sativa L. dormancy, the most logical
Cross a strong dormancy material and the segregating population of a weak dormancy material construction, individual plant dormant trait each in colony is detected, and ties
Close molecular marker analysis to carry out the site controlling dormant trait just positioning.Then the site that contribution rate is high is selected to carry out follow-up study.Main
Will be by carrying out many for backcrossing with one of them parent, it is thus achieved that comprise only the NIL (NIL) of target site, by NIL
Carry out screening of recombinant with the background parent F2 segregating population obtained that backcrosses, and the offspring of recombinant is carried out phenotype checking, in conjunction with
QTL site is finely positioned by the genotype of recombinant, thus obtains the related gene affecting dormancy phenotype.In recent years, utilize
Different genetical populationes is analyzed by molecular marker, more than 100 QTLs to Oryza sativa L. dormant trait relevant of Primary Location, extensively
It is distributed on 12 chromosomes.But due to seed dormant complexity and being easily affected by the external environment, the QTL detected often is imitated
The highest or unstable expression should be worth, bring difficulty to the finest location and map based cloning, up to the present, only two
QTL is cloned, but it is the most unclear to seed dormant Regulation Mechanism.Wild rice and Weedy Rice have extremely strong Grain Dormancy, past
Toward being used for seed dormant research, but this dormant trait is difficult to abolish, the existence of Linkage drag phenomenon in addition so that these QTL
It is difficult to work with in producing reality.Therefore excavate excellent dormancy QTL, and related gene is studied, the heaviest to Rice Production
Want.
Summary of the invention
It is an object of the invention to provide the albumen that an Oryza sativa L. dormancy is relevant.
It is a further object of the present invention to provide encoding gene and the application of this albumen.
The albumen qSdn-1 relevant to rice paddy seed dormancy, derives from Oryza Oryza sativa L. (Oryza sativa var.N22), have as
Amino acid residue sequence shown in (a) or (b):
A protein that () is made up of the aminoacid sequence shown in SEQ ID NO.1；
B the aminoacid sequence of SEQ ID NO.1 through replacement and/or the disappearance of one or several amino acid residue and/or is added by ()
Add the derivative protein relevant to rice paddy seed dormancy obtained.
Sequence 1 in sequence table is made up of 966 amino acid residues, for phosphoric acid enol pyruvic acid carboxylase family protein.
In order to make the qSdn-1 in (a) be easy to purification, can be made up of the aminoacid sequence shown in SEQ ID NO.1
The amino terminal of protein or carboxyl terminal connect upper label the most as shown in table 1.
The sequence of table 1 label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (usually 5) | RRRRR |
| Poly-His | 2-10 (usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
QSdn-1 in above-mentioned (b) can synthetic, it is possible to first synthesize its encoding gene, then carries out biological expression and obtain.Above-mentioned
B the encoding gene of the qSdn-1 in () can be by lacking one or several aminoacid in the DNA sequence shown in SEQ ID NO.2
The codon of residue, and/or carry out the missense mutation of one or several base pair, and/or connect table 1 at its 5 ' end and/or 3 ' ends
The coded sequence of shown label obtains.
The gene OsqSdn-1 (N22) encoding the above-mentioned albumen relevant to rice paddy seed dormancy falls within protection scope of the present invention.
Described gene is preferably following 1) or 2) or 3) described in DNA molecular:
1) DNA molecular shown in SEQ ID NO.2；
2) DNA molecular shown in SEQ ID NO.3；
3) under strict conditions with 1) or 2) the DNA sequence hybridization that limits and the DNA molecular of encoding said proteins；
4) with 1) or 2) or 3) DNA sequence that limits has more than 90% homology, and coded plant dormancy associated protein
DNA molecular.
Recombinant expression carrier containing gene described in any of the above falls within protection scope of the present invention.
Available existing plant expression vector construction contains the recombinant expression carrier of described gene.
Described plant expression vector can build double base agrobacterium vector.Described plant expression vector also can comprise 3 ' ends of exogenous gene
Untranslated region, i.e. comprises polyadenylation signals and any other participates in mRNA processing or the DNA fragmentation of gene expression.Described poly-
The bootable polyadenylic acid of adenylic acid signal join mRNA precursor 3 ' end, as Agrobacterium crown gall nodule induction (Ti) plasmid gene (as
Kermes synzyme Nos gene), the untranslated region transcribed of plant gene (such as soybean storage protein genes) 3 ' end be respectively provided with similar merit
Energy.
When using described gene constructed recombinant plant expression vector, can open plus any enhancement mode before its transcription initiation nucleotide
Mover or constitutive promoter, such as cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin promoter (Ubiquitin) of Semen Maydis,
They can be used alone or be used in combination with other plant promoter；Additionally, use the gene constructed plant expression vector of the present invention
Time, it be also possible to use enhancer, including translational enhancer or transcriptional enhancer, these enhancer regions can be ATG initiation codon
Or neighboring region start codon etc., but must be identical with the reading frame of coded sequence, to ensure the correct translation of whole sequence.Institute
The source stating translation control signal and start codon is widely, can be natural, it is also possible to be synthesis.Translation initiator
Territory can come from transcription initiation region or structural gene.
For the ease of transgenic plant cells or plant being identified and screening, plant expression vector used can be processed, as
Addition can express coding in plant can produce enzyme or gene (gus gene, the luciferase genes of luminophor of color change
Deng), there is the antibiotic marker thing (Hygromycin marker thing, kanamycin label etc.) of resistance or anti-chemical reagent labelling base
Cause (such as anti-herbicide gene) etc..From the security consideration of transgenic plant, any selected marker can be not added with, directly with
Adverse circumstance screening transformed plant.
Described recombinant expression carrier can be pCUbi 1390 carrier EcoRI recombination site insert described gene (qSdn-1) obtain
Recombiant plasmid.By the pCUbi 1390 named pCUbi 1390-qSdn-1 containing qSdn-1.
Expression cassette, transgenic cell line and recombinant bacterium containing gene described in any of the above (qSdn-1) belongs to the protection of the present invention
Scope.
Expand the primer of described gene (qSdn-1) total length or arbitrary fragment to falling within protection scope of the present invention, described primer
To preferred Primer1/Primer2, Primer3/Primer4 and Primer5/Primer6.
A kind of Oryza sativa L. dormant trait site qSdn-1, its this site is positioned between Indel flag F 19 and F18,29.8kb scope
In；The forward primer of described Indel flag F 19 is as shown in SEQ ID NO.36 in sequence table, in downstream primer such as sequence table
Shown in SEQ ID NO.37；The forward primer of Indel flag F 18 is as shown in SEQ ID NO.34 in sequence table, and downstream primer is such as
In sequence table shown in SEQ ID NO.35.
The location primer (being shown in Table 2) related to during this gene of fine location, in addition to primer RM11669 and RM11694,
Remaining SSR primer and InDel primer are that this experiment needs and the primer of designed, designed, and the primer of these designed, designeds falls within this
Bright protection domain.
Beneficial effect:
The Oryza sativa L. dormant trait associated protein of the present invention affects the dormant trait of rice paddy seed.This albumen of process LAN may result in Grain Dormancy and increases
By force.Described albumen and encoding gene thereof can apply to genetic modification of plants, to obtain the kind with appropriate dormant trait, it is ensured that dislike
Bad Rice under Condition yield and quality is not affected or less affected by impact.
Accompanying drawing explanation
Fig. 1 is N22 and the phenotype analytical of south round-grained rice 35.
A is N22 and the plant type figure of south round-grained rice 35；B is both germination percentages；C is both filling rates；D is both germination phenotypes
Figure；E is the embryo situation of change in both different imbibition stages.
Fig. 2 is NIL building process.
Fig. 3 is NIL and the phenotype analytical of south round-grained rice 35
A is NIL and the plant type figure of south round-grained rice 35；B is both situations at heading stage；C, d are both germination；E is that both are different
The embryo situation of change in imbibition stage；F-l is that both Some Agronomic Traits investigate situation.
Fig. 4 is NIL, south the round-grained rice 35 and phenotype analytical of their F1.
Fig. 5 is fine location and the exchange individual plant checking of qSdn-1.
A is the fine location of qSdn-1；B is exchange individual plant checking
Fig. 6 is over-express vector pCUbi1390 plasmid map.
Fig. 7 is that transfer-gen plant carries out PCR Molecular Detection result.
Swimming lane 1 be do not proceed to the cDNA of OsqSdn-1 (N22) be template amplification as negative control, in addition to 2,25,26,30,
Remaining turns pCUbi1390-qSdn-1 (N22) positive plant for converting 35 strains obtained.
Fig. 8 is partial transgenic plant germination.
The germination percentage of comparison is about 99%, T0The germination percentage of-15 is 71%, T0The germination percentage of-9 is 64%.
Detailed description of the invention
Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experimental technique in following embodiment,
If no special instructions, it is conventional method.Test material used in following embodiment, if no special instructions, is from conventional raw
Change what reagent shop was commercially available.
Embodiment 1, Oryza sativa L. dormant trait related locus and the discovery of encoding gene thereof
One, Oryza sativa L. dormant trait is identified, NIL builds and genetic analysis
N22 is the rice variety with extremely strong dormant trait, and south round-grained rice 35 is the japonica rice variety without dormancy.Collect respectively after earing 35 days
N22 and south round-grained rice 35 seed, choose ripe plump seed and carry out dormant trait detection.Each repetition 50, totally three repetitions, are contained in
Being covered with in the 10cm culture dish of two layers of filter paper, add 10ml water, 30 DEG C of light culture record germination after 7 days.Long with root or bud
Degree exceedes seed half and is designated as germinateing.The germination percentage of N22 is 0%, and the germination percentage of south round-grained rice 35 is close to 100%.Utilize stereomicroscope
Observing the embryo in imbibition period, the embryo of south round-grained rice 35 occurs radicle and the phenomenon of plumule elongation after imbibition 36h, and N22
Embryo after imbibition 48h still without significant change.But both imbibition speed is detected, has no notable difference (see Fig. 1).
The segregating population of N22 with south round-grained rice 35 hybridization acquisition is carried out dormancy phenotypic evaluation, and binding molecule labeled analysis is stopped affecting seed
After the site of moultinism is analyzed, the qSdn-1 choosing contribution rate higher is analyzed.On the south structure, round-grained rice 35 is background parent,
N22 (qSdn-1) is the NIL (NIL) (see Fig. 2) of Insert Fragment.NIL and south round-grained rice 35 are analyzed, NIL dormancy
Property be better than south round-grained rice 35 outside, at agronomy such as plant height, heading stage, filling rate, imbibition speed, tiller number, setting percentage and mass of 1000 kernel
No significant difference in character.Observing imbibition embryo in period, the embryo of NIL starts radicle and plumule occur after imbibition 60h
Change, and the germination percentage of NIL is about 40% (see Fig. 3).To NIL with south round-grained rice 35 backcross obtain F1 be analyzed, its kind
Sub-dormant trait is close to the Grain Dormancy of NIL, so it is considered that rice paddy seed dormant trait is controlled (see Fig. 4) by dominant gene
Two, Oryza sativa L. dormancy site and the acquisition of related gene thereof
1, Oryza sativa L. dormancy site and the fine location of related gene thereof
With NIL with south round-grained rice 35 backcross obtain F2Segregating population 4826 strain, point individual plant takes the blade of each strain, extracts DNA respectively,
SSR marker RM11669 and RM11694 with just location swap individual plant screening, each individual plant are carried out dormant trait detection simultaneously,
Choose the exchange individual plant of extreme phenotype for follow-up test.Next year chooses segregating population 8248 strain, and a point individual plant removes blade and extracts DNA,
Swap individual plant screening with self-developing Indel labelling Y25 and Y37, in conjunction with the dormancy phenotype of each individual plant, choose extreme exchange
Individual plant is used for follow-up test.By this method, Oryza sativa L. dormant trait site qSdn-1 is positioned at independently developed Indel labelling
Between Y78 and Y75.These exchange individual plant offsprings screened are carried out dormant trait detection, and combine the genotype of this exchange individual plant,
The finest location.Finally, Oryza sativa L. dormant trait site-qSdn-1 is positioned between Indel flag F 19 and F18,29.8kb
In the range of (see Fig. 5).
Above-mentioned exchange individual plant offspring's verification method is as follows:
(1) each exchange individual plant for analyzing is planted, each plantation 40 strain
(2) offspring producing exchange individual plant, point individual plant investigates the dormant trait of each individual plant
(3) adding up the phenotype distribution of all offsprings of each exchange individual plant, and be designated as H without dormancy, strong dormancy is designated as L, offspring
Phenotype occurs that separation is designated as S.
The method that above-mentioned SSR marker is analyzed is as described below:
(1) extracting the above-mentioned STb gene of individual plant of choosing as template, concrete grammar is as follows:
1. take the Oryza sativa L. young leaflet tablet of about 0.2 gram, be placed in 2.0ml Eppendorf pipe, pipe is placed a steel ball,
Install Eppendorf pipe freezing 5min in liquid nitrogen of sample, be placed on 2000 type GENO/GRINDER instruments pulverizing sample 1min.
2. add 660 μ l extracting solution (containing 100mM Tris-Hcl (PH 8.0), 20mM EDTA (PH 8.0), 1.4M NaCl,
The solution of 0.2g/ml CTAB), the mixing of violent vortex, ice bath 30min on whirlpool device.
3. 40 μ l 20%SDS, 65 DEG C of temperature bath 10min, mixing of turning upside down gently every two minutes are added.
4. 100 μ l 5M NaCl, gentle mixing are added.
5. add 100 μ l 10 × CTAB, 65 DEG C of temperature bath 10min, be interrupted mixing of turning upside down gently.
6. adding 900 μ l chloroforms, fully mix, 12000rpm is centrifuged 3min.
7. transfer supernatant is in 1.5mL Eppendorf pipe, adds 600 μ l isopropanols, mixing, and 12000rpm is centrifuged
5min。
8. abandon supernatant, precipitate with 70% (volumn concentration) ethanol rinse once, room temperature airing.
9. 100 μ l 1 × TE (121 grams of Tris are dissolved in 1 liter of water, adjust pH value to 8.0 solution obtained with hydrochloric acid) are added molten
Solve DNA.
10. 2 μ l electrophoresis detection DNA mass are taken, and with DU800 spectrophotometric determination concentration (Beckman Instrument Inc.
U.S.A)。
(2) DNA of said extracted is diluted to about 20ng/ μ l, carries out PCR amplification as template；
PCR reaction system (10 μ l): DNA (20ng/ul) 1ul, forward primer (2pmol/ul) 1ul, downstream primer (2pmol/ul)
1ul, 10xBuffer (MgCl2Free) 1ul, dNTP (10mM) 0.2ul, MgCl2(25mM) 0.6ul, rTaq (5u/ul) 0.1ul,
ddH2O 5.1ul, altogether 10ul.
PCR response procedures: 94.0 DEG C of degeneration 5min；94.0 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, follow altogether
Ring 35 times；72 DEG C extend 7min；10 DEG C of preservations.PCR reaction is carried out in MJ Research PTC-225 thermal cycler.
Above-mentioned primer development process is as follows:
(1) SSR marker exploitation
The SSR marker of public collection of illustrative plates is integrated with Rice Genome Sequence, downloads the BAC/PAC near mutational site and clone sequence
Row.With potential in SSRHunter (Li Qiang etc., heredity, 2005,27 (5): 808-810) or SSRIT software search clone
SSR sequence (number of repetition >=6)；The sequence of these SSR and neighbouring 400～500bp is existed by blast program at NCBI
Line compares with corresponding long-grained nonglutinous rice sequence, if both SSR numbers of repetition are variant, and the preliminary PCR inferring this SSR primer
Polymorphism is there is in product between Xian, round-grained rice；Recycling Primer Premier 5.0 software design SSR primer, and by the handsome life in Shanghai
Thing Technology Co., Ltd. synthesizes.Paired for the SSR of designed, designed primer equal proportion is mixed, detects it between N22 and south round-grained rice 35
Polymorphism, show polymorphic person and be used as the fine molecular marker positioning qSdn-1.Molecular marker for fine location is shown in Table 2.
The PCR primer detection of SSR marker:
Amplified production is with 8% native polyacrylamide gel electrophoresis analysis.With the DNA Ladder of 50bp for comparing amplification
The molecular size range of product, silver staining develops the color.
(2) InDel marker development
InDel design of primers: N22 and the south round-grained rice 35 partial sector near qSdn-1 position are checked order, and carries out
Comparison, finds the SNPs existed between the two, with software design InDel labelling based on these SNPs, uses Primer simultaneously
Another primer that Premier 5.0 software design is corresponding, is shown in Table 2.
The PCR reaction system of InDel labeled analysis: DNA (20ng/ul) 2ul, Primer1 (10pmol/ul) 2ul,
Primer2 (10pmol/ul) 2ul, 10xBuffer (MgCl2Free) 2ul, dNTP (10mM) 0.4ul, MgCl2(25mM)
1.2ul, rTaq (5u/ul) 0.4ul, ddH2O 10ul, cumulative volume 20ul.
Amplified reaction is carried out in PTC-200 (MJ Research Inc.) PCR instrument: 94 DEG C of 3min；94 DEG C of 30sec, 55 DEG C
(primer is different, has adjusted) 45sec, 72 DEG C of 2.5min, 35 circulations；72℃5min.
PCR primer purification reclaims, and carries out by test kit (Beijing Tiangen company) step.After PCR primer is digested overnight,
It is separated by electrophoresis with in the agarose gel of 1-4%, observes under uviol lamp after EB dyes and take pictures.DCAPS with 8% Native PAGE
Glue separates, silver staining.
Table 2 is for the molecular marker of fine location
(3) acquisition of mutant gene
Site design primer according to location, sequence is as described below:
Primer1:
5'—AGAAGGGGGAAAAGGA—3'(SEQ ID NO.4)
Primer2:
5'—CTTAGCATCCCCTTATTTAC—3'(SEQ ID NO.5)
With primer1 and primer2 as primer, respectively with N22 and south round-grained rice 35 cDNA as template, carry out PCR amplification obtain
Genes of interest.This is positioned at SEQ ID NO.3 upstream 44bp and downstream 104bp to primer, and amplified production contains the complete of this gene
Coding region, portion
Amplified reaction is with KOD enzymatic amplification (purchased from TOYOBO company), in PTC-200 (MJ Research Inc.) PCR instrument
Carry out: 94 DEG C of 2min；98 DEG C of 10sec, 60 DEG C of 30sec, 68 DEG C of 10min, 35 circulations；68℃20min.
PCR primer being reclaimed is connected to (purchased from TAKARA company) on carrier pMb18T carrier after purification, converts bacillus coli DH 5 alpha
Competent cell (purchased from Tiangen company), selects positive colony, checks order.
Sequencing results shows, the fragment that PCR reaction obtains comprises the nucleotide sequence shown in SEQ ID NO.3, encodes 966
The protein (see SEQ ID NO.1) of individual amino acid residue composition.By the named OsqSdn-1 of albumen shown in SEQ ID NO.1
(N22), the unnamed gene by the albumen shown in coding SEQ ID NO.1 is OsqSdn-1 (N22).
Embodiment 2, the acquisition of transgenic plant and qualification
One, recombinant expression carrier builds
With the cDNA of N22 as template, carrying out PCR amplification and obtain OsqSdn-1 (N22) gene, PCR primer sequence is as follows:
Primer3 (sequence shown in underscore is EcoRI recombination site):
5'—CCATGATTACGAATTCATGGCGCGCAATGCGGCGGAC—3'(SEQ ID NO.6)
Primer4 (sequence shown in underscore is EcoRI recombination site):
5'—TACCGAGCTCGAATTCCCCAGTGTTCTGCATACCAGCAG—3'(SEQ ID NO.7)
Above-mentioned primer is positioned at 23bp before the initial 21bp in the coding region of gene shown in SEQ ID NO.2 and coding region terminator, amplification
Product contains the complete coding region of this gene, and PCR primer is reclaimed purification.UseHD Cloning Kit
PCR primer is cloned in carrier pCUbi 1390 (Fig. 6) by recombination kit (Takara company).
In-Fusion recombining reaction system (10 μ L): PCR primer 10-200ng, reclaims pCUbi 1390 through EcoRI enzyme action and carries
Body 50-200ng, 5 × In-Fusion HD Enzyme Premix 2 μ L, Deionized water to 10 μ L.Rifle head blows
Being placed on ice by mixed system 50 DEG C reaction 15min after playing mixing, the 2 μ L reaction system heat shock methods that take convert bacillus coli DH 5
α competent cell (Tiangen company).It is uniformly coated on the LB solid containing 100mg/L kanamycin by being totally converted cell
In culture medium.Cultivate 12-16h, picked clones positive colony, check order for 37 DEG C.Sequencing result shows, has obtained containing SEQ
The recombinant expression carrier of the gene of OsqSdn-1 (N22) shown in ID NO.3, will be containing the pCUbi 1390 of OsqSdn-1 (N22)
Named pCUbi 1390-qSdn-1 (N22).
Two, the acquisition of recombinational agrobacterium
With electric shocking method, pCUbi 1390-qSdn-1 (N22) is converted Agrobacterium EHA105 bacterial strain (purchased from handsome company of the U.S.),
To recombinant bacterial strain, extract plasmid and carry out PCR and enzyme action qualification.PCR and enzyme action are identified the correct named EH-of recombinant bacterial strain
pCUbi 1390-qSdn-1(N22)。
Three, the acquisition of transgenic plant
By EH-pCUbi 1390-qSdn-1 (N22) rice transformation south round-grained rice 35, method particularly includes:
Cultivate EH-pCUbi 1390-qSdn-1 (N22) 16 hours for (1) 28 DEG C, collect thalline, and be diluted to containing 100 μm ol/L
N6 fluid medium (Sigma company, C1416) in concentration be OD600≈ 0.5, it is thus achieved that bacterium solution；
(2) the bacterium solution mixed infection of the southern round-grained rice 35 Mature Embryos of Rice embryo callus to month and step (1) will be cultivated
30min, filter paper proceeds to after blotting bacterium solution co-culture in culture medium (N6 solid co-cultivation medium, Sigma company), and 24 DEG C altogether
Cultivate 3 days；
(3) wound healing of step (2) is seeded in containing 100mg/L hygromycin (Phyto Technology Laboratories public affairs
Department) N6 solid screening culture medium on for the first time screening (16 days)；
(4) picking health wound healing proceeds to programmed screening in the N6 solid screening culture medium containing 100mg/L hygromycin, and every 15
It subculture is once；
(5) picking health wound healing proceeds to screen for the third time in the N6 solid screening culture medium containing 50mg/L hygromycin, every 15 days
Subculture is once；
(6) picking kanamycin-resistant callus tissue proceeds to break up on division culture medium；
Obtain the T of seedling differentiation0For positive plant.With turn pCUbi 1390 empty carrier southern round-grained rice 35 as negative control.
Four, the qualification of transfer-gen plant
1, PCR Molecular Identification
The T that step 3 is obtained0Extract genomic DNA for positive plant, with genomic DNA as template, utilize on pCUbi1390
Primer Primer5 near SEQ ID NO.3 insertion point left margin and the primer Primer6 on SEQ ID NO.3 is as primer
To expanding (Primer5:5 '-TTTGTCGGGTCATCTTTTC-3 ' (SEQ ID NO.8) and Primer6:5'-
TCAGCCAAGTTTGCCAG-3'(SEQ ID NO.9)), amplification length 1018bp..PCR reaction system: DNA (20ng/ul)
2ul, Primer5 (10pmol/ul) 2ul, Primer6 (10pmol/ul) 2ul, 10xBuffer (MgCl2Free) 2ul,
DNTP (10mM) 0.4ul, MgCl2(25mM) 1.2ul, rTaq (5u/ul) 0.4ul, ddH2O 10ul, cumulative volume 20ul.Expand
Increase reaction to carry out in PTC-200 (MJ Research Inc.) PCR instrument: 94 DEG C of 3min；94 DEG C of 30sec, 55 DEG C of 45sec,
72 DEG C of 1min, 35 circulations；72℃5min.
PCR primer is reclaimed with test kit (Beijing Tiangen company) purification.PCR primer detects by the sepharose electrophoresis of 1%.Knot
Fruit shows to obtain the plant that 35 strain PCR detections are positive.See Fig. 7, in Fig. 7 swimming lane 1 be on the south round-grained rice 35DNA be template amplification make
For negative control, in addition to 2,25,26 and 30, remaining is to convert 35 strains obtained to turn pCUbi 1390-qSdn-1 (N22)
Plant.
2, phenotypic evaluation
Respectively by T0In generation, turns EH-pCUbi 1390-qSdn-1 (N22) plant, south round-grained rice 35 and N22 is planted in Agricultural University Of Nanjing
Rice test station, carries out sowing to the heading transfer-gen plant of 35 days, carries out the qualification of dormancy phenotype.Turn unloaded southern round-grained rice 35
Transfer-gen plant germination percentage is about 99%, and the transfer-gen plant germination percentage proceeding to EH-pCUbi 1390-qSdn-1 (N22) occurs
Separate, wherein T0The germination percentage of-15 is about 71%, T0The germination percentage of-9 is about 64%.Illustrate that OsqSdn-1 (N22) is the most permissible
Affect the dormant trait (see Fig. 8) of seed.
Claims (12)
1. an albumen relevant to rice paddy seed dormancy, it is characterised in that: selected from the albumen shown in (a) or (b):
A protein that () is made up of the aminoacid sequence shown in SEQ ID NO.1；
B the aminoacid sequence of SEQ ID NO.1 through replacement and/or the disappearance of one or several amino acid residue and/or is added by ()
Add the derivative protein relevant to rice paddy seed dormancy obtained.
2. the gene of albumen described in coding claim 1.
Gene the most according to claim 2, it is characterised in that: described gene is following 1) or 2) or 3) or 4)
DNA molecular:
1) DNA molecular shown in SEQ ID NO.2；
2) DNA molecular shown in SEQ ID NO.3；
3) under strict conditions with 1) or 2) DNA molecular of albumen described in the DNA sequence hybridization that limits and coding claim 1；
4) with 1) or 2) or 3) DNA sequence that limits has more than 90% homology, and coding rice paddy seed dormant trait albumen
DNA molecular.
4. contain the recombinant expression carrier of gene described in Claims 2 or 3, expression cassette, transgenic cell line or recombinant bacterium.
Recombinant expression carrier the most according to claim 4, it is characterised in that: described recombinant expression carrier is at pCUbi 1390
The recombiant plasmid that gene described in Claims 2 or 3 obtains is inserted between the EcoRI recombination site of carrier.
6. the total length of gene or the primer pair of its any fragment described in amplification Claims 2 or 3, preferably Primer1/Primer2,
Primer3/Primer4 or Primer5/Primer6；Wherein, Primer1 as shown in SEQ ID NO.4 in sequence table, Primer2
As shown in SEQ ID NO.5 in sequence table, Primer3 is as shown in SEQ ID NO.6 in sequence table, in Primer4 such as sequence table
Shown in SEQ ID NO.7, Primer5 as shown in SEQ ID NO.8 in sequence table, SEQ ID NO.9 in Primer6 such as sequence table
Shown in.
7. the albumen described in claim 1, gene described in Claims 2 or 3, recombinant expression carrier described in claim 4,
At least one in expression cassette, transgenic cell line or recombinant bacterium application in plant breeding.
8. the method cultivating rice paddy seed appropriateness dormant trait, is without dormancy Oryza sativa L. by channel genes described in Claims 2 or 3
In kind, obtain the transgenic paddy rice that dormant trait strengthens；Described rice varieties without dormancy be germination percentage close to 100% rice varieties；
The transgenic paddy rice that described dormant trait strengthens is the transgenic paddy rice that germination percentage is less than 80%.
Method the most according to claim 8, it is characterised in that: gene described in Claims 2 or 3 passes through claim 4
Or recombinant expression carrier described in 5 imports without in dormancy Oryza sativa L..
10. the method cultivating the transgenic plant that Grain Dormancy strengthens, is Claims 2 or 3 in process LAN purpose plant
The expression of described gene, obtains the transgenic plant that dormant trait strengthens；Described purpose plant is for carrying base described in Claims 2 or 3
The plant of cause.
11. 1 kinds of Oryza sativa L. dormant trait gene qSdn-1, it is characterised in that be positioned between Indel flag F 19 and F18,29.8kb
In the range of；The forward primer of described Indel flag F 19 as shown in SEQ ID NO.36 in sequence table, downstream primer such as sequence
In table shown in SEQ ID NO.37；The forward primer of Indel flag F 18 is as shown in SEQ ID NO.34 in sequence table, and downstream is drawn
Thing is as shown in SEQ ID NO.35 in sequence table.
The location primer of the Oryza sativa L. dormant trait gene qSdn-1 described in 12. claim 11, it is characterised in that selected from shown in table 2
The all primers in addition to RM11669 and RM11694 be designed, designed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610567000.9A CN105950598B (en) | 2016-07-19 | 2016-07-19 | Rice dormancy-breaking related protein and coding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610567000.9A CN105950598B (en) | 2016-07-19 | 2016-07-19 | Rice dormancy-breaking related protein and coding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105950598A true CN105950598A (en) | 2016-09-21 |
| CN105950598B CN105950598B (en) | 2019-12-24 |
Family
ID=56900903
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610567000.9A Active CN105950598B (en) | 2016-07-19 | 2016-07-19 | Rice dormancy-breaking related protein and coding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105950598B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106544347A (en) * | 2016-12-06 | 2017-03-29 | 南京农业大学 | A kind of method of regulation and control vegetable seeds dormancy time |
-
2016
- 2016-07-19 CN CN201610567000.9A patent/CN105950598B/en active Active
Non-Patent Citations (5)
| Title |
|---|
| CHEN GINZBURG: "Metabolic Changes in Gladiolus Cormels During the Break of Dormancy: The Role of Dark CO2 Fixation", 《PLANT PHYSIOL.》 * |
| KAWAHARA,Y等: "Oryza sativa Japonica Group DNA, chromosome 1, cultivar: Nipponbare, complete sequence GenBank: AP014957.1", 《GENBANK》 * |
| SASAKI,T等: "Oryza sativa Japonica Group genomic DNA, chromosome 1, BAC clone:B1131G08 GenBank: AP003409.4", 《GENBANK》 * |
| 无: "PREDICTED: Oryza sativa Japonica Group phosphoenolpyruvate carboxylase, housekeeping isozyme (LOC4325309), transcript variant X1, mRNA NCBI Reference Sequence: XM_015775415.1", 《GENBANK》 * |
| 无: "PREDICTED: phosphoenolpyruvate carboxylase, housekeeping isozyme [Oryza sativa Japonica Group] NCBI Reference Sequence: XP_015630901.1", 《GENBANK》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106544347A (en) * | 2016-12-06 | 2017-03-29 | 南京农业大学 | A kind of method of regulation and control vegetable seeds dormancy time |
| CN106544347B (en) * | 2016-12-06 | 2019-05-10 | 南京农业大学 | A method of regulation vegetable seeds dormancy time |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105950598B (en) | 2019-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111690625B (en) | Acetolactate synthase mutant protein with herbicide resistance and application thereof | |
| CN111333707B (en) | Plant grain type related protein and coding gene and application thereof | |
| CN108822194B (en) | Plant starch synthesis related protein OsFLO10, and coding gene and application thereof | |
| CN107759676B (en) | Plant amylose synthesis related protein Du15, and coding gene and application thereof | |
| CN106432447B (en) | A kind of plant amylum synthesis associated protein OsPKp1 and its encoding gene and application | |
| CN106754967B (en) | Rice grain type gene OsLG1 and encoding protein and application thereof | |
| CN108642065B (en) | Rice endosperm aleurone related gene OsSecY2 and encoding protein and application thereof | |
| CN108642067A (en) | A kind of relevant gene OsHsp70cp-2 of paddy endosperm silty and its coding protein and application | |
| WO2023065966A1 (en) | Application of bfne gene in tomato plant type improvement and biological yield increase | |
| CN107475266A (en) | A kind of paddy endosperm silty related gene OscyMDH and its encoding proteins matter and application | |
| CN104628839B (en) | A kind of paddy endosperm amyloplast development associated protein and its encoding gene and application | |
| CN108047319B (en) | Rice seed dormancy regulatory gene OsMPK14 and application thereof | |
| CN107253980B (en) | Application of OsGRF7 gene in rice plant type regulation | |
| CN106589085B (en) | Plant starch synthesis related protein OsFLO8, and coding gene and application thereof | |
| CN106749571B (en) | Plant starch synthesis related protein OsNPPR and coding gene and application thereof | |
| CN107325161B (en) | Protein related to low-nitrogen stress and high-salt stress resistance as well as encoding gene and application thereof | |
| CN106432444A (en) | Protein GPA4 related to plant glutelin transportation and storage and encoding gene and application thereof | |
| CN110724694B (en) | Rice fertility gene SAW1 and application thereof | |
| CN105950598A (en) | Rice dormancy interacting protein and encoding gene and application thereof | |
| CN106244596A (en) | A kind of rice paddy seed dormant gene OsDOG1L3 and application thereof | |
| CN112029777B (en) | OsALIS4 gene for reducing rice setting percentage and protein obtained by encoding same and application thereof | |
| CN104513825B (en) | Wheat salt-tolerant gene TaNAS1 and application thereof | |
| CN107446031A (en) | A kind of plant glutelin transhipment storage GAP-associated protein GAP OsVHA E1 and its encoding gene and application | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN108795949B (en) | Rice leaf color regulation related gene OsWSL6 and encoding protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |