CN112225789B - Rice grain type related gene OsLa1 gene and coding sequence and application thereof - Google Patents

Abstract

A rice grain type related gene OsLa1 gene and a coding sequence and application thereof belong to the technical field of molecular biology and genetic engineering. Provides rice grain type related gene OsLa1 gene and its coding sequence. Provides the application of the OsLa1 gene in regulating and controlling rice grain types. The OsLa1 gene is separated from rice, the full length of the gene is 4409bp, and the DNA sequence is shown as SEQ ID NO: 1 is shown in the specification; the cDNA coding region sequence is 1404bp long and is shown as SEQ ID NO. 2; the OsLa1 gene codes 467 amino acids, and the amino acid sequence is shown in SEQ ID NO. 3. Compared with wild rice, the transgenic rice over expressing OsLa1 can improve the grain length of rice, while the grain length and grain width of Cas9 transgenic rice are obviously reduced, and a new target gene resource is provided for breeding new high-yield and high-quality rice varieties.

Description

Rice grain type related gene OsLa1 gene and coding sequence and application thereof

Technical Field

The invention belongs to the technical field of molecular biology and genetic engineering, and particularly relates to a rice grain type related gene OsLa1 gene as well as a coding sequence and application thereof.

Background

Rice (Oryza sativa L.) is one of the most important food crops in the world, and rice is taken as staple food in more than 50% of the global population. With the increasing population of the world, the grain safety problem becomes more serious due to the fact that the available arable land area is less and less due to the development of industrialization and the global climate change is aggravated. Therefore, the cultivation of new varieties of high-yield and high-quality rice is the most effective means for solving the grain problems. The yield composition of rice is mainly determined by the effective ear number per unit area, ear number and thousand kernel weight (Xing and Zhang, 2010). The grain shape of the rice mainly comprises three components of grain length, grain width and grain thickness, is one of key factors influencing grain weight, and directly determines the grain weight of the rice under the condition of ideal grouting degree.

La protein was originally found as an autoimmune antigen in human patients with systemic lupus erythematosus and Sjogren's syndrome (Alspaugh and Tan, 1975). Although first found in humans, later studies have shown that the homologous gene is widely present in eukaryotes, including yeast, insects, vertebrates, etc., and is a nuclear phosphorylated protein expressed in high abundance (Wolin and cedervalll, 2002). The La protein has been shown to be associated with most nascent small RNA (small RNAs), including tRNA precursor, 5SrRNA precursor and U6 small nuclear RNA, as well as a portion of the viral-encoded RNA (Kufel et al, 2000) La protein whose specific recognition site is 3' -UUU-OH (Stefano 1984), so that both the precursor transcript produced by RNA polymerase III (pretRNA) and a portion of the small RNA precursor produced by RNA polymerase II transcription containing this domain can be recognized and bound by the La protein. This binding helps these newly synthesized small RNAs from exonuclease cleavage (Maraia and intein, 2002), serving to aid assembly and allow proper folding. This La protein-mediated stabilizing structural role is essential for the maturation pathway of pre-tRNAs, and can promote the assembly of small RNAs into functional RNA-protein complexes, and contribute to the retention of some small RNAs in the nucleus (Grimm et al, 1997). Therefore, La protein plays a chaperone role during RNA synthesis.

In plants, 8 similar proteins of La or La were obtained by search with the La motif domain in the arabidopsis genome database (Fleurdepine et al, 2007). By comparison of protein structure and phylogeny, two of these are probably authentic La proteins, namely At4g32720(At32) and At1g79880(At79), which are expressed At different stages of the overall growth and development of the plant and under different regulatory conditions. At32 restores the nuclear function of the Saccharomyces cerevisiae La protein in the non-coding RNA synthesis and binds small RNAs containing 3' -UUUU-OH tails. It can be said that the nuclear function of La protein is performed by At32 and is highly conserved in Arabidopsis thaliana, so the gene encoding this protein was named AtLa 1. AtLa1 is a homologous gene of real La protein in Arabidopsis thaliana, and is mainly positioned in nuclear plasma of nucleus and nucleus cavity occasionally distributed. The deletion of AtLa1 in Arabidopsis resulted in a lethal embryonic phenotype, with insufficient development of embryos during the early globular stage. In addition, the mutated embryonic cells exhibited a nucleolar hypertrophy phenotype, suggesting that the AtLa1 protein plays an important role during embryogenesis.

In summary, the rice grain shape development is influenced by various factors, but the research on the influence of La protein on the rice grain shape development is not enough, and the mechanism of the La protein is not very clear. The invention researches the biological function of OsLa1 by methods of molecular biology, genetic engineering and the like, and further discloses that the OsLa1 plays an important role in the growth and development of rice grain types.

Disclosure of Invention

The first purpose of the invention is to provide a rice grain type related gene OsLa1 gene.

The second purpose of the invention is to provide the coding sequence of the rice grain type related gene OsLa1 gene.

The third purpose of the invention is to provide the application of the rice grain type related gene OsLa1 in regulation and control of rice grain type.

The rice grain type related gene OsLa1 gene is separated from rice, the full length of the gene is 4409bp, and the DNA sequence is shown as SEQ ID NO: 1 is shown in the specification; the cDNA coding region sequence is 1404bp long and is shown as SEQ ID NO. 2; the OsLa1 gene codes 467 amino acids, and the amino acid sequence is shown in SEQ ID NO. 3.

According to the sequence verified full-length cDNA sequence information of the OsLa1 gene, an over-expression vector of the gene is constructed, and a CRISPR/Cas9 vector is constructed, and is represented by a sequence table SEQ NO: 2, from position 97 to 116. In order to determine the expression site of the gene in the cell, a GFP vector is further constructed, namely the expression mode of the gene is determined according to the expression condition of GFP, and the expression mode is shown as the sequence table SEQ NO: 2.

The invention also provides a primer sequence for cloning the gene OsLa1 from rice mRNA by reverse transcription PCR, and the primer for amplifying the rice OsLa1 gene is as follows:

Os02g39700-CDS-F：ATGGCCGCCGCCACCGCG

Os02g39700-CDS-R：CTAAGCAGCAGCTTCGACCTTC

the invention also provides a vector containing the rice OsLa1 gene.

The invention also provides a host containing the rice OsLa1 gene vector. Preferably, the host is a eukaryotic cell. More preferably, the host is rice.

The invention also provides application of the rice OsLa1 gene in regulation of rice grain types; the application is to convert a nucleotide sequence coding rice OsLa1 into rice by utilizing a transgenic technology so as to change the rice grain type, and the specific method is as follows:

1) the coding region or sgRNA fragment of the rice OsLa1 gene is connected to a plant expression vector to form a plant overexpression or CRISPR/Cas9 vector containing the rice OsLa1 gene.

2) Transferring the plant overexpression or CRISPR/Cas9 vector in the step 1) into agrobacterium EHA105, infecting agrobacterium containing the overexpression or CRISPR/Cas9 vector into rice callus, and performing co-culture, sterilization, antibiotic screening and differentiation (about 4 months) to obtain the rice OsLa1 gene overexpression and CRISPR/Cas9 transgenic plant.

Compared with wild rice, the transgenic rice over expressing OsLa1 can improve the grain length of rice, and the grain length and grain width of Cas9 transgenic rice are obviously reduced.

The invention also provides a method for detecting the expression quantity in the transgenic rice, which mainly utilizes a fluorescent quantitative PCR method. The method comprises the following specific steps: taking leaves of transgenic rice, extracting rice RNA by using an RNA extraction kit, digesting DNA by using DNase1, then carrying out reverse transcription to form cDNA, and carrying out fluorescent quantitative PCR analysis by using the cDNA as a template. The nucleotide sequence of the fluorescent quantitative PCR primer is as follows:

qPCR—Os02g39700-F：GAGGATGGAAAAATGGTTGG

qPCR—Os02g39700-R：TTGAGATATGGCGTGGTAGC

the invention clones a gene OsLa1(LOC _ Os02g 3970) related to rice grain type development, and obtains a cloned transgenic plant by transforming rice. Through phenotype observation and research on transgenic rice, the function of the gene in the rice grain growth and development process is determined, and a new target gene resource is provided for breeding new high-yield and high-quality rice varieties.

Drawings

FIG. 1 shows the sequence homology analysis of OsLa1 of rice.

FIG. 2 shows the PCR identification of transgenic plants overexpressing OsLa1, wherein P represents a positive control, N represents a negative control, and M represents a DNA molecule Marker.

FIG. 3 shows the expression level detection of OsLa1 gene in over-expressed transgenic plants.

FIG. 4 shows PCR identification of Cas9 transgenic plants, wherein P represents a positive control, N represents a negative control, and M represents a DNA molecule Marker.

FIG. 5 shows mutation type analysis of T0 generation of Cas9 transgenic plants.

FIG. 6 is the localization of transient expression of OsLa1 protein.

FIG. 7 is a length and width phenotype diagram of grain of rice OsLa1 transgenic plant.

FIG. 8 is a statistical chart of grain length and grain width of rice OsLa1 transgenic plant. Bar is 1 cm.

FIG. 9 is a thousand kernel weight analysis diagram of rice OsLa1 transgenic plant grain.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

The experimental procedures, for which specific conditions are not specified in the following examples, are carried out according to conventional conditions, for example, as described in the handbook of molecular cloning laboratories (New York: Cold Spring Harbor Laboratory press,1989), or according to the conditions recommended by the manufacturer.

Example 1 cloning of a cDNA fragment of OsLa1 gene of rice.

Extraction of RNA: reference is made to Promega

Super total RNA extraction kit catalog # S104). Putting the rice material into mortar for rapid useLiquid nitrogen was frozen and ground until the tissue was completely ground to a powder. And (3) rapidly transferring the powdery sample to an EP tube without nuclease, adding 300-500 mu L of cracking liquid, repeatedly blowing and beating, and adding an equal volume of diluent. After 5min at room temperature, centrifuge at maximum speed for 5 min. Carefully absorbing the supernatant into a new 1.5mL nuclease-free EP tube, adding absolute ethyl alcohol with the volume 0.5 times that of the supernatant, and absorbing and releasing for 3-4 times by using a pipette gun to mix uniformly. The mixture was transferred to a spin column and then centrifuged at 12000g for 1 min. Discarding the filtrate, replacing the column into the collection tube, adding 600 μ L RNA washing solution into the column, centrifuging at 12000g for 1min, and discarding the filtrate. Add 50. mu.L DNase I incubation to the center of the column and let stand at room temperature for 30 min. Add 600. mu.L RNA wash to the column, centrifuge at 12000g for 1min, discard the filtrate. After repeated one time, the column was replaced on the collection tube and centrifuged at 12000g for 2 min. Transferring the column to an elution tube, adding 50 μ L of nuclease-free water into the center of the column membrane, standing at room temperature for 2min, and centrifuging at 12000g for 1 min. Adding the eluted eluate back to the center of the centrifugal column, standing at room temperature for 2min, centrifuging at 12000g for 1min, eluting again, and storing RNA at-80 deg.C. The RNA content was then determined on a spectrophotometer.

2. Reverse transcription: reference is made to GoScript from Promega^TMThe reverse transcription kit catalog # A2790 is characterized in that an RNA sample is incubated at 70 ℃ for 5min to open a higher-order structure, and after the higher-order structure is opened, the RNA sample is immediately placed on ice to configure the following reaction system:

(1) reaction System (20. mu.L)

Name of reagent	Amount used (μ L)
		RNA	5
Reaction Buffer,Oligo(dT)	4
		Enzyme Mix	2
DEPCH2O	Up to 20μL

(2) Reaction conditions

Temperature of	Time
		25℃	5min
42℃	60min
		70℃	15min

The reacted sample is stored at4 ℃ for a short time and at-20 ℃ for a long time.

Cloning cDNA, designing a primer (SEQ ID NO.4) according to sequence information provided in Rice database information in Rice Genome Annotation Project, and carrying out cDNA full-length cloning by adopting an RT-PCR method.

Obtaining a coding region containing a complete open reading frame by RT-PCR, wherein the length of the coding region is 1404 bp; recovered, ligated to pMD19-T vector, and sequenced. The sequencing result is analyzed on DNMAN software, and the result shows that the sequence is completely matched with the rice annotation gene LOC _ Os02g 39790.

Example 2 sequence information and homology analysis of rice OsLa 1.

The length of the full-length coding region of the rice OsLa1 is 1404bp, and the sequence of the full-length coding region is shown as SEQ ID NO. 2. The amino acid sequence of the rice OsLa1 is deduced according to the full-length cDNA, 467 amino acid residues are totally obtained, the molecular weight is 51689.8 daltons, the isoelectric Point (PI) is 5.4038, and the sequence is shown as SEQ NO. 3.

BLAST alignment of the protein in GenBank was performed to obtain a protein homologous to the protein, alignment was performed using Clustal x software, and then a phylogenetic tree was constructed using MEGA7 software according to the neighbor method (FIG. 1).

Example 3 identification of rice OsLa1 gene over-expression in rice and CRISPR/Cas9 and transgenic plant

1. Construction of overexpression vector of rice OsLa1 gene

According to the full-length sequence of the rice OsLa1 gene, a primer for amplifying a complete coding reading frame is designed, and an additional base is introduced to an upstream primer so as to construct an overexpression vector. The amplified product obtained in example 1 is used as a template, after PCR amplification, cDNA of the rice OsLa1 gene is cloned to an overexpression vector (such as pCXUN-FLAG), sequencing is carried out, the overexpression vector is transferred into agrobacterium under the premise of ensuring correct reading frame, and the model plant rice Nipponbare is transformed.

According to a PAM site designed in Rice Information GateWay (RIGW) Rice database Information, a CRISPR target site (sgRNA) is designed. The target site primer is as follows:

Os02g39700-sgRNA-F：CGCGATAAGTTCCTGAGGGA

Os02g39700-sgRNA-R：TCCCTCAGGAACTTATCGCG

after synthesizing a primer dimer, carrying out enzyme digestion connection on the primer dimer and a purified and recovered BsaI enzyme digestion CRISPR/Cas9 entry vector pU3-sgRNA, transforming escherichia coli DH5 alpha, and carrying out PCR identification on a bacterial liquid and positive monoclonal sequencing to obtain an entry vector recombinant plasmid pU3-Os 39-sgRNA. And then the LR reaction is carried out with the target carrier pH-ubi-cas9 through a Gateway system.

The LR reaction system (5. mu.L) was as follows:

components	Volume of
		Entrance clone (100 ng/. mu.L)	3μL
Target vector (150 ng/. mu.L)	1μL
		LR ClonaseTMII Enzyme Mix	1μL

Incubate at 25 ℃ for 2 h. Through escherichia coli transformation and identification, the final sequencing is correct, and then the CRISPR/Cas9-Os39 gene editing vector is successfully constructed. After the recombinant vector is transformed into the agrobacterium EHA105 by heat shock, the recombinant vector is transformed into the Nipponbare rice by an agrobacterium-mediated transformation method.

2. Agrobacterium mediated transformation of rice.

A. Inducing callus

(1) Selecting intact rice seeds without mildew, removing seed coat, sterilizing the seeds with 75% ethanol for three times, each time for 1min, and cleaning with sterile water. After the water is poured to dryness, 10% sodium hypochlorite solution is added, the vacuum pumping is carried out for 8min, and then the mixture is placed on a shaking table for 180r/min and shaken for 15min at the temperature of 30 ℃.

(2) Pouring the sodium hypochlorite solution in a super clean bench, washing with sterile water for several times, spreading the solution on a dish filled with filter paper and sterilized in advance, sucking water, inoculating the seeds on an induction culture medium (NBD) by using tweezers (taking care of sterile operation), allowing the embryos to face downwards or contact the NBD culture medium, and performing dark culture at 28 ℃ for 21 days; 12-14 grains per tissue culture bottle.

B. Subculture

And (3) stripping off embryonic roots and embryos around the callus, airing the callus on clean filter paper, transferring the callus to a subculture medium, and carrying out dark culture for 7-9 days at 28 ℃.

C. Culture of Agrobacterium EHA105

The correctly cloned Agrobacterium culture solution obtained in the previous experiments was spread on YEP resistant plates and incubated at 28 ℃ in the dark for about 36 h. Selecting monoclonal amplification culture, infecting when the OD600 of the agrobacterium liquid is 0.3-0.8, centrifuging at 4000rpm at room temperature for 8min, removing the upper layer of the liquid, and collecting thalli. And (3) resuspending the thallus by using a proper amount of AAM-As culture medium, inducing toxicity, finally enabling the OD600 value of the bacterial liquid to be about 0.6, and standing for 0.5h in a dark place for infection.

D. Infection and co-culture

(1) Selecting callus with good growth condition and compact structure, soaking in infection solution, fully inverting, mixing, and standing at room temperature for 30 min.

(2) Pouring off the staining solution, transferring the callus to a dish filled with sterilized filter paper for full blow drying, transferring to an NBD-As co-culture medium, adding a sterilized filter paper on the culture medium to prevent overgrowth of the agrobacterium, and performing dark culture at 28 ℃ for 3 days.

(3) Transferring the callus into a centrifuge tube, slightly turning and mixing uniformly, standing for 15min and 20min, and mixing uniformly once at an interval of 5 min.

(4) Pouring out the bacterial liquid, placing the callus on sterile filter paper for drying for more than 1.5h, ensuring that the bacterial liquid is sucked dry, inoculating the bacterial liquid on a co-culture medium, and culturing for 2-3 days at 20 ℃ in a dark environment.

E. Sterilization

(1) Transferring the callus after 3 days of co-culture to a triangular flask, and washing with sterilized water for more than 3 times until the liquid is clear.

(2) Pouring out sterile water, washing with sterile water containing 100mg/L of cefuroxime and 100mg/L of carbenicillin until the water is clear, and oscillating at the temperature of 28 ℃ and the rpm of 200 for 20min for 3-4 times.

(3) The washed callus was poured on sterile filter paper and fully dried, transferred to a selection medium (NBD +50mg/L hygromycin B +125mg/L cefuroxime +125mg/L carbenicillin), cultured at 28 ℃ in the dark. The culture medium can be replaced every 15 or 20 days.

F. Differentiation

Transferring the newly screened callus to a differentiation medium (MS +2 mg/L6-BA +2mg/L KT +0.2mg/L NAA +600mg/L casamino acid +300mg/L L-Proline +13g/L sorbitol +0.2mg/L IAA +50mg/L hygromycin +125mg/L cephamycin +125mg/L carbenicillin) for 16h light culture at 28 ℃.

G. Rooting

Differentiated transgenic shoots (> lcm high), were stripped of excess callus, and roots (approximately 0.5cm) were excised and transferred to 1/2MS medium for rooting. Incubated at 28 ℃ for 16h in light.

H. Hardening and transplanting seedlings

After rooting, the rooting medium can be removed, and the seedlings are soaked in water for several days for hardening and then transplanted into soil for growing.

3. Identification of transgenic plants

A. Identification of overexpressed transgenic seedlings

(1) Transgenic T0 rice leaves are cut, and DNA of the rice leaves is extracted by a CTAB method. Wild type Nipponbare was used as a negative control (N) and the vector plasmid was used as a positive control (P). The transgenic condition was detected by PCR identification using the vector specific primer Ubip FOR and the fragment primer 397900 qPCR-REV (FIG. 2). 20 strains are identified in total, each strain can amplify a DNA fragment of about 600bp, and the DNA fragment is proved to be an over-expression positive transgenic plant, and the positive rate is 100%.

(2) And extracting leaf RNA by using an RNA extraction kit, carrying out reverse transcription to obtain cDNA (the method is the same as example 2), designing a primer according to a gene sequence, and carrying out fluorescent quantitative PCR analysis on the expression condition of the OsLa1 gene of the transgenic rice, wherein the specific operation is carried out according to the instruction of a kit of TAKARA company, and a fluorescent quantitative PCR instrument is Applied Biosystems. Os39 was overexpressed by 40-1600 fold more inequality compared to wild type (fig. 3).

Cas9 transgenic shoot identification

Transgenic T0 rice leaves are cut, and DNA of the rice leaves is extracted by a CTAB method. Taking a wild Nipponbare as a negative control (N), taking a vector plasmid as a positive control (P), and carrying out PCR identification detection by adopting a vector framework specific primer Cas9 screen F/R, wherein the fragment size is 500 bp. Among 22 transgenic plants tested, 7 plants without cas9 vector could stably inherit the mutation, and the remaining 15 plants could still detect the pH-ubi-cas9 vector fragment, which basically conformed to Mendelian's law of inheritance (FIG. 4). Cas9 vector backbone specific primers were:

Cas9 screen-F：CCCCAAAGAAGAAGCGCAAG

Cas9 screen-R：CTGCACGAGCTGGATGAACA

in order to identify mutation sites of Cas9 transgenic plants, a specific primer Cas 9-39793 JDFOR/REV is designed to amplify a sequence of about 550bp upstream and downstream of CRISPR sites and sequenced. The sequencing result shows (figure 5), the obtained transgenic plant has mutation in different conditions in the target site region, wherein the No. 1 and No.2 strains are both inserted with basic groups and promote the subsequent translation sites to form TAA terminator sequences, and the No.2 strain is homozygous mutation. No. 8 strain is a base deletion, one chromosome is deleted for 4 bases, and a complementary chromosome is deleted for 62 bases. The sequencing specific primers are as follows:

cas9-39700-JD-F：ACCCTAAAGCCGCCGATTC

cas9-39700-JD-R：TGCTACTGCGAGCACTGTCTC

example 4 analysis of transient expression of OsLa1 Gene in Rice in tobacco

The gene was ligated to the vector for transient expression pH7WG2, Agrobacterium GV3101 was transformed, Agrobacterium containing the transient expression plasmid was injected into tobacco leaves along the tobacco vein with a micro-syringe, and after 3 days of culture, the leaves at the injection site were torn and photographed under laser confocal observation, and the protein was localized in the nucleus as shown (FIG. 6).

Example 5 detection of grain type and thousand Kernel weight of OsLa1 Gene in Rice

After the rice is mature, grains of the wild type strain, the overexpression strain and the Cas mutant strain are respectively collected, the grains are placed in a drying oven at the temperature of 60 ℃ to be dried to constant weight, and then grain length, grain width and thousand grain weight are measured. 10 strains were measured.

A. Grain length: randomly picking 10 mature and plump grains from each sample, closely arranging the grains in a line on coordinate paper in an end-to-end, non-overlapping and non-gap mode, measuring the length of the grains, repeating the steps twice, and calculating the average length of each grain, namely the grain length. The results show that grain size of OsLa1 overexpressing transgenic plants is increased and grain size of OsLa1 Cas9 transgenic plants is decreased compared to wild type (FIGS. 7 and 8).

B. And (3) grain width, namely randomly picking 10 mature and full grains from each sample, closely arranging the 10 grains in a line on coordinate paper according to shoulder-to-shoulder (namely width direction), measuring the width of the grain, repeating the measurement twice, and calculating the average width of each grain to be the grain width. Grain width of both OsLa1 over-expressed and Cas9 transgenic plants was less than wild type (fig. 7 and 8).

C. Thousand grain weight of grains: randomly picking 100 mature and plump grains from each sample, weighing the grains, repeating the weighing twice, calculating the average value of the grains, and finally converting the average value into the weight of thousands of grains. Grain thousand kernel weight was significantly reduced in OsLa1 Cas9 transgenic plants compared to wild type (FIG. 9).

Grain length, grain width and thousand grain weight of the OsLa1 Cas9 transgenic plant are obviously reduced. The gene provided by the invention has obvious effect in plant breeding, has high application value, and provides a new target gene resource for breeding a new high-yield and high-quality rice variety.

Sequence listing

<110> university of mansion

<120> rice grain type related gene OsLa1 gene and coding sequence and application thereof

<130> OsLa1

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4409

<212> DNA

<213> Oryza sativa

<400> 1

tcgtcggcac gctgcacagt acgcgcgctg ctcctaaacc caaaccctaa agccgccgat 60

tcctctcctc tcctctccac accagctcga tcgcgatcgg ggtcatggcc gccgccaccg 120

cggcgccgtc gatcgacgag gccaaggcga agagcgttct ccgccaggtg tccgatcccg 180

ccttcttgtt gtttgttcac ggcggatttc tccccctttt ggcgattttg tttgagcatt 240

tatttttggg ggggaggttt gagcttttga tttggtttgg ttgtcgcagg tggagttcta 300

cttcagcgac agcaacctcc cgcgcgataa gttcctgagg gagacggtcg agcagcgcga 360

agatggatgt aaatgatctc tcgcgcagta cattttccac gcggattgct tttctccggc 420

gcgatgattg agtgctgaac ttagcgtctt ttttttttct tctcattttg ttggaaatgt 480

gcagtggtaa gcttggcttt gatatgctct ttcgcgcgga tgaagtcgca cctcgggctg 540

gacgccgccg tgaagcccga aactgtgcca gaggagacag tgctcgcagt agcagaggtg 600

ctacgtcgtt cccagatgct tcgtatctcg gaggatggtg attcctctct ttcctcttaa 660

ttccagttat tcgtgattca ctagcaacga gcacaaattg ctggcaattg aatttcaaaa 720

ggagttggta aataccagtg aaacatgtga agtgtacatt tttagataac gatgtaaagt 780

gtacatatac tctgctttgt gacctgctat tcaatgttgt caataaactt ttgttttcct 840

tctttagtaa tgataaatat gccatgttct caaatacagt gttagtttgg gaactagagc 900

tggtctactt ttatgtgagt taagtttctc tagtaaattg gtttcttttt tatcattgct 960

gatttgctgt atttttcaaa tgcaggaaaa atggttggtc gagctagtga gctgttgaag 1020

gcagatgaaa tcatcaagca agtggactca aggacagttg ctgcgtcacc attgccttac 1080

aatgtaaagc tggaagatgt ccaatctttc tttgcgcaat atgcaaaggt gtgtccaagt 1140

actgaacact tatagtgcac aacaagcttg cagttagttt gaaatgaaat tgaaatgtaa 1200

tgcaaagaga aaaggtggca tggctaggct gcataaattc gattcaaagt tcaacagaac 1260

aaaggaagtt ttttttctcg tgaacctttt tcataattag gattttgagt atcatgaaca 1320

taattaccag ttatgcatgc tggctatctg gagcttttcc agtgttatga ttacatgtgc 1380

aatactatac tgcaaatatc aatgaattaa cattttcttg gtgtacttgt gtctgaattg 1440

taggtaaata gtgtcaggct accacgccat atctcaaaca aaaaacactt ctgtggcact 1500

gccttagttg aattttcaga agaggatgaa gcgaaaattg ttttggagaa taatttgttc 1560

tttgcagggg caaatctgga aataaaacta aagtaagcca ctaacatatc ctttttgcat 1620

gataatcata catgtggaat gtgcagataa aatgcttgct ttagtactat caccataaat 1680

ttctatgtta attccaatat attcccctct agctgtactg ccataccggt aagttgttag 1740

ttatcaaacc tcatttcatt gccaacattg ctttcttttc tattaagtgc aatttgaatg 1800

aaatgtgcga aataagctgc attaattttg tacttctttt gtttagtttg gtgtcagatc 1860

atgcaagcat ttccctctag caagttcctt gtcttgcatg tttacctctt ttagtgatac 1920

ttgaattaat gatgcctttc acatatttgc gttcattctg ttgctgtatg tgacattatg 1980

taacttataa ttcgttgcct gaatcatgaa ggaaggaatt tgatgctgaa acagaatcta 2040

aaaaagaagc atatgaaaag gcacatccta agaaggacga gcagaatgaa gggtgacatt 2100

tttacaggct gtctgttcaa ttacttttcc ttcctttaga gttcaaatca agaccatttt 2160

cctggaattt gtgttgcagc tatcctaaag gcctaattgt ggccttcaaa ttgaagagaa 2220

tcacggttga tggtggggtg caacaaaact gtgcagacaa tgatactgcc actgaagaag 2280

aaactccaaa gtccatgaag aaaacatcaa ctggggaatc tgaagagagg actaccgtga 2340

acagtgatat ggaggaacag aagtcatcag acgacatgac tgaagcgaaa gaagtgaatg 2400

ctggggaagc tacagaatct ggtgacaagt gcacagttga tgccttgcta gaaagtgaaa 2460

agaagggtga taatgaaaca tcgatcaaag atgacagagg cctctctggc aaagcgaata 2520

gtccaatctc aagggaagat ctaaaagaag cgttcaaaaa atttggaaca gttcgggtat 2580

tttaatccac accactttct agctttagtt tttcttggta taaacaccag taacagttct 2640

gtttaacatt atggaatgaa aattatgaaa catatagcat tcttctagat tcaaatatgg 2700

tccacagaga gctcagattt taactcatgg gtcatatggc attatctttg tactttcatt 2760

tgtccttaaa gatctggtgg gatattaagc atgacgagtt gtaaaattat taagatcaat 2820

taactatgga atgggaaatg cctgaaaatg ttcttgatac acaccataaa atcgtggtaa 2880

tagactaata gctagtccta attgtaaatt catatttgta aaagtttatt tatggtcctt 2940

ggaggagcac agttatgagg tagtggtatg acataatgtt aattatctat atctttggta 3000

cctggcatgg ctgtggtggt gaactgttca tattgtatgt cactatgtca caaattcaca 3060

tgacactttt taattccgtt ttttactttc attgcacatg tttttcttcc tgaagtatgt 3120

ggacttcagt atcggggatg aatcgggata ccttcgtttc gaggattcta aggcagctga 3180

aaaagcccgc atgtctgctg tattagctga tgaaggtggc ttgatagtta aagaccacat 3240

tgttaccttg gagcctgtga ctggtaattg acaatttgac atgtgtttat tagagttttt 3300

ttaataccat tactgcttgc attgtatcat gattaataaa tgtagaatat ccattataga 3360

aaatttttag ttccatttaa tgatacttag gtggaatcga ctcctattat tgtttgacgc 3420

tgtaaattaa ttcctcaaat ctggatgcaa ttaaattggt ttgtggggtc ttactttttt 3480

tgtttttgca ggtgaagctg agaaggatta ttggaataca atacgtggca ttcaagggaa 3540

atacaaggac aataggagtt acaaaggaag gtattcaatg aattaacagt ttaattttat 3600

ttgtttatgt cctgtttggt actacgtaca atattatctc tagaagtaat tgcagacaat 3660

tatcaggaaa ggcacactac agcattcagt aattttgtgg caaattagac cgaaataact 3720

ttgtgtgcct tttgagaatg ttatgacttt ttcatttgca attttcgagc tagatgacct 3780

gcgctaattg caatttattt gtgcattgca gtattgtggt taccacaaat atgctcctta 3840

attccttgta tatatatgtc gaatagatac ttccttgcac gaaaattgat catctcgtat 3900

gcccatgttt aatgttctct gcagaatata atgtgtcttt gccccttgtc atatatatgt 3960

tattgctctt tttctaggac tggaaagagc tacagaggag gaaagcagtt caatgggaag 4020

cgaggccgac attctgattc ctccgaaaag ggtgcgaata aaacacagaa ggtcgaagct 4080

gctgcttagg ctaattttaa cgtcttcact cgaccgagaa gtaacatgct acgcttacta 4140

tcggtggtct tgtatattta ttatatcaga gaccatttat taccatattt tgtgactgtt 4200

attgtccatt ttttatgcta accttgttcc aaggtatact tccgtaatga ttagccttta 4260

gtaacggctt tgccgtttac ttttgaatgg ctttggagga tataaccttg tatagctcca 4320

aacatgcaaa cccggagctg tttcctgcag cggagcagag cagctgtcct gacaatcttc 4380

agatatcttc accgtcctgg attgattac 4409

<210> 2

<211> 1404

<212> DNA

<213> Oryza sativa

<400> 2

atggccgccg ccaccgcggc gccgtcgatc gacgaggcca aggcgaagag cgttctccgc 60

caggtggagt tctacttcag cgacagcaac ctcccgcgcg ataagttcct gagggagacg 120

gtcgagcagc gcgaagatgg attggtaagc ttggctttga tatgctcttt cgcgcggatg 180

aagtcgcacc tcgggctgga cgccgccgtg aagcccgaaa ctgtgccaga ggagacagtg 240

ctcgcagtag cagaggtgct acgtcgttcc cagatgcttc gtatctcgga ggatggaaaa 300

atggttggtc gagctagtga gctgttgaag gcagatgaaa tcatcaagca agtggactca 360

aggacagttg ctgcgtcacc attgccttac aatgtaaagc tggaagatgt ccaatctttc 420

tttgcgcaat atgcaaaggt aaatagtgtc aggctaccac gccatatctc aaacaaaaaa 480

cacttctgtg gcactgcctt agttgaattt tcagaagagg atgaagcgaa aattgttttg 540

gagaataatt tgttctttgc aggggcaaat ctggaaataa aactaaagaa ggaatttgat 600

gctgaaacag aatctaaaaa agaagcatat gaaaaggcac atcctaagaa ggacgagcag 660

aatgaaggct atcctaaagg cctaattgtg gccttcaaat tgaagagaat cacggttgat 720

ggtggggtgc aacaaaactg tgcagacaat gatactgcca ctgaagaaga aactccaaag 780

tccatgaaga aaacatcaac tggggaatct gaagagagga ctaccgtgaa cagtgatatg 840

gaggaacaga agtcatcaga cgacatgact gaagcgaaag aagtgaatgc tggggaagct 900

acagaatctg gtgacaagtg cacagttgat gccttgctag aaagtgaaaa gaagggtgat 960

aatgaaacat cgatcaaaga tgacagaggc ctctctggca aagcgaatag tccaatctca 1020

agggaagatc taaaagaagc gttcaaaaaa tttggaacag ttcggtatgt ggacttcagt 1080

atcggggatg aatcgggata ccttcgtttc gaggattcta aggcagctga aaaagcccgc 1140

atgtctgctg tattagctga tgaaggtggc ttgatagtta aagaccacat tgttaccttg 1200

gagcctgtga ctggtgaagc tgagaaggat tattggaata caatacgtgg cattcaaggg 1260

aaatacaagg acaataggag ttacaaagga aggactggaa agagctacag aggaggaaag 1320

cagttcaatg ggaagcgagg ccgacattct gattcctccg aaaagggtgc gaataaaaca 1380

cagaaggtcg aagctgctgc ttag 1404

<210> 3

<211> 467

<212> PRT

<213> Oryza sativa

<400> 3

Met Ala Ala Ala Thr Ala Ala Pro Ser Ile Ala Gly Ala Leu Ala Leu

1 5 10 15

Ser Val Leu Ala Gly Val Gly Pro Thr Pro Ser Ala Ser Ala Leu Pro

20 25 30

Ala Ala Leu Pro Leu Ala Gly Thr Val Gly Gly Ala Gly Ala Gly Leu

35 40 45

Val Ser Leu Ala Leu Ile Cys Ser Pro Ala Ala Met Leu Ser His Leu

50 55 60

Gly Leu Ala Ala Ala Val Leu Pro Gly Thr Val Pro Gly Gly Thr Val

65 70 75 80

Leu Ala Val Ala Gly Val Leu Ala Ala Ser Gly Met Leu Ala Ile Ser

85 90 95

Gly Ala Gly Leu Met Val Gly Ala Ala Ser Gly Leu Leu Leu Ala Ala

100 105 110

Gly Ile Ile Leu Gly Val Ala Ser Ala Thr Val Ala Ala Ser Pro Leu

115 120 125

Pro Thr Ala Val Leu Leu Gly Ala Val Gly Ser Pro Pro Ala Gly Thr

130 135 140

Ala Leu Val Ala Ser Val Ala Leu Pro Ala His Ile Ser Ala Leu Leu

145 150 155 160

His Pro Cys Gly Thr Ala Leu Val Gly Pro Ser Gly Gly Ala Gly Ala

165 170 175

Leu Ile Val Leu Gly Ala Ala Leu Pro Pro Ala Gly Ala Ala Leu Gly

180 185 190

Ile Leu Leu Leu Leu Gly Pro Ala Ala Gly Thr Gly Ser Leu Leu Gly

195 200 205

Ala Thr Gly Leu Ala His Pro Leu Leu Ala Gly Gly Ala Gly Gly Thr

210 215 220

Pro Leu Gly Leu Ile Val Ala Pro Leu Leu Leu Ala Ile Thr Val Ala

225 230 235 240

Gly Gly Val Gly Gly Ala Cys Ala Ala Ala Ala Thr Ala Thr Gly Gly

245 250 255

Gly Thr Pro Leu Ser Met Leu Leu Thr Ser Thr Gly Gly Ser Gly Gly

260 265 270

Ala Thr Thr Val Ala Ser Ala Met Gly Gly Gly Leu Ser Ser Ala Ala

275 280 285

Met Thr Gly Ala Leu Gly Val Ala Ala Gly Gly Ala Thr Gly Ser Gly

290 295 300

Ala Leu Cys Thr Val Ala Ala Leu Leu Gly Ser Gly Leu Leu Gly Ala

305 310 315 320

Ala Gly Thr Ser Ile Leu Ala Ala Ala Gly Leu Ser Gly Leu Ala Ala

325 330 335

Ser Pro Ile Ser Ala Gly Ala Leu Leu Gly Ala Pro Leu Leu Pro Gly

340 345 350

Thr Val Ala Thr Val Ala Pro Ser Ile Gly Ala Gly Ser Gly Thr Leu

355 360 365

Ala Pro Gly Ala Ser Leu Ala Ala Gly Leu Ala Ala Met Ser Ala Val

370 375 380

Leu Ala Ala Gly Gly Gly Leu Ile Val Leu Ala His Ile Val Thr Leu

385 390 395 400

Gly Pro Val Thr Gly Gly Ala Gly Leu Ala Thr Thr Ala Thr Ile Ala

405 410 415

Gly Ile Gly Gly Leu Thr Leu Ala Ala Ala Ser Thr Leu Gly Ala Thr

420 425 430

Gly Leu Ser Thr Ala Gly Gly Leu Gly Pro Ala Gly Leu Ala Gly Ala

435 440 445

His Ser Ala Ser Ser Gly Leu Gly Ala Ala Leu Thr Gly Leu Val Gly

450 455 460

Ala Ala Ala

465

Claims (2)

1. Rice grain type related geneOsLa1Application of gene in regulation of rice grain type, wherein the regulation of rice grain type is characterized in that rice grain length is increased and rice grain width is reducedOsLa1The DNA sequence of the gene is shown as SEQ ID NO: 1 is shown in the specification; the rice grain type related geneOsLa1The cDNA sequence of the gene is shown in SEQ ID NO. 2;

encoding rice by transgenic technologyOsLa1The nucleotide sequence of (A) is transformed into rice to change the rice grain type, and the specific method is as follows:

1) mixing riceOsLa1The coding region of the gene is connected with a plant expression vector to form the rice-containing riceOsLa1Plant overexpression of the gene;

2) transferring the plant overexpression in the step 1) into agrobacterium EHA105, infecting rice callus with the agrobacterium containing overexpression, co-culturing at 28 ℃, sterilizing, screening antibiotics and differentiating to obtainRice (Oryza sativa L.) with improved resistance to stressOsLa1Overexpression of the gene.

2. Rice grain type related geneOsLa1Application of gene in regulation of rice grain type, wherein the regulation of rice grain type is characterized in that rice grain length, thousand grain weight and grain width are reduced, and the gene is related to rice grain typeOsLa1The DNA sequence of the gene is shown as SEQ ID NO: 1 is shown in the specification; the rice grain type related geneOsLa1The cDNA sequence of the gene is shown in SEQ ID NO. 2;

the specific method comprises the following steps:

1) mixing riceOsLa1The sgRNA fragment of the gene is connected to a plant expression vector to form a rice-containing geneOsLa1A CRISPR/Cas9 vector for a gene;

2) transferring the CRISPR/Cas9 vector in the step 1) into agrobacterium EHA105, infecting agrobacterium containing the CRISPR/Cas9 vector into rice callus, and performing co-culture, sterilization, antibiotic screening and differentiation at 28 ℃ to obtain riceOsLa1Transgenic plants of the genetic CRISPR/Cas 9.

Images