CN112522279B - Coding sequence of rice grain type gene OsGL8 gene and application - Google Patents

Abstract

A coding sequence and application of rice grain type gene OsGL8 relate to molecular biology and gene engineering. A gene related to the grain type development of rice is cloned, a cloned transgenic plant is obtained by transforming the rice, the function of the gene in the grain type growth and development process of the rice is determined by the phenotype observation and research of the transgenic rice, and a new target gene resource is provided for the cultivation of a new high-yield and high-quality rice variety. Provides the application of the gene for coding the rice OsGL8 protein in grain type. An OsGL8 gene related to rice grain type is separated and cloned from a rice chromosome fragment. Also comprises a recombinant vector of the gene sequence and a transgenic plant transformed by the vector. Grain size, grain width and thousand grain weight of OsGL8Cas9 transgenic plants are obviously reduced. Has obvious effect on plant breeding and high application value, and provides new target gene resources for breeding new high-yield and high-quality rice varieties.

Description

Coding sequence of rice grain type gene OsGL8 gene and application

Technical Field

The invention relates to the technical field of molecular biology and genetic engineering, in particular to a coding sequence of a rice grain type gene OsGL8 gene and application thereof.

Background

Rice (Oryza sativa L) is one of the most important food crops in the world, and more than 50% of the global population takes rice as staple food. With the increasing population of the world, the grain safety problem becomes more serious due to the fact that the available arable land area is less and less due to the development of industrialization and the global climate change is aggravated. Therefore, the cultivation of new varieties of high-yield and high-quality rice is the most effective means for solving the grain problems. The yield of rice is mainly composed of the number of effective ears per unit area, the number of ears and thousand kernel weight (Xing and Zhang, 2010). The grain shape of the rice mainly comprises three components of grain length, grain width and grain thickness, is one of key factors influencing grain weight, and directly determines the grain weight of the rice under the condition of ideal grouting degree.

The La protein referred to in this application was originally found as an autoimmune antigen in human patients with systemic lupus erythematosus and sjogren's syndrome (Alspaugh and Tan, 1975). Although first found in humans, later studies have shown that the homologous gene is widely present in eukaryotes, including yeast, insects, vertebrates, etc., and is a nuclear phosphorylated protein expressed in high abundance (Wolin and cedervalll, 2002). The La protein has been shown to be associated with most nascent small RNA (small RNAs), including tRNA precursor, 5SrRNA precursor and U6 small nuclear RNA, as well as a portion of the viral-encoded RNA (Kufel et al, 2000) La protein whose specific recognition site is 3' -UUU-OH (Stefano 1984), so that both the precursor transcript produced by RNA polymerase III (pretRNA) and a portion of the small RNA precursor produced by RNA polymerase II transcription containing this domain can be recognized and bound by the La protein. This binding helps these newly synthesized small RNAs from exonuclease cleavage (Maraia and intein, 2002), serving to aid assembly and allow proper folding. This La protein-mediated stabilizing structural role is essential for the maturation pathway of pre-tRNAs, and can promote the assembly of small RNAs into functional RNA-protein complexes, and contribute to the retention of some small RNAs in the nucleus (Grimm et al, 1997). Therefore, La protein plays a chaperone role during RNA synthesis.

In plants, 8 similar proteins of La or La were obtained by search with the La motif domain in the arabidopsis genome database (Fleurdepine et al, 2007). By comparison of protein structure and phylogeny, two of these are probably authentic La proteins, namely At4g32720(At32) and At1g79880(At79), which are expressed At different stages of the overall growth and development of the plant and under different regulatory conditions. At32 restores the nuclear function of the Saccharomyces cerevisiae La protein in the non-coding RNA synthesis and binds small RNAs containing 3' -UUUU-OH tails. It can be said that the nuclear function of La protein is performed by At32 and is highly conserved in Arabidopsis thaliana, so the gene encoding this protein was named AtLa 32. AtLa32 is a homologous gene of real La protein in Arabidopsis thaliana, and is mainly positioned in nuclear plasma of nucleus and nucleus cavity occasionally distributed. The deletion of AtLa32 in Arabidopsis resulted in a lethal embryonic phenotype, with insufficient development of embryos during the early globular stage. In addition, the mutated embryonic cells exhibited a nucleolar hypertrophy phenotype, suggesting that the AtLa32 protein plays an important role during embryogenesis.

In conclusion, the rice grain shape development is influenced by various factors, the research on the influence of the La protein on the rice grain shape development is not much, and the mechanism in the research is not very clear, so that the invention researches the biological function of the homologous gene OsGL8 of the Arabidopsis AtLa32 in the rice by methods such as molecular biology, genetic engineering and the like, and further reveals that the invention plays an important role in the growth and development of the rice grain shape.

Disclosure of Invention

The invention aims to clone a gene OsGL8 related to rice grain type development, obtain a cloned transgenic plant by transforming rice, confirm the function of the gene in the rice grain type growth and development process by phenotype observation and research of the transgenic rice, and provide a new target gene resource for breeding a new high-yield and high-quality rice variety.

Another objective of the invention is to provide application of a gene coding rice OsGL8 protein in grain type.

In order to achieve the purpose, the invention is realized by the following technical scheme:

the invention separates a gene OsGL8(LOC _ Os04g42010) from rice, the full length of the gene is 3936bp, the sequence of the cDNA coding region is 1308bp long, as shown in SEQ ID NO.1 and SEQ ID NO.2, the gene codes 435 amino acids, as shown in SEQ ID NO. 3.

According to the sequence information of the full-length cDNA sequence of the gene after sequencing verification, an over-expression vector of the gene is constructed, and a CRISPR/Cas9 vector is constructed, and is shown in a sequence table SEQ NO: 2 at positions 108 to 127. In order to determine the expression position of the gene in the cell, a GFP vector is further constructed, namely the expression mode of the gene is determined according to the expression condition of GFP, and the GFP vector is represented by the sequence table SEQ NO: 2.

The invention also provides a primer sequence for cloning the gene OsGL8 from rice mRNA by reverse transcription PCR, and primers for amplifying the rice OsGL8 gene are as follows:

Os04g42010-CDS-F：ATGGCCGCCGCCGCCACC

Os04g42010-CDS-R：TTAAGCAGCAGCATCGACTTTT

the invention also provides a vector containing the rice OsGL8 gene.

The invention also provides a host containing the rice OsGL8 gene vector. Preferably, the host is a eukaryotic cell. More preferably, the host is rice.

The invention also provides a transformed plant cell containing the rice OsGL8 gene.

The invention also provides application of the rice OsGL8 gene in the aspect of grain type.

The invention also provides a method for transforming the nucleotide sequence of the coded rice OsGL8 into rice by using a transgenic technology to change the rice grain type, which comprises the following steps:

(1) the coding region or sgRNA fragment of the rice OsGL8 gene is connected to a plant expression vector to form a plant overexpression or CRISPR/Cas9 vector containing the rice OsGL8 gene.

(2) Transferring the plant overexpression or CRISPR/Cas9 vector in the step (1) into agrobacterium EHA105, infecting agrobacterium containing the overexpression or CRISPR/Cas9 vector into rice callus, and performing co-culture, sterilization, antibiotic screening and differentiation (at 28 ℃) to obtain the rice OsGL8 gene overexpression and CRISPR/Cas9 transgenic plant. Compared with wild rice, the transgenic rice over expressing OsGL8 can improve the grain length of rice, and the grain length and grain width of Cas9 transgenic rice are obviously reduced.

The invention also provides a method for detecting the expression quantity in the transgenic rice, which mainly utilizes a fluorescent quantitative PCR method. The method comprises the following specific steps: taking leaves of transgenic rice, extracting rice RNA by using an RNA extraction kit, digesting DNA by using DNase1, then carrying out reverse transcription to form cDNA, and carrying out fluorescent quantitative PCR analysis by using the cDNA as a template. The nucleotide sequence of the fluorescent quantitative PCR primer is as follows:

qPCR—Os04g42010-F：GTGTCACCGAGGATGGGAAG

qPCR—Os04g42010-R：GTCGAGGTAGCCTCACACTG

the invention separates and clones OsGL8 gene related to rice grain type from rice chromosome segment. The invention also comprises a recombinant vector of the gene sequence and a transgenic plant transformed by the vector. Grain size, grain width and thousand grain weight of OsGL8Cas9 transgenic plants are obviously reduced. The gene provided by the invention has obvious effect in plant breeding, has high application value, and provides a new target gene resource for breeding a new high-yield and high-quality rice variety.

Drawings

FIG. 1 shows the sequence homology analysis of rice OsGL 8.

FIG. 2 shows PCR identification of over-expressing transgenic plants. In FIG. 2, P represents a positive control, N represents a negative control, and M represents a DNA molecule Marker.

FIG. 3 shows the detection of the expression level of OsGL8 gene in the overexpression transgenic plant.

Fig. 4 is a PCR identification of Cas9 transgenic plants. In FIG. 4, P represents a positive control, N represents a negative control, and M represents a DNA molecule Marker.

FIG. 5 shows mutation type analysis of T0 generation of Cas9 transgenic plants.

FIG. 6 depicts the transient expression mapping of OsGL8 protein.

FIG. 7 is a table of grain length and width of transgenic plant grains.

FIG. 8 shows the grain length and width statistics of transgenic plants. In fig. 8 Bar is 1 cm.

FIG. 9 shows the thousand kernel weight analysis of rice OsGL8 transgenic plant grains.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the following embodiments will be further described with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. On the contrary, the invention is intended to cover alternatives, modifications, equivalents and alternatives which may be included within the spirit and scope of the invention as defined by the appended claims. Furthermore, in the following detailed description of the present invention, certain specific details are set forth in order to provide a better understanding of the present invention. It will be apparent to one skilled in the art that the present invention may be practiced without these specific details.

The experimental procedures, for which specific conditions are not specified in the following examples, are carried out according to conventional conditions, for example, as described in the handbook of molecular cloning laboratories (New York: Cold Spring Harbor Laboratory press,1989), or according to the conditions recommended by the manufacturer.

Example 1 cloning of cDNA fragment of OsGL8 gene of rice.

1. Extraction of RNA: reference is made to Promega

Super total RNA extraction kit catalog # S104). The rice material was taken in a mortar, rapidly frozen with liquid nitrogen and ground until the tissue was completely ground to a powder. And (3) rapidly transferring the powdery sample to an EP tube without nuclease, adding 300-500 mu L of cracking liquid, repeatedly blowing and beating, and adding an equal volume of diluent. After 5min at room temperature, centrifuge at maximum speed for 5 min. Carefully pipette the supernatant into a new 1.5mL nuclease-free EP tube, add 0.5 times the volume of the supernatant in absolute ethanol, pipette 3-4 times to mix well. The mixture was transferred to a spin column and then centrifuged at 12000g for 1 min. Discarding the filtrate, replacing the column into the collection tube, adding 600 μ L RNA washing solution into the column, centrifuging at 12000g for 1min, and discarding the filtrate. Add 50. mu.L DNase I incubation to the center of the column and let stand at room temperature for 30 min. Add 600. mu.L RNA wash to the column, centrifuge at 12000g for 1min, discard the filtrate. After repeated one time, the column was replaced on the collection tube and centrifuged at 12000g for 2 min. Transferring the column to an elution tube, adding 50 μ L of nuclease-free water into the center of the column membrane, standing at room temperature for 2min, and centrifuging at 12000g for 1 min. Will be provided withAdding the eluted eluate back to the center of the centrifugal column, standing at room temperature for 2min, centrifuging at 12000g for 1min, eluting again, and storing RNA at-80 deg.C. The RNA content was then determined on a spectrophotometer.

2. Reverse transcription: reference is made to GoScript from Promega^TMThe reverse transcription kit catalog # A2790 is characterized in that an RNA sample is incubated at 70 ℃ for 5min to open a higher-order structure, and after the higher-order structure is opened, the RNA sample is immediately placed on ice to configure the following reaction system:

(1) the reaction system (20. mu.L) was:

(2) the reaction conditions are as follows:

the reacted sample is stored at4 ℃ for a short time and at-20 ℃ for a long time.

3. cloning of cDNA, designing a primer (SEQ ID NO.4) according to sequence information provided in Rice database information in Rice Genome Annotation Project, and carrying out cDNA full-length cloning by adopting an RT-PCR method.

Obtaining a coding region containing a complete open reading frame by RT-PCR, wherein the length of the coding region is 1308 bp; recovered, ligated to pMD19-T vector, and sequenced. The sequencing results were analyzed on DNMAN software and showed a perfect match with the rice annotation gene LOC _ Os04g 42010.

Example 2 sequence information and homology analysis of rice OsGL 8.

The length of the full-length coding region of the rice OsGL8 is 1308bp, and the sequence of the full-length coding region is shown as SEQ ID NO. 2. The amino acid sequence of the rice OsGL8 is deduced according to the full-length cDNA, and the amino acid sequence is 436 amino acid residues in total, the molecular weight is 48295.8 daltons, the isoelectric Point (PI) is 5.3685, and the sequence is shown in SEQ NO. 3.

BLAST alignment of the protein in GenBank was performed to obtain a protein homologous to the protein, alignment was performed using Clustal x software, and then a phylogenetic tree was constructed using MEGA7 software according to the neighbor method (FIG. 1).

Example 3 identification of rice OsGL8 Gene over-expression in Rice and CRISPR/Cas9 and transgenic plants

1. Construction of overexpression vector of rice OsGL8 gene

According to the full-length sequence of the rice OsGL8 gene, a primer for amplifying a complete coding reading frame is designed, and an additional base is introduced to an upstream primer so as to construct an overexpression vector. The amplified product obtained in example 1 was used as a template, after PCR amplification, the cDNA of the OsGL8 gene of rice was cloned into an overexpression vector (e.g., pCXUN-HA), sequenced, the overexpression vector was transferred into Agrobacterium under the premise of ensuring the right reading frame, and transformed into the model plant rice Nipponbare.

According to a PAM site designed in Rice Information GateWay (RIGW) Rice database Information, a CRISPR target site (sgRNA) is designed. The target site primer is as follows:

Os04g42010-sgRNA-F：CTTCCTGCGGAAGACAGTCG

Os04g42010-sgRNA-R：CGACTGTCTTCCGCAGGAAG

after synthesizing a primer dimer, carrying out enzyme digestion connection on the primer dimer and a purified and recovered BsaI enzyme digestion CRISPR/Cas9 entry vector pU3-sgRNA, transforming escherichia coli DH5 alpha, and carrying out PCR identification on a bacterial liquid and positive monoclonal sequencing to obtain an entry vector recombinant plasmid pU3-OsGL 8-sgRNA. And then the LR reaction is carried out with the target carrier pH-ubi-cas9 through a Gateway system.

The LR reaction system (5. mu.L) was as follows:

incubate at 25 ℃ for 2 h. Through escherichia coli transformation and identification, the final sequencing is correct, and then the CRISPR/Cas9-OsGL8 gene editing vector is successfully constructed. After the recombinant vector is transformed into the agrobacterium EHA105 by heat shock, the recombinant vector is transformed into the Nipponbare rice by an agrobacterium-mediated transformation method.

2. Agrobacterium mediated transformation of rice.

A Induction of callus

(1) Selecting intact rice seeds without mildew, removing seed coat, sterilizing the seeds with 75% ethanol for 3 times, each time for 1min, and washing with sterile water. After the water is poured to dryness, 10% sodium hypochlorite solution is added, the vacuum pumping is carried out for 8min, and then the mixture is placed on a shaking table for 180r/min and shaken for 15min at the temperature of 30 ℃.

(2) Pouring the sodium hypochlorite solution in a clean bench, washing with sterile water for several times, spreading on a dish filled with filter paper sterilized in advance, sucking water, inoculating the seeds on NBD medium with tweezers (taking care of sterile operation), allowing the embryos to face down or contact the medium, and performing dark culture at 28 ℃ for 21 days. 12-14 grains per tissue culture bottle.

B subculture

And (3) stripping off embryonic roots and embryos around the callus, airing the callus on clean filter paper, transferring the callus to an NBD subculture medium, and carrying out dark culture for 7-9 days at 28 ℃.

Culture of Agrobacterium C EHA105

The correctly cloned Agrobacterium culture solution obtained in the previous experiments was spread on YEP resistant plates and incubated at 28 ℃ in the dark for about 36 h. Selecting monoclonal amplification culture, infecting when the OD600 of the agrobacterium liquid is 0.3-0.8, centrifuging at 4000rpm at room temperature for 8min, removing the upper layer of the liquid, and collecting thalli. And (3) resuspending the bacteria by using a proper amount of AAM-As culture medium, inducing toxicity, finally enabling the OD600 value of the bacteria liquid to be about 0.6, and standing for half an hour in a dark place for infection.

D. Infection and co-culture

(1) Selecting callus with good growth condition and compact structure, soaking in infection solution, fully inverting, mixing, and standing at room temperature for 30 min.

(2) Pouring off the staining solution, transferring the callus to a dish filled with sterilized filter paper for full blow drying, transferring to an NBD-As co-culture medium, adding a sterilized filter paper on the culture medium to prevent overgrowth of the agrobacterium, and performing dark culture at 28 ℃ for 3 days.

(3) Transferring the callus into a centrifuge tube, slightly turning and mixing uniformly, standing for 15min and 20min, and mixing uniformly once at an interval of 5 min.

(4) Pouring out the bacterial liquid, placing the callus on sterile filter paper for drying for more than 1.5h, ensuring that the bacterial liquid is sucked dry, inoculating the bacterial liquid on a co-culture medium, and culturing for 2-3 days at 20 ℃ in a dark environment.

E Sterilization

(1) Transferring the callus after 3 days of co-culture to a triangular flask, and washing with sterilized water for more than 3 times until the liquid is clear.

(2) Pouring out sterile water, washing with sterile water containing 100mg/L of cefuroxime and 100mg/L of carbenicillin until the water is clear, and oscillating at the temperature of 28 ℃ and the rpm of 200 for 20min for 3-4 times.

(3) The washed callus was poured on sterile filter paper and fully dried, transferred to a selection medium (NBD +50mg/L hygromycin B +125mg/L cefuroxime +125mg/L carbenicillin), cultured at 28 ℃ in the dark. The culture medium can be replaced every 15 or 20 days.

F differentiation

The newly selected calli were transferred to a differentiation medium (MS +2mg/L6-BA +2mg/L KT +0.2mg/L NAA +600mg/L casamino acid +300mg/L L-Proline +13g/L sorbitol +0.2mg/L IAA +50mg/L hygromycin +125mg/L cephamycin +125mg/L carbenicillin) for 16h light culture at 28 ℃.

G root taking

Differentiated transgenic shoots (> lcm high), were stripped of excess callus, and roots (approximately 0.5cm) were excised and transferred to 1/2MS medium for rooting. Incubated at 28 ℃ for 16h in light.

H hardening and transplanting

After rooting, the rooting medium can be removed, and the seedlings are soaked in water for several days for hardening and then transplanted into soil for growing.

3. Identification of transgenic plants

A. Identification of overexpressed transgenic seedlings

(1) Transgenic T0 rice leaves are cut, and DNA of the rice leaves is extracted by a CTAB method. Wild type Nipponbare was used as a negative control (N) and the vector plasmid was used as a positive control (P). The transgenic condition is detected by PCR identification by using a vector specific primer Ubip FOR and a fragment primer Os04g42010-qPCR-R (figure 2). 20 strains are identified in total, each strain can amplify a DNA fragment of about 600bp, and the DNA fragment is proved to be an over-expression positive transgenic plant, and the positive rate is 100%.

(2) And extracting leaf RNA by using an RNA extraction kit, carrying out reverse transcription to obtain cDNA (the method is the same as example 2), designing a primer according to a gene sequence, and carrying out fluorescent quantitative PCR analysis on the expression condition of the OsGL8 gene of the transgenic rice, wherein the specific operation is carried out according to the instruction of a kit of TAKARA company, and a fluorescent quantitative PCR instrument is Applied Biosystems. Compared with wild type, OsGL8 was overexpressed by 10-60 fold differently (FIG. 3).

Cas9 transgenic shoot identification

Transgenic T0 rice leaves are cut, and DNA of the rice leaves is extracted by a CTAB method. Taking a wild Nipponbare as a negative control (N), taking a vector plasmid as a positive control (P), and carrying out PCR identification detection by adopting a vector framework specific primer Cas9 screen F/R, wherein the fragment size is 500 bp. The pH-ubi-cas9 vector fragment was detected in 16 transgenic plants tested (FIG. 4). Cas9 vector backbone specific primers were:

Cas9 screen-F：CCCCAAAGAAGAAGCGCAAG

Cas9 screen-R：CTGCACGAGCTGGATGAACA

in order to identify mutation sites of Cas9 transgenic plants, specific primers Cas9-42010JDFOR/REV are designed to amplify and sequence about 400bp sequences upstream and downstream of CRISPR sites. The sequencing result shows (figure 5), the obtained transgenic plant has mutation in different conditions in the target site region, wherein, the No.1 and No.2 strains have base deletion and promote the subsequent translation site to form TAA terminator sequence, and are both homozygous mutation. The sequencing specific primers are as follows:

cas9-Os04g42010-JD-F：GCCAAAGCCAAGGAGGTTC

cas9-Os04g42010-JD-R：CATGGTCTCCTGCTTCACGT

example 4 analysis of transient expression of Rice OsGL8 Gene in tobacco

The gene was ligated to the vector for transient expression pH7WG2, Agrobacterium GV3101 was transformed, Agrobacterium containing the transient expression plasmid was injected into tobacco leaves along the tobacco vein with a micro-syringe, and after 3 days of culture, the leaves at the injection site were torn and photographed under laser confocal observation, and the protein was localized in the nucleus as shown (FIG. 6).

Example 5 detection of grain type and thousand Kernel weight of OsGL8 Gene of Rice

After the rice is mature, grains of the wild type strain, the overexpression strain and the Cas mutant strain are respectively collected, the grains are placed in a drying oven at the temperature of 60 ℃ to be dried to constant weight, and then grain length, grain width and thousand grain weight are measured. 10 strains were measured.

A. Grain length: randomly picking 10 mature and plump grains from each sample, closely arranging the grains in a line on coordinate paper in an end-to-end, non-overlapping and non-gap mode, measuring the length of the grains, repeating the steps twice, and calculating the average length of each grain, namely the grain length. The results show that grain size of OsGL8 overexpressing transgenic plants is increased and grain size of OsGL8Cas9 transgenic plants is decreased compared to wild type (FIGS. 7 and 8).

B. And (3) grain width, namely randomly picking 10 mature and full grains from each sample, closely arranging the 10 grains in a line on coordinate paper according to shoulder-to-shoulder (namely width direction), measuring the width of the grain, repeating the measurement twice, and calculating the average width of each grain to be the grain width. Grain width of OsGL8Cas9 transgenic plants was smaller than wild type (FIG. 8).

C. Thousand grain weight of grains: randomly picking 100 mature and plump grains from each sample, weighing the grains, repeating the weighing twice, calculating the average value of the grains, and finally converting the average value into the weight of thousands of grains. Grain thousand kernel weight was significantly reduced in OsGL8Cas9 transgenic plants compared to wild type (FIG. 9).

Sequence listing

<110> university of mansion

<120> coding sequence of rice grain type gene OsGL8 gene and application

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3936

<212> DNA

<213> Oryza sativa

<400> 1

ctaactcctt ctcccccaaa ttcgctagag ccatggccgc cgccgccacc gccgccgtcc 60

ccctcgacga ggccaaagcc aaggaggttc tccgccaggt tcgcgattcc taccccgttc 120

ccggatcctg cccgttctgg cccctcaaat tatgggggaa tttttcagat cgaagtcgct 180

tagcgttctt ttgttctgca ccgcaggtgg agttctactt cagcgacagc aacctccccc 240

gcgacaactt cctgcggaag acagtcgagg agagcgagga tggccgtaag gattcgtctc 300

ctctcctttt tgttcatgat cctgtctgtg tgtgattctg gacttctggt gctaagtctg 360

gtgttgttta tgggtgtgtt gggattgggc agtggtgagc ttggcactca tctgctcctt 420

ctcgcggatg aagaagcacc taggcctgga cttggacgtg aagcaggaga ccatgccgga 480

ggagacggtg ctcgccgttg ccgaggtgct gcggcgttcc tcggccctcc gtgtcaccga 540

ggatggtaag gaagttattt tgtcacatac gtgcaccatt acacagtcga agttcatgtg 600

ttgacagcaa aagaggctta acttcattct gtttagattt tttagagaga aatttgttgc 660

tcatattgac aatgtcagct taaattccaa taccatgttt ttttttcgcc ccctttaact 720

gtttttttga cagggaagaa agttggcaga tcaattgagt tgtcgaaact ggatgagatc 780

atggagcaag tggactctag gacaattgct gcatcaccat ttccttacaa tgtaaagctg 840

gaagatgttc agtctttctt tgctcagtat ggcaaggtat acatgactag catttagtag 900

caaagcaaat atcacatatg gtctgcaaaa ctgttaagat tgatgcatag ggtagtcaag 960

aattcagcaa cccccaacaa catgggacat ttatgagtcc tggaatttaa atgatgatgc 1020

catgatgatg atgataatga tgctatgctg catctgaact gtttgcatca caggtgaaca 1080

gtgtgaggct acctcgacat attgccgaca aacgacactt ctgcggcact gctttagtcg 1140

aattttcaga agaagaggaa gcaaatgctg tattaaagaa tactcttgtt tttgcagaag 1200

cagatctgga aataaaacca aagtaagcca actactgctc aagcttcttt cctcgtacta 1260

tactgattag ctagagattt atgtctccat gctttgggca aattcttcat ttcttttttg 1320

aaacgacaat ttttcatttc ttatttagtt attttttatg ttatgcttct atagtaattg 1380

cagttgttga ttgcaacttg cttagctgca atatgtcctg ttgtttcttc atcatatttg 1440

ataaatgtta actgaaccag ttcctcattt cacatagttg aatctattta ttaactgaat 1500

atcattctga taaccgtcat gcaatcctga aaaaaatgaa ggaaagaatt tgatactgaa 1560

agagaggcta agaaagaagc ttatgagaag tcacaaccta ctaagaatgg tcatgatgag 1620

gggtaaacat ttctttacta acaactttac aaatggtttt ttcaatttcc ttgagttgaa 1680

gataaccgag tcataaaaat tggttataga tatccaaaag gtctaattgt ggccttcaag 1740

ctgaagataa ttcaaattga tggtggcatg gcagaaaatg gtggggacaa agagggtgaa 1800

actgatgatg ccaataaatc aagaacaggg catgacgaga aaatccctga gaacagtgat 1860

atcaaggaag acttgtcaga tgatgttgag aagtcaaaag aggcagctgc tcaatctgtt 1920

aagaaaggag aaagtccttc agaaaatgcg gatgatccaa tttcaaggga agattttaaa 1980

gaagaatttg gcaaattcgg cacagtgcgg gtaacttttc caataattga tgatgtttgt 2040

ttttcatatt gattttgttt caccaggagt aacctgaggt tgtaaatctg gtgtgcattg 2100

cataaaatat ccagaataga taggttgcat atttcatttg gccgactatt gtttgctgta 2160

gatcgtgaga ctgttatgat gcatacaact gagcttagct tgttagtttt ttttttaatg 2220

aaaagtgctt gttggcttca atgacggagt catacagtta tgtgatcaca atagcatgct 2280

gttatgttat atttattcat gctatttttg taggatttgg taaatgatag caacacttag 2340

ttcaatgtcg atcatattac ctttgtgcta attggacaaa cctaatctag tcaaacgtgt 2400

agagctacag tgagatgatc caatagttcg tgttcttact cttactgcct tttgtaagca 2460

cacatttgtc tggagagaaa gcaagagaaa taatgcttca tcttgtaaag acatctacac 2520

catgctttta tgcaattctg tatcttgctt tctaatttct acaagtaaac ataatctctt 2580

ttatcagaca acttatgctg attcaaaact ctttcttttt tattgttcca ttttcccccc 2640

ttgaagtatg tggacttcag cataggggag gattcaggat acattcggtt cgaggattct 2700

aaggcagctg aaaaggcccg tgcacttgcg gctatttcag atgaaggtgg tttgattatg 2760

aagggccatc ttgttacttt ggaacctgtg tccggtaaga actgcacttt ctttcagtta 2820

attattattt tttagctttt gttgaactga gtaactaaat caaccacaaa attgatgcct 2880

tattgatatg tcatatggtt ggcattcctg ctttaggtgt atttaggtgt actgtttaac 2940

catgagtttt aagcagaagc tgtcttgatg tattgatgct tgacttcaaa aaatcgctaa 3000

tgatccatca aattggtata gaaaaagcat aacacttcag cggatttgaa tgctatgttt 3060

tatcactatt ttgatgattt actgttcctt tcattcaggt caagctgaga aggattattg 3120

gagtgcgata aagggcggtc aaggaaaata tagagacaat agaagtaaca ggggaaggta 3180

tttcatttta cctcagaatc attcttcctg tctgtttgct ctgttagagc cgatcctctt 3240

aaatatcata atgcacctag aatgaatctt aggagtgggc tgaaacttaa aatagaagtt 3300

gaagccttat ggcacacaag aatgccaaca catatatttg gagttatatt atcatggaac 3360

tggcagtaac cagtttatct gtcaatagga ttgccatccc ctatttaatc actcactagc 3420

tacaaaccta tggtcctttt tcaaatatgt actacaaaaa aagcaacagg catgtcatga 3480

aatgcaatct catgtagtat atgtacagta tacactttga taagctgttg gcagaagata 3540

atgctggttg ctttgcatga acttttctag ggactggaag aataacaggg gcgggaggca 3600

cttcggtggg aagcgtggtc gccactcgga cggccatgaa agggcaaata aagctcgaaa 3660

agtcgatgct gctgcttaaa ggcctcgtcg tcttatacta gtaacctcag cttatgagct 3720

ctagtgagga acggaaatgt ttgctccgtt gcttgcttcc acaactttgg gagcaaacct 3780

tttgtgttgt gtttcttgtc gtgagctatg ctctttggaa gtaagaaacg gtgaactcat 3840

gatgaaacgg aaaattttgt tcggtcaaag cttgggatga atcctttaca tgtatctgat 3900

atatatacta atacttccgt catctgaata tctgat 3936

<210> 2

<211> 1308

<212> DNA

<213> Oryza sativa

<400> 2

atggccgccg ccgccaccgc cgccgtcccc ctcgacgagg ccaaagccaa ggaggttctc 60

cgccaggtgg agttctactt cagcgacagc aacctccccc gcgacaactt cctgcggaag 120

acagtcgagg agagcgagga tggcctggtg agcttggcac tcatctgctc cttctcgcgg 180

atgaagaagc acctaggcct ggacttggac gtgaagcagg agaccatgcc ggaggagacg 240

gtgctcgccg ttgccgaggt gctgcggcgt tcctcggccc tccgtgtcac cgaggatggg 300

aagaaagttg gcagatcaat tgagttgtcg aaactggatg agatcatgga gcaagtggac 360

tctaggacaa ttgctgcatc accatttcct tacaatgtaa agctggaaga tgttcagtct 420

ttctttgctc agtatggcaa ggtgaacagt gtgaggctac ctcgacatat tgccgacaaa 480

cgacacttct gcggcactgc tttagtcgaa ttttcagaag aagaggaagc aaatgctgta 540

ttaaagaata ctcttgtttt tgcagaagca gatctggaaa taaaaccaaa gaaagaattt 600

gatactgaaa gagaggctaa gaaagaagct tatgagaagt cacaacctac taagaatggt 660

catgatgagg gatatccaaa aggtctaatt gtggccttca agctgaagat aattcaaatt 720

gatggtggca tggcagaaaa tggtggggac aaagagggtg aaactgatga tgccaataaa 780

tcaagaacag ggcatgacga gaaaatccct gagaacagtg atatcaagga agacttgtca 840

gatgatgttg agaagtcaaa agaggcagct gctcaatctg ttaagaaagg agaaagtcct 900

tcagaaaatg cggatgatcc aatttcaagg gaagatttta aagaagaatt tggcaaattc 960

ggcacagtgc ggtatgtgga cttcagcata ggggaggatt caggatacat tcggttcgag 1020

gattctaagg cagctgaaaa ggcccgtgca cttgcggcta tttcagatga aggtggtttg 1080

attatgaagg gccatcttgt tactttggaa cctgtgtccg gtcaagctga gaaggattat 1140

tggagtgcga taaagggcgg tcaaggaaaa tatagagaca atagaagtaa caggggaagg 1200

gactggaaga ataacagggg cgggaggcac ttcggtggga agcgtggtcg ccactcggac 1260

ggccatgaaa gggcaaataa agctcgaaaa gtcgatgctg ctgcttaa 1308

<210> 3

<211> 435

<212> PRT

<213> Oryza sativa

<400> 3

Met Ala Ala Ala Ala Thr Ala Ala Val Pro Leu Asp Glu Ala Lys Ala

1 5 10 15

Lys Glu Val Leu Arg Gln Val Glu Phe Tyr Phe Ser Asp Ser Asn Leu

20 25 30

Pro Arg Asp Asn Phe Leu Arg Lys Thr Val Glu Glu Ser Glu Asp Gly

35 40 45

Leu Val Ser Leu Ala Leu Ile Cys Ser Phe Ser Arg Met Lys Lys His

50 55 60

Leu Gly Leu Asp Leu Asp Val Lys Gln Glu Thr Met Pro Glu Glu Thr

65 70 75 80

Val Leu Ala Val Ala Glu Val Leu Arg Arg Ser Ser Ala Leu Arg Val

85 90 95

Thr Glu Asp Gly Lys Lys Val Gly Arg Ser Ile Glu Leu Ser Lys Leu

100 105 110

Asp Glu Ile Met Glu Gln Val Asp Ser Arg Thr Ile Ala Ala Ser Pro

115 120 125

Phe Pro Tyr Asn Val Lys Leu Glu Asp Val Gln Ser Phe Phe Ala Gln

130 135 140

Tyr Gly Lys Val Asn Ser Val Arg Leu Pro Arg His Ile Ala Asp Lys

145 150 155 160

Arg His Phe Cys Gly Thr Ala Leu Val Glu Phe Ser Glu Glu Glu Glu

165 170 175

Ala Asn Ala Val Leu Lys Asn Thr Leu Val Phe Ala Glu Ala Asp Leu

180 185 190

Glu Ile Lys Pro Lys Lys Glu Phe Asp Thr Glu Arg Glu Ala Lys Lys

195 200 205

Glu Ala Tyr Glu Lys Ser Gln Pro Thr Lys Asn Gly His Asp Glu Gly

210 215 220

Tyr Pro Lys Gly Leu Ile Val Ala Phe Lys Leu Lys Ile Ile Gln Ile

225 230 235 240

Asp Gly Gly Met Ala Glu Asn Gly Gly Asp Lys Glu Gly Glu Thr Asp

245 250 255

Asp Ala Asn Lys Ser Arg Thr Gly His Asp Glu Lys Ile Pro Glu Asn

260 265 270

Ser Asp Ile Lys Glu Asp Leu Ser Asp Asp Val Glu Lys Ser Lys Glu

275 280 285

Ala Ala Ala Gln Ser Val Lys Lys Gly Glu Ser Pro Ser Glu Asn Ala

290 295 300

Asp Asp Pro Ile Ser Arg Glu Asp Phe Lys Glu Glu Phe Gly Lys Phe

305 310 315 320

Gly Thr Val Arg Tyr Val Asp Phe Ser Ile Gly Glu Asp Ser Gly Tyr

325 330 335

Ile Arg Phe Glu Asp Ser Lys Ala Ala Glu Lys Ala Arg Ala Leu Ala

340 345 350

Ala Ile Ser Asp Glu Gly Gly Leu Ile Met Lys Gly His Leu Val Thr

355 360 365

Leu Glu Pro Val Ser Gly Gln Ala Glu Lys Asp Tyr Trp Ser Ala Ile

370 375 380

Lys Gly Gly Gln Gly Lys Tyr Arg Asp Asn Arg Ser Asn Arg Gly Arg

385 390 395 400

Asp Trp Lys Asn Asn Arg Gly Gly Arg His Phe Gly Gly Lys Arg Gly

405 410 415

Arg His Ser Asp Gly His Glu Arg Ala Asn Lys Ala Arg Lys Val Asp

420 425 430

Ala Ala Ala

435

Claims (2)

1. Rice grain type geneOsGL8Use of the coding sequence of a gene in the context of a granule, said granuleThe type is rice grain length, grain width and grain thousand seed weight reduction, and it is characterized by that the rice grain type geneOsGL8The coding sequence of the gene is separated from rice to obtain a gene related to rice grain type developmentOsGL8（LOC_Os04g42010) The total length of the gene is 3936bp, the sequence of the cDNA coding region is 1308bp, as shown in SEQ ID NO.1 and SEQ ID NO.2, the gene codes 435 amino acids, as shown in SEQ ID number 3;

the rice grain type geneOsGL8The CRISPR/Cas9 vector of the gene is shown in a sequence table SEQ NO: 2 at positions 108 to 127;

the method comprises the following specific steps:

(1) mixing riceOsGL8The sgRNA fragment of the gene is connected to a plant expression vector to form a rice-containing geneOsGL8A CRISPR/Cas9 vector for a gene;

(2) transferring the CRISPR/Cas9 vector in the step (1) into agrobacterium EHA105, infecting agrobacterium containing the CRISPR/Cas9 vector on rice callus, co-culturing, sterilizing, screening antibiotics and differentiating at 28 ℃ to obtain riceOsGL8Transgenic plants of the genetic CRISPR/Cas 9.

2. Rice grain type geneOsGL8Use of the coding sequence of a gene in the grain type aspect, which is an increase in grain length of a grain, characterized in that the rice grain type gene isOsGL8The coding sequence of the gene is separated from rice to obtain a gene related to rice grain type developmentOsGL8（LOC_Os04g42010) The total length of the gene is 3936bp, the sequence of the cDNA coding region is 1308bp, as shown in SEQ ID NO.1 and SEQ ID NO.2, the gene codes 435 amino acids, as shown in SEQ ID number 3;

the method comprises the following specific steps:

(1) mixing riceOsGL8The coding region of the gene is connected with a plant expression vector to form the rice-containing riceOsGL8Plant overexpression of the gene;

(2) transferring the plant overexpression in the step (1) into agrobacterium EHA105, infecting rice callus with the overexpressed agrobacterium into the rice callus, and performing co-culture, sterilization, antibiotic screening and differentiation at 28 ℃ to obtain the agrobacterium tumefaciensObtaining riceOsGL8Overexpression of the gene.

Images