CN107475264B - Application of DGM1 protein in improving plant root hair generation capability - Google Patents

Abstract

The invention discloses application of DGM1 protein in improving the root hair generation capability of plants. The invention provides application of DGM1 protein or a coding gene thereof in improving the root hair generating capability of plants; the DGM1 protein can be any one of the proteins in the sequences 2-6 in the sequence table. The invention over-expresses AtDGM1 in plants, and finds that the length and density of plant root hairs can be obviously improved without changing other growth and development traits of the plants. The AtDGM1 gene is directly originated from plants, so that the AtDGM1 gene has less risk in biosafety. In addition, the AtDGM1 gene has homologous genes in other important crops such as rice, soybean, rape and tomato, so that the AtDGM1 gene has more choices in the construction of transgenic plants. The invention provides gene resources for cultivating new crop varieties capable of efficiently absorbing soil nutrients by using genetic engineering means, and can be used for cultivating new crop varieties capable of efficiently absorbing soil nutrients.

Description

Application of DGM1 protein in improving plant root hair generation capability

Technical Field

The invention belongs to the technical field of biology, and relates to application of DGM1 protein in improving the generation capacity of plant root hairs.

Background

The surface area of the root hair accounts for about 70% of the total surface area of the plant root system, is the tissue with the most active water and nutrient absorption of the root system, and is an important component of the external signal sensed by the plant root system. Root hair is a single cell, tubular projection that is formed by the overhang of specific epidermal cells in the mature region of the root. The root hair is used as the direct contact part of the plant root and the soil, and the increase of the number and the length of the root hair can increase the contact area of the epidermal cells of the plant root and the soil, and is beneficial to improving the stability of the root in the soil, the interaction of the root and microorganisms and the absorption of the root to the soil nutrition. Root hairs can also affect the environment around the root system by secreting large amounts of organic acids, enzymes, mucus and secondary metabolites. Studies have shown that by increasing the density and length of root hairs, the nutrient absorption efficiency of plants can be improved. In Arabidopsis, the determination of root hair cell fate is related to where it is located. Epidermal cells (hair-producing cells) located between two cortical cells are able to differentiate to form root hair, while epidermal cells (non-hair-producing cells) located above one cortical cell are unable to develop into root hair.

When the environment is lack of nutrition (such as phosphorus deficiency, iron deficiency and the like), a plurality of root hairs are formed on the roots of the plants so as to improve the absorption efficiency of the plants on the nutrition. These nutritional stresses may promote root hair growth and elongation, increase root hair length and growth period, further increase the rate at which root hair is formed by hair-forming cells, or convert non-hair-forming cells into hair-forming cells. However, the molecular mechanisms governing these processes are not currently understood. The elucidation of the molecular mechanism for regulating the growth and development of root hairs not only helps us to understand the rule of plant cell development and differentiation deeply, but also can better serve the production practice. The method has important significance in improving the generation capacity (including the number and the length of the root hairs) of the plant root hairs and further applying the method to crop breeding.

Disclosure of Invention

The invention aims to provide a new application of DGM1 protein.

First, the present invention provides the use of DGM1 protein or its coding gene in improving the root hair generating ability of plants.

Wherein, the DGM1 protein can be any one of the following proteins:

(A1) protein (Arabidopsis source) with the amino acid sequence of sequence 2 in the sequence table;

(A2) protein (rice source) with the amino acid sequence of sequence 3 in the sequence table;

(A3) protein (soybean source) with an amino acid sequence of sequence 4 in the sequence table;

(A4) protein (rape source) with amino acid sequence of sequence 5 in the sequence table;

(A5) protein (tomato source) with the amino acid sequence of sequence 6 in the sequence table;

(A7) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in any one of the sequences 2-6 in the sequence table and has the same function;

(A8) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to the amino acid sequence defined in any one of (A1) to (A7) and having the same function;

(A9) a fusion protein obtained by attaching a tag to the N-terminus and/or C-terminus of the protein defined in any one of (A1) to (A8).

In a second aspect, the invention provides the use of a DGM1 protein or a gene encoding the same for promoting root hair elongation and/or increasing root hair density in plants. Wherein, the DGM1 protein is a protein shown in any one of the preceding paragraphs (A1) - (A9).

Third, the present invention provides a method for cultivating a plant having a higher root hair generating ability.

The method for cultivating the plant with stronger root hair generating capability provided by the invention specifically comprises the step of improving the expression quantity and/or activity of the DGM1 protein in the receptor plant. Wherein, the DGM1 protein is a protein shown in any one of the preceding paragraphs (A1) - (A9).

Fourth, the present invention provides a method for cultivating a transgenic plant having a higher root hair generating ability.

The method for cultivating the transgenic plant with stronger root hair generating capability provided by the invention specifically comprises the following steps: introducing a DGM1 protein coding gene into a receptor plant to obtain a transgenic plant; the transgenic plant has a stronger root hair generating ability than the recipient plant. Wherein, the DGM1 protein is a protein shown in any one of the preceding paragraphs (A1) - (A9).

Fifth, the present invention provides a method of growing plants with longer root hair growth and/or greater density.

The method for cultivating the plant with longer root hair growth degree and/or higher density provided by the invention specifically comprises the step of improving the expression quantity and/or activity of DGM1 protein in a receptor plant. Wherein, the DGM1 protein is a protein shown in any one of the preceding paragraphs (A1) - (A9).

Sixth, the present invention provides a method for growing transgenic plants with greater root hair growth and/or density.

The method for cultivating the transgenic plant with longer root hair growth degree and/or higher density provided by the invention specifically comprises the following steps: introducing a DGM1 protein coding gene into a receptor plant to obtain a transgenic plant; the transgenic plant has a greater root hair growth and/or density than the recipient plant. Wherein, the DGM1 protein is a protein shown in any one of the preceding paragraphs (A1) - (A9).

In the above application or method, the gene encoding DGM1 protein may be specifically any one of the following DNA molecules:

(B1) a DNA molecule shown in the 156 nd-1778 th site of the sequence 1 in the sequence table;

(B2) DNA molecule shown in sequence 1 in the sequence table;

(B3) a DNA molecule that hybridizes under stringent conditions to the DNA molecule defined in (B1) or (B2) and encodes the DGM1 protein;

(B4) a DNA molecule which has more than 99%, more than 95%, more than 90%, more than 85% or more than 80% homology with the DNA sequence defined in any one of (B1) - (B3) and encodes the DGM1 protein.

The stringent conditions may be hybridization with a solution of 6 XSSC, 0.5% SDS at 65 ℃ followed by washing the membrane once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

Wherein the sequence 1 is an Arabidopsis thaliana AtDGM1 gene, and the 156-th and 1778-th sites are ORFs. The sequence 1 encodes a protein shown as a sequence 2 in a sequence table.

In the method, the gene encoding the DGM1 protein may be introduced into the recipient plant via a recombinant expression vector containing the gene encoding the DGM1 protein.

The recombinant expression vector can be constructed by using the existing plant expression vector. The plant expression vector comprises a binary agrobacterium vector, a vector which can be used for plant microprojectile bombardment and the like, such as pCAMBIA-1300-221, pGreen0029, pCAMBIA3301, pCAMBIA1300, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UBIN or other derivative plant expression vectors. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The poly A signal can direct the addition of poly A to the 3' end of the mRNA precursor. When the gene is used for constructing a recombinant expression vector, any one of enhanced, constitutive, tissue-specific or inducible promoters, such as a cauliflower mosaic virus (CAMV)35S promoter, a Ubiquitin gene Ubiquitin promoter (pUbi), a stress-inducible promoter rd29A and the like, can be added before the transcription initiation nucleotide, and can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a recombinant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codon or initiation codon of adjacent regions, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the recombinant expression vectors used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change, antibiotic markers having resistance or chemical resistance marker genes, etc., which are expressed in plants. Or directly screening the transformed plants in a stress environment without adding any selective marker gene.

In the invention, the promoter for starting the transcription of the gene coding for the DGM1 protein in the recombinant vector is a CaMV35S promoter.

More specifically, the recombinant expression vector is a recombinant plasmid obtained by inserting the encoding gene of the DGM1 protein into the multiple cloning site (BamH I and Sac I) of the pZH01 vector.

In the above method, the recombinant expression vector carrying the DGM1 gene is introduced into the recipient plant, which may specifically be: plant cells or tissues are transformed by conventional biological methods using Ti plasmids, Ri plasmids, plant viral vectors, direct DNA transformation, microinjection, conductance, agrobacterium mediation, etc., and the transformed plant tissues are grown into plants.

In the above-mentioned use or method, the plant may be a dicotyledonous plant or a monocotyledonous plant.

Further, the dicotyledonous plant can be a crucifer, or a leguminous plant, or a solanaceous plant; the monocot may be a gramineae.

More specifically, the cruciferous plants are arabidopsis thaliana or brassica napus; the leguminous plant is soybean; the plant of the Solanaceae family is tomato; the gramineous plant is rice.

The invention remarkably improves the length and the density of the root hair of the plant by over-expressing the nuclease-like gene AtDGM1 in the plant without changing other growth and development traits of the plant. In addition, the AtDGM1 gene is directly originated from plants, so that the AtDGM1 gene has less risk in biosafety. Finally, the AtDGM1 gene has homologous genes in other important crops such as rice, soybean, rape and tomato, so that the AtDGM1 gene has more choices in the construction of transgenic plants. The invention provides gene resources for cultivating new crop varieties capable of efficiently absorbing soil nutrients by using genetic engineering means, and can be used for cultivating new crop varieties capable of efficiently absorbing soil nutrients.

Drawings

FIG. 1 shows that RNA of leaves and roots of four homozygous lines of AtDGM1 plants is extracted to detect the expression of DGM1 gene. A is a blade; b is root. The figure shows the statistics of 3 biological replicates, with error bars representing SD, and the gene expression value of WT under normal growth conditions is designated as 1, indicating a significant difference compared to WT under the same conditions (P <0.05, t-test).

FIG. 2 shows the growth phenotype of AtDGM1 overexpression transgenic plants under normal conditions. A is the photograph of seeds of Wild Type (WT) and transgenic plants when they were germinated directly on the corresponding medium for 7 days (7-day-old Arabidopsis seedling morphology). B is the enlarged observation of the plant root tips in A under a dissecting mirror (root hair morphology of the main root tip of 7-day-old Arabidopsis seedlings). 4-5, 9-2, 11-4 and 18-12 represent 4T 3 generations of 35S, and the AtDGM1 transgenic Arabidopsis line.

FIG. 3 shows the root hair length and root hair density statistics of wild type Arabidopsis thaliana and 35S AtDGM1 plants. A is a statistical chart of the root hair length of wild type Arabidopsis thaliana and 35S, namely AtDGM1 plants; b is a statistical chart of root hair density of Col-0 ecotype Arabidopsis (wild type Arabidopsis) and 35S:: AtDGM 1. The area 3mm above the plant root tip shown as B in FIG. 2 was selected for statistical root hair analysis. 20 to 30 roots were taken per sample. The figure shows the statistics of 3 biological replicates with error bars representing SD, indicating significant differences compared to WT under the same conditions (P <0.05, t-test).

FIG. 4 is an alignment of the amino acid sequences of DGM1 in different species. The gene species are marked on the left side of the figure, and the numbers immediately following represent the amino acid numbering. The alignment was performed using the CLUSTAL W2 program and then stained with Boxshade. The same or similar amino acids are shown with black and gray backgrounds.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the quantitative tests in the following examples, three replicates were set up and the results averaged.

Agrobacterium strain GV 3101: products of Clontech.

Columbia-0 ecotype Arabidopsis thaliana (Col-0): arabidopsis Biological Resource Center (ABRC) product.

pZH01 vector pCAMBIA1301 vector was obtained by replacing the GUS (β -glucuronidase) gene (SEQ ID NO: 7) with the LUC (luciferase) gene (SEQ ID NO: 8) and leaving the remaining sequences of pCAMBIA1301 unchanged, wherein pCAMBIA1301 is a product from Biovector, catalog No. Biovector Cambia1301, and pZH01 carries the hygromycin resistance gene.

Example 1 acquisition of AtDGM1 Gene and functional verification thereof

In order to identify important genes involved in regulating plant root hair development, the inventors of the present invention conducted screening of arabidopsis mutants with abnormal root hair. Through screening of an arabidopsis seed mutant library, a mutant hps5 with increased root hair formation under normal conditions is obtained. The gene clone showsHPS5 encodes the ethylene receptor ERS 1. Through the comparative analysis of transcriptome of hps5, ethylene-insensitive mutant EIN3 and the like, the inventors identified a series of target genes which are positioned at the downstream of ethylene and participate in the root hair development process, and proved that EIN3 can be directly combined on the promoters of the root hair-related genes, so that the expression level of the target genes is improved, and the formation of root hair is increased. These genes are mostly proteins that encode cell wall proteins, cell wall modifying enzymes, proton pumps, jasmonic signals and synthesis related proteins, and some proteins of unknown function. However, the molecular mechanisms by which these target genes regulate root hair development are not clear. Therefore, the further intensive research on the relevant phenotype and function of the genes helps to identify new molecular components involved in the development of plant root hairs. Thus, the inventor constructs over-expression plants of genes with different functions, and finds that the generation capacity of root hair can be obviously improved after over-expression of one gene (gene number: At4g 29780). The inventors named this gene AtDGM1(DUOGENMAO 1). The specific implementation method is as follows:

first, 35S, construction of AtDGM1 transgenic plant

In order to obtain plants with the DGM1 gene overexpressed, the inventors constructed an expression vector (35S:: AtDGM1) of the wild-type AtDGM1 gene driven by the CaMV35S (Caulifloremogenic virus 35S) promoter for plant transformation. Total DNA is extracted from Col-0 wild type Arabidopsis thaliana, an AtDGM1 gene sequence is cloned by using the total DNA as a template and primers DGM1-35S-F and DGM1-35S-R, and the cloned sequence is connected to a BamH I/Sac I enzyme cutting site behind a pZH01 vector CaMV35S promoter. The constructed vector was tested with the endonucleases BamHI and SacI, and the 1.9KB of the target fragment could be excised, indicating that the constructed vector was correct. pZH01 the vector itself carries a hygromycin resistance gene.

DGM1-35S-F：

5’-CGGGGGACTCTAGAGGATCCCATAAAACTCAAAAATCTTTGGTC-3' (containing a BamHI cleavage site);

DGM1-35S-R：

5’-GATCGGGGAAATTCGAGCTCACTTAAGAGGTTTCAGATTCAATTTG-3' (containing SacI cleavage site)

1. Preparation and validation of recombinant expression vectors

(1) The PCR conditions were:

the reaction system is 50 mu L

(2) Plasmid linearization treatment

And (3) carrying out enzyme digestion for 1h at 37 ℃, detecting whether the enzyme digestion is complete or not by electrophoresis, and cutting the gel to recover linear plasmids and PCR products.

(3) And (3) recovering: recovery kit of Tiangen company (cargo number DP209-03)

(4) Connection of

(5) Transformation and characterization

The ligation products were transformed into DH5 α large intestine competent cells, the ligation products were added to 100. mu.L competent cells, incubated on ice for 30min, water bath at 42 ℃ for 90s, incubated on ice for 2min, 700. mu.L LB liquid medium was added, incubated at 37 ℃ and 200rpm for 1h, 4000rpm, centrifuged to remove the supernatant, 100. mu.L of LB resuspended cells were retained, spread on a plate of resistant LB (containing 50. mu.g/ml kanamycin), inverted cultured at 37 ℃ for 16h, and single colonies were picked.

Transformants were identified according to conventional molecular cloning methods. Colony PCR is firstly carried out to identify colonies containing the target fragment, then plasmids of the colonies are extracted, and the detection is carried out by using endonucleases BamH I and Sac I, so that the target fragment of about 1.9kb can be cut out, and the constructed vector is correct. And finally sequencing the plasmid with the correct enzyme digestion, wherein the completely correct plasmid is a 35S:: AtDGM1 fusion expression vector.

35S the structure of the AtDGM1 fusion expression vector is described as follows: replacing a small fragment between enzyme cutting sites BamH I and Sac I of the pZH01 vector with a recombinant plasmid of a DNA fragment shown in a sequence 1 in a sequence table. The sequence 1 is the genome sequence of the AtDGM1 gene, wherein the 156-th and 1778-th sites are ORFs. The sequence 1 encodes a protein shown as a sequence 2 in a sequence table.

2. Obtaining transgenic plants

(1) The recombinant plasmid 35S, AtDGM1, is introduced into Agrobacterium strain GV3101 to obtain recombinant Agrobacterium. The method comprises adding 5 μ L of plasmid with correct sequencing into 100 μ L of Agrobacterium infected cells, freezing on ice for 5min, freezing in liquid nitrogen for 20s, and keeping temperature in 37 deg.C water bath for 5 min. 700. mu.L of LB liquid medium was added thereto, and the mixture was cultured at 28 ℃ and 200rpm for 4 hours. The supernatant was centrifuged at 4000rpm, 100. mu.L of LB-resuspended cells were retained, spread on a resistant LB plate (containing 50. mu.g/ml kanamycin), and subjected to inverted culture at 28 ℃ for 48 hours to pick up individual colonies.

(2) The recombinant plasmid was introduced into Col-0 Arabidopsis thaliana by the flower soaking method (see Clough SJ and Bent AF,1998) to obtain seeds.

The method comprises the following steps: selecting a single clone to be cultured in 2-3ml of liquid LB culture medium for 16 hours at 28 ℃ and 250 rpm; adding 0.2ml of bacterial liquid into 100ml of liquid LB culture medium, and culturing at 28 ℃ and 250rpm for 18-24 hours; pouring the bacterial liquid into a 250ml centrifugal tube, and balancing; centrifuging at room temperature and 5500rpm for 10 min; the supernatant was discarded, and the cells were resuspended in floral dip solution (formulation: 1/2MS salt + microorganism B5(Sigma salts 0404)2.2g/L, sucrose 50g/L, MES 0.5g/L, 0.44mM 6BA 10. mu.l/L, Silwet L-77200. mu.l/L, pH 5.7 with NaOH), and OD was adjusted to OD₆₀₀nm is 0.8. Inverting the wild Col-0 in flowering state to completely immerse the flower in the thallus suspension, and maintaining for 2 min; taking out Col-0, placing in a humid tray, standing in the dark for 24 hr, standing Col-0, and culturing in the same way as common plant.

3. Screening and validation of transgenic plants

Seeds were harvested from Agrobacterium-soaked plants (referred to as 35S:: AtDGM1 transgenic Arabidopsis T1 generation seeds). After the seeds are sterilized, the seeds are spread on an MS (containing 30 mu g/ml hygromycin) plate with the agar concentration of 0.55g/100ml and vernalized for 2 days at the temperature of 4 ℃; the plates were placed in a greenhouse and grown flat for 12 days, after which resistant plants were selected and moved into the soil. Seeds of resistant plants were harvested from individual plants (i.e., 35S:: AtDGM1 transgenic Arabidopsis T2 generation seeds). And (4) paving the harvested seeds on a screening culture medium containing hygromycin again, and selecting a hygromycin-resistant plant. 10 resistant seedlings are selected from each transgenic line, transferred into soil, and seeds are harvested from the single plants after the seedlings are mature. And (3) spreading the harvested seeds of each plant on a screening culture medium again, and checking the separation condition of the hygromycin resistance character. If there is no segregation, it indicates the plant is the transgene homozygous line, can be used in the phenotype analysis. A total of 4 homozygous lines were obtained, 4-5, 9-2, 11-4, 18-12, respectively.

Then, Real-time PCR was performed on these plants to further confirm whether the expression of AtDGM1 was significantly increased in these plants. Total RNA from wild type and transgenic plants was extracted using the RNAeasy Plant Mini Kit from Qiagen (cat # 74903), 1. mu.g of total RNA was digested with DNase at 37 ℃ for 30min and then reverse-transcribed into cDNA using the RT Kit of TOYOBO in a 20. mu.l system according to the instructions; the cDNA was amplified using the SYBR Premix Ex Taq kit from TaKaRa, and the amount of cDNA amplified was detected in real time using the Bio-Rad CFX96real-time PCR detection system. The primer sequences for amplifying the AtDGM1 gene are 5'-TCGAATCGGTCCACAAAATACC-3' and 5'-GTGGACTTTCGGAGCGATGA-3', and the primer sequences for amplifying the Actin cDNA are 5'-GACCTTGCTGGACGTGACCTTAC-3' and 5'-GTAGTCAACAGCAACAAAGGAGAGC-3'.

The results are shown in FIG. 1, the expression level of AtDGM1 in the leaves and roots of the four lines is significantly higher than that of the Wild Type (WT) plant, which shows that the DGM1 gene in the body of the transgenic plant 35S: AtDGM1 is actually significantly over-expressed.

Second, 35S, phenotype analysis of AtDGM1 transgenic plant

1. 35S growth observation of AtDGM1 seedlings

Sterilized wild Arabidopsis thaliana (WT) and 35S were prepared by plating seeds 4-5, 9-2, 11-4, 18-12 of AtDGM1 plants on 9cm MS solid medium (formulation: MS salt 4.46g/l (product of Phytotechnology Laboratories, Cat. No. M519), MES 1g/l, sucrose 10g/l, pH 5.8, agar concentration 1.2g/100ml), plating 3 seeds per Arabidopsis thaliana, vernalizing at4 ℃ for 3 days, culturing in a greenhouse at 23 ℃ under conditions of light intensity of 100. mu. mol/100. mu. mol^-2·s^-116 hours light 8 hours dark, after 8 days of plant growth WT and 35S were obtainedNamely, AtDGM1 seedlings and observing the root hair property.

The root hair trait of the AtDGM1 plants is shown in FIG. 2. The results show that under normal conditions, the major root length of these transgenic plants is identical to that of the wild type (A in FIG. 2). Compared with the wild type, 35S shows that the root hair length of AtDGM1 transgenic Arabidopsis is obviously longer, and the root hair density is obviously increased (B in figure 2).

2. Root hair length and Density measurement

First, the wild type Arabidopsis thaliana and 35S obtained by the second cultivation were grown by observing the root hairs of the seedlings of AtDGM1 under a phase contrast microscope (Olympus, BAX51, Japan) and photographing them with a digital camera attached correspondingly. And then opening the shot picture by using software Digimizer, setting internal references according to the actual scale of a ruler, selecting a fixed area and length of each root, measuring the number of the root hairs and the length of each root hair in the area to obtain the root hair density and the average root hair length of each root, selecting 20 to 30 root hairs and 20 to 30 root hairs in each arabidopsis thaliana, repeating the test for 3 times, and averaging the results.

Wild type Arabidopsis thaliana and 35S. the results of measuring the root hair length and density of AtDGM1 plants are shown in FIG. 3. The results of A in FIG. 3 show that the average root hair length of Col-0 ecotype Arabidopsis (wild type Arabidopsis) is 0.32. + -. 0.02mm, and 35S that the average root hair length of AtDGM1 plants is 0.49. + -. 0.02mm, 0.62. + -. 0.03mm, 0.63. + -. 0.02mm, 0.64. + -. 0.03 mm. The results B in FIG. 3 show that the Col-0 ecotype Arabidopsis (wild type Arabidopsis) has a root hair density (number of root hairs per mm of root) of 19.5. + -. 0.9, and 35 S.the AtDGM1 plants have a root hair density (number of root hairs per mm of root) of 27.1. + -. 1.0, 36.2. + -. 1.6, 32.5. + -. 1.7, 34.8. + -. 1.2. The result shows that compared with wild Arabidopsis, the length of the root hair of the AtDGM1 plant is obviously increased, and the density of the root hair is obviously improved.

DGM1 homologous protein in main crops

In order to understand whether the homologous protein of DGM1 exists in some main crops, the inventor of the present invention searched a plant genomic database and found that the homologous protein highly similar to DGM1 exists in rice, soybean, rape and tomato (the sequence of DGM1 protein in rice is shown as sequence 3 in the sequence table, the sequence of DGM1 protein in soybean is shown as sequence 4 in the sequence table, the sequence of DGM1 protein in rape is shown as sequence 5 in the sequence table, and the sequence of DGM1 protein in tomato is shown as sequence 6 in the sequence table), as shown in FIG. 4. The protein sequence comparison result shows that the DGM1 protein in the crops of rice, soybean, rape and tomato has higher homology with the DGM1 protein in Arabidopsis, and the DGM1 gene in the crops is likely to be used for constructing the crops with improved root hair generation capability, thereby cultivating new varieties of crops with high nutrient absorption efficiency.

In summary, the present inventors considered that the ability of a plant to produce root hairs could be significantly improved by overexpressing the AtDGM1, which is a nucleotidase gene, in the plant.

<110> Qinghua university

Application of <120> DGM1 protein in improving root hair generation capability of plants

<130>CGGNQALN176112

<160>8

<170>PatentIn version 3.5

<210>1

<211>1997

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>1

cataaaactc aaaaatcttt ggtcttcaaa cttcaaacac ttgagaaaaa agcttttgat 60

ttcacatctt aatctaacaa gtcaaacact tttcaaacca caaaattcgt caaagctctg 120

aaacaaataa acatttttta atttctccct ttttaatgga aatctcttct ttcccatttc 180

catacctaca agacgacgag tgttcccatt tccttggtct atttcaagac atggactctt 240

ctccttctac tttcggatta gaaggtttta atagcaacga caataatact aatcaaaaga 300

aacgcccaag aaaagacgac gaaggcggtg gtggtggcgg cggaggaaca gaagttctag 360

gagctgttaa tggtaataat aaggctgctt ttggagatat actcgcgacg cttctgttgt 420

tagacgagga agctaaacag caacaagaac agtgggattt tgaatttatt aaagagaagt 480

ctttacttga agctaatcat aagaagaaag tgaaaacaat ggatggttat tacaatcaaa 540

tgcaagatca ttactctgca gctggtgaaa ccgatggttc gcgttcaaaa cgcgcacgga 600

aaaccgcggt tgcggctgtg gtttccgcgg tagcttccgg ggcggacaca accggtttag 660

ctgctccggt tccgaccgcg gatatcgcta gcggttccgg gtcaggaccg agtcatagga 720

ggttatgggt taaagaacga accacggact ggtgggacag agtaagccgg cctgattttc 780

cagaagacga gtttcggcga gagttccgta tgagcaaatc gacgtttaac ctaatatgcg 840

aggagctaga tacgacggtg acgaagaaaa acacgatgtt aagagacgcg attccagctc 900

caaaacgcgt aggcgtttgc gtttggcgtt tggcgacagg agctccgctt cgccacgtgt 960

cggagcgttt cggtctggga atctcaactt gccacaaact agtcatcgaa gtctgccgcg 1020

cgatctacga cgttctcatg cccaagtatc tcctctggcc gtcggattca gagataaact 1080

caacgaaagc caaattcgaa tcggtccaca aaataccaaa cgtcgtcgga tcaatctaca 1140

ccacacatat tccgatcatc gctccgaaag tccacgtggc ggcgtatttt aacaagagac 1200

acacggagag gaatcagaag acgtcgtact cgataacagt acaaggagtg gtcaacgccg 1260

acgggatctt caccgacgtt tgtatcggaa acccaggatc tctcaccgac gatcagatcc 1320

tggagaaatc ttcgctttca cggcaaagag cggcgcgtgg gatgttacgt gacagctgga 1380

tagttggaaa ctctgggttt ccgttgactg attatcttct tgtaccgtac acgagacaga 1440

atctgacgtg gacgcagcac gcgtttaacg agagtatcgg agagattcag gggattgcga 1500

cggctgcgtt tgagaggctc aaaggacggt gggcttgttt gcagaaacgg acggaggtga 1560

agcttcagga tctgccgtac gtgcttggag cttgttgtgt gttgcataac atttgtgaga 1620

tgaggaagga ggagatgttg ccggagttga agtttgaggt ttttgatgat gtggcggtgc 1680

cggagaataa tatccgatct gctagtgcgg ttaatacgag ggatcatatc tctcacaatc 1740

tcttgcatcg tggacttgcc gggacaagaa ctctataggc tctgtttttc accttttctt 1800

attttgaaac tgatttttta ttgcaaattc tttttccaaa ttaggaataa aaacatttta 1860

gggattggtt ggatacagaa agaatagttg aattgagagt agaagtggct gatgatattg 1920

tttgtgttac ttattagcat tgtgtaatct ttagttcatg tattttctat acaaattgaa 1980

tctgaaacct cttaagt 1997

<210>2

<211>540

<212>PRT

<213> Artificial sequence

<220>

<223>

<400>2

Met Glu Ile Ser Ser Phe Pro Phe Pro Tyr Leu Gln Asp Asp Glu Cys

1 5 10 15

Ser His Phe Leu Gly Leu Phe Gln Asp Met Asp Ser Ser Pro Ser Thr

20 25 30

Phe Gly Leu GluGly Phe Asn Ser Asn Asp Asn Asn Thr Asn Gln Lys

35 40 45

Lys Arg Pro Arg Lys Asp Asp Glu Gly Gly Gly Gly Gly Gly Gly Gly

50 55 60

Thr Glu Val Leu Gly Ala Val Asn Gly Asn Asn Lys Ala Ala Phe Gly

65 70 75 80

Asp Ile Leu Ala Thr Leu Leu Leu Leu Asp Glu Glu Ala Lys Gln Gln

85 90 95

Gln Glu Gln Trp Asp Phe Glu Phe Ile Lys Glu Lys Ser Leu Leu Glu

100 105 110

Ala Asn His Lys Lys Lys Val Lys Thr Met Asp Gly Tyr Tyr Asn Gln

115 120 125

Met Gln Asp His Tyr Ser Ala Ala Gly Glu Thr Asp Gly Ser Arg Ser

130 135 140

Lys Arg Ala Arg Lys Thr Ala Val Ala Ala Val Val Ser Ala Val Ala

145 150 155 160

Ser Gly Ala Asp Thr Thr Gly Leu Ala Ala Pro Val Pro Thr Ala Asp

165 170 175

Ile Ala Ser Gly Ser Gly Ser Gly Pro Ser His Arg Arg Leu Trp Val

180 185 190

Lys Glu Arg Thr Thr Asp TrpTrp Asp Arg Val Ser Arg Pro Asp Phe

195 200 205

Pro Glu Asp Glu Phe Arg Arg Glu Phe Arg Met Ser Lys Ser Thr Phe

210 215 220

Asn Leu Ile Cys Glu Glu Leu Asp Thr Thr Val Thr Lys Lys Asn Thr

225 230 235 240

Met Leu Arg Asp Ala Ile Pro Ala Pro Lys Arg Val Gly Val Cys Val

245 250 255

Trp Arg Leu Ala Thr Gly Ala Pro Leu Arg His Val Ser Glu Arg Phe

260 265 270

Gly Leu Gly Ile Ser Thr Cys His Lys Leu Val Ile Glu Val Cys Arg

275 280 285

Ala Ile Tyr Asp Val Leu Met Pro Lys Tyr Leu Leu Trp Pro Ser Asp

290 295 300

Ser Glu Ile Asn Ser Thr Lys Ala Lys Phe Glu Ser Val His Lys Ile

305 310 315 320

Pro Asn Val Val Gly Ser Ile Tyr Thr Thr His Ile Pro Ile Ile Ala

325 330 335

Pro Lys Val His Val Ala Ala Tyr Phe Asn Lys Arg His Thr Glu Arg

340 345 350

Asn Gln Lys Thr Ser Tyr Ser Ile ThrVal Gln Gly Val Val Asn Ala

355 360 365

Asp Gly Ile Phe Thr Asp Val Cys Ile Gly Asn Pro Gly Ser Leu Thr

370 375 380

Asp Asp Gln Ile Leu Glu Lys Ser Ser Leu Ser Arg Gln Arg Ala Ala

385 390 395 400

Arg Gly Met Leu Arg Asp Ser Trp Ile Val Gly Asn Ser Gly Phe Pro

405 410 415

Leu Thr Asp Tyr Leu Leu Val Pro Tyr Thr Arg Gln Asn Leu Thr Trp

420 425 430

Thr Gln His Ala Phe Asn Glu Ser Ile Gly Glu Ile Gln Gly Ile Ala

435 440 445

Thr Ala Ala Phe Glu Arg Leu Lys Gly Arg Trp Ala Cys Leu Gln Lys

450 455 460

Arg Thr Glu Val Lys Leu Gln Asp Leu Pro Tyr Val Leu Gly Ala Cys

465 470 475 480

Cys Val Leu His Asn Ile Cys Glu Met Arg Lys Glu Glu Met Leu Pro

485 490 495

Glu Leu Lys Phe Glu Val Phe Asp Asp Val Ala Val Pro Glu Asn Asn

500 505 510

Ile Arg Ser Ala Ser Ala Val Asn Thr Arg AspHis Ile Ser His Asn

515 520 525

Leu Leu His Arg Gly Leu Ala Gly Thr Arg Thr Leu

530 535 540

<210>3

<211>551

<212>PRT

<213> Artificial sequence

<220>

<223>

<400>3

Met Arg Ser Thr Ser Gly Ala Arg Pro Ser Ser Gly Gly Gly Gly Gly

1 5 10 15

Asp Asp Asp Tyr Ala Phe Tyr Tyr Ser Phe Phe Gln Asp Ala Ala Ala

20 25 30

Ala Ala Ala Ser Pro Leu Gly Leu Asp Asp Ala Ala Ala Met Thr Asn

35 40 45

Gly Gly Arg Lys Arg Lys Arg Gly Gly Gly Gly Asp Gly Ala Asp Gly

50 55 60

Gly Ala Pro Ala Ala Ser Arg Lys Asp Gly Pro Gly Gly Asp Gly Glu

65 70 75 80

Gly Gly Asn Gly Arg Lys Arg Ser Ile Ala Lys Ile Leu Thr Ser Leu

85 90 95

Ala Ala Leu Glu Ala Glu Glu His Ser Asp Arg Ala Gly Ala Ala Asp

100 105 110

Ala Ser Arg Arg Glu Leu Ala Leu Leu Glu Ser Asn Ala Asp His Lys

115 120 125

Ser Gln Ala Met Met Asp Tyr Tyr Ala Lys Met Glu Gly Ser Phe Asp

130 135 140

Ala Ala Ala Glu Ser Asp Ala Thr Ala Arg Ser Lys Arg Ser Arg Leu

145 150 155 160

Ala Ala Ser Ala Thr Thr Ala Ala Val Val Ala Thr Glu Glu Gly Ala

165 170 175

Ala Glu Thr Ala Ser Ala Ser Ala Ser Pro Ser Arg Ala Ser Gly Gly

180 185 190

Gly Gly Ala Gly His His Gln Arg Arg Leu Trp Val Lys Asp Arg Ser

195 200 205

Arg Ala Trp Trp Asp Lys Cys Asn Ser Pro Asp Tyr Pro Glu Glu Glu

210 215 220

Phe Arg Arg Ala Phe Arg Met Gly Arg Glu Thr Phe Asp Met Ile Cys

225 230 235 240

Glu Ala Leu Gly Ser Ala Val Ala Lys Glu Asp Thr Met Leu Arg Ala

245 250 255

Ala Ile Pro Val Arg Gln Arg Val Ala Val Cys Ile Trp Arg Leu Ala

260 265 270

Thr Gly Glu Pro Leu Arg Leu Val Ser Lys Arg Phe Gly Leu Gly Ile

275 280 285

Ser Thr Cys His Lys Leu Val Leu Glu Val Cys Ala Ala Ile Lys Ser

290 295 300

Val Leu Met Pro Arg Phe Leu Gln Trp Pro Asp Glu Ala Ala Ala Ala

305 310 315 320

Ala Phe Lys Glu Arg Phe Gln Ala Ala Tyr Gly Val Pro Gly Val Ile

325 330 335

Gly Ala Met Tyr Thr Thr His Ile Pro Ile Ile Ala Pro Lys Ile Ser

340 345 350

Val Ala Ala Tyr Phe Asn Arg Arg His Thr Glu Arg Asn Gln Lys Thr

355 360 365

Ser Tyr Ser Ile Thr Leu Gln Gly Val Val Gly Pro Asp Gly Ala Phe

370 375 380

Thr Asp Val Cys Ile Gly Trp Pro Gly Ser Met Pro Asp Asp Gln Val

385 390 395 400

Leu Glu Lys Ser Met Leu His Gln Arg Ala Ala Ala Gly Met Met His

405 410 415

Ser Ala Cys Leu Val Gly Gly Ala Ser Tyr Pro Leu Met Asp Trp Val

420 425 430

Leu Val Pro Tyr Thr His Gln Asn Leu Thr Trp Thr Gln His Ala Phe

435 440 445

Asn Glu Lys Val Gly Asp Leu Arg Arg Val Ala Val Asp Ala Phe Ala

450 455 460

Arg Leu Lys Ala Arg Trp Ala Cys Leu Gln Lys Arg Thr Glu Val Lys

465 470 475 480

Leu Gln Asp Leu Pro Val Val Leu Gly Ala Cys Cys Val Leu His Asn

485 490 495

Ile Cys Glu Thr Arg Gly Glu Glu Leu Glu Pro Glu Leu Arg Phe Glu

500 505 510

Leu Val Asp Asp Glu Thr Ser Pro Glu Thr Pro Val Arg Ser Glu Ala

515 520 525

Ala Lys Arg Ala Arg Asp Asn Ile Ala His Asn Leu Leu His Arg Gly

530 535 540

Phe Ala Gly Thr Thr Phe Phe

545 550

<210>4

<211>527

<212>PRT

<213> Artificial sequence

<220>

<223>

<400>4

Met Glu Ile Ser Gln Ile Pro Phe Phe Thr Gln Glu Asp Tyr Ser His

1 5 10 15

Phe Tyr Asn Leu Tyr Glu Asp Thr Asp Ser Asn Asn Ser Leu Asn Asn

20 25 30

Asn Asn Ser Asn Asn Lys Arg Lys Arg Asn Asn Arg Lys Glu Glu Gly

35 40 45

Ser Gly Gly Gly Ala Glu Gln Lys Gly His Asn Gly Asn Asn Asn Asn

50 55 60

Glu Asn Ser Glu Ser Asn Leu Lys Asp Leu Leu Ala Ser Leu Ile Met

65 70 75 80

Leu Asp Glu Glu Glu Ile Gln Glu Glu Arg Asn Arg Lys Val Glu Tyr

85 90 95

Glu Gln His Arg Asn Met Tyr Asn Ala Asn Phe Glu Asn Gln Thr Arg

100 105 110

Ala Met Asn Thr Tyr Lys Ala Gln Phe Glu Ala His Tyr Ala Gln Ser

115 120 125

Glu Glu Phe Glu Gln Thr Ile Thr Lys Lys Ala Arg Arg Ala Val Ala

130 135 140

Ala Ala Thr Gly Thr Gly Ser Val Met Leu Tyr Glu Ser Gly Ser Val

145 150 155 160

GlnVal Gln Pro Arg Thr Asp Ser Glu Pro Gly Ser Thr Val Gln Arg

165 170 175

Arg Leu Trp Val Lys Asp Arg Ser Lys Asp Trp Trp Glu Lys Ile Ser

180 185 190

Arg Lys Asp Phe Pro Glu Glu Glu Phe Arg Arg Trp Phe Arg Met Ser

195 200 205

Arg Ser Thr Phe Asp Met Ile Cys Asp Glu Leu Asp Ala Ala Val Thr

210 215 220

Lys Lys Asn Thr Met Leu Arg Asp Ala Ile Pro Val Arg Gln Arg Val

225 230 235 240

Ala Val Cys Ile Trp Arg Leu Ala Thr Gly Asp Pro Leu Arg Leu Val

245 250 255

Ser Lys Arg Phe Gly Leu Gly Ile Ser Thr Cys His Lys Leu Val Leu

260 265 270

Glu Val Cys Ser Ala Ile Arg Thr Val Leu Met Pro Lys Phe Leu Gln

275 280 285

Trp Pro Asn Glu Glu Lys Thr Lys Gln Ile Lys Asp Glu Phe Glu Lys

290 295 300

Ile Ser Gly Ile Pro Asn Val Gly Gly Ala Met Tyr Thr Thr His Val

305 310 315 320

Pro Ile IleAla Pro Lys Ile Ser Val Ser Ala Tyr Phe Asn Lys Arg

325 330 335

His Thr Glu Arg Asn Gln Lys Thr Ser Tyr Ser Ile Thr Val Gln Gly

340 345 350

Val Val Asp Ser Lys Gly Val Phe Asn Asp Val Cys Ile Gly Trp Pro

355 360 365

Gly Ser Met Pro Asp Asp Arg Val Leu Glu Lys Ser Ala Leu Phe Gln

370 375 380

Arg Ala Ser Arg Gly Asn Leu Lys Gly Val Trp Ile Val Gly Asn Ser

385 390 395 400

Gly His Pro Leu Met Asp Trp Val Leu Val Pro Tyr Thr His Ala Asn

405 410 415

Leu Thr Trp Thr Gln His Ala Phe Asn Glu Lys Ile Glu Glu Ile Gln

420 425 430

Gly Val Ala Lys Glu Ala Phe Ala Arg Leu Lys Gly Arg Trp Gly Cys

435 440 445

Leu Gln Lys Arg Thr Glu Val Lys Leu Gln Asp Leu Pro Val Val Leu

450 455 460

Gly Ala Cys Cys Val Leu His Asn Ile Cys Glu Met Arg Asn Glu Glu

465 470 475 480

Met Asp Asp Glu TrpArg Phe Gln Ile Phe Asp Asp Glu Met Leu Pro

485 490 495

Glu Asn Gly Ile Arg Ser Ser Ala Ser Leu Gln Ala Arg Asp His Ile

500 505 510

Ala His Tyr Leu Leu His His Gly Arg Ala Gly Thr Gly Phe Phe

515 520 525

<210>6

<211>527

<212>PRT

<213> Artificial sequence

<220>

<223>

<400>6

Met Glu Ile Ser Ala Phe Pro Phe Pro Tyr Leu Gln Asp Asp Glu Cys

1 5 10 15

Ser His Phe Leu Gly Leu Phe Gln Asp Met Asp Ser Ser Ser Pro Ser

20 25 30

Asp Phe Gly Phe Glu Gly Phe Gly Asn Asp Asn Ser Lys Lys Arg Pro

35 40 45

Arg Lys Glu Asp Gln Glu Glu Gly Ala Gly Ala Val Asn Gly Ser Ser

50 55 60

Asn Lys Pro Ala Phe Gly Asp Ile Leu Ala Thr Leu Leu Leu Leu Asp

65 70 75 80

Glu Glu Ala Lys His Gln Gln Glu Gln Trp Asp Phe Glu Ser Asn Arg

85 90 95

Glu Lys Ser Leu Leu Glu Ala Asn His Arg Glu Lys Val Arg Ala Met

100 105 110

Asp Gly Tyr Tyr Asn Gln Leu Gln Gly His Tyr Asn Thr Ala Glu Glu

115 120 125

Thr Asp Val Thr Pro Pro Lys Arg Ala Arg Arg Ser Ala Val Ala Ala

130 135 140

Ala Val Val Ser Ala Val Ala Ser Gly Glu Glu Ala Thr Thr Ala Pro

145 150 155 160

Val Gln Ala Thr Asp Ile Ala Ser Gly Ser Gly Thr Ser His Arg Arg

165 170 175

Leu Trp Val Lys Glu Arg Thr Thr Asp Trp Trp Asp Arg Val Ser Ser

180 185 190

Pro Asp Phe Pro Glu Glu Glu Phe Arg Arg Glu Phe Arg Met Ser Lys

195 200 205

Ser Thr Phe Asn Leu Ile Cys Asp Glu Leu Asp Ala Thr Val Thr Lys

210 215 220

Lys Asn Thr Met Leu Arg Asp Ala Ile Pro Ala Pro Lys Arg Val Gly

225 230 235 240

Val Cys Val Trp Arg Leu Ala Thr Gly Ala Pro Leu Arg His Val Ser

245 250 255

Glu Arg Phe Gly Leu Gly Ile Ser Thr Cys His Lys Leu Val Ile Glu

260 265 270

Val Cys Arg Ala Ile Tyr Asp Val Leu Met Pro Lys Tyr Leu Arg Trp

275 280 285

Pro Ser Asp Ser Glu Ile Gln Ser Thr Lys Glu Lys Phe Glu Ser Val

290 295 300

His Lys Ile Pro Asp Val Val Gly Ser Ile Tyr Thr Thr His Ile Pro

305 310 315 320

Ile Ile Ala Pro Lys Val His Val Ala Ala Tyr Phe Asn Lys Arg His

325 330 335

Thr Glu Arg Asn Gln Lys Thr Ser Tyr Ser Ile Thr Val Gln Gly Val

340 345 350

Val Asn Ala Asp Gly Ile Phe Thr Asp Val Cys Ile Gly Asn Pro Gly

355 360 365

Ser Leu Thr Asp Asp Leu Ile Leu Glu Lys Ser Ser Leu Ala Arg Gln

370 375 380

Arg Ala Ala Arg Gly Met Leu Arg Asp Gly Trp Ile Val Gly Asn Ala

385 390 395 400

Gly Phe Pro Leu Thr Asp Trp Leu Leu Val Pro Tyr Ala Arg Gln Asn

405 410 415

Leu Thr Trp Thr Gln His Gly Phe Asn Glu Asn Ile Gly Gly Ile Gln

420 425 430

Lys Ile Ala Ile Glu Ala Phe Glu Arg Leu Lys Gly Arg Trp Ala Cys

435 440 445

Leu Gln Lys Arg Thr Glu Val Lys Leu Gln Asp Leu Pro Tyr Val Leu

450 455 460

Gly Ala Cys Cys Val Leu His Asn Ile Cys Glu Met Arg Asn Glu Glu

465 470 475 480

Met Ala Pro Glu Ile Lys Phe Asp Val Phe Asp Asp Val Thr Val Pro

485 490 495

Glu Asn Asn Ile Arg Ser Ala Thr Ala Ser Asn Lys Arg Asp Gln Ile

500 505 510

Ser His Asn Leu Leu His Arg Gly Leu Ala Gly Thr Arg Thr Leu

515 520 525

<210>6

<211>499

<212>PRT

<213> Artificial sequence

<220>

<223>

<400>6

Met Glu Ile Ser Ser Phe Leu Phe Pro Asn Gln Glu Asp Tyr Pro Ser

1 5 10 15

Pro Asn Phe Phe Ser Phe Phe Gln Asp Phe Asp Phe Pro Thr Thr Asp

20 25 30

Thr Leu Ala Pro Ile Val Ala Glu Pro Leu Pro Lys Lys Gln Arg Val

35 40 45

Asp Asp Phe Asp Phe Asp Leu Glu Gln Val Val Glu Gln Gln Gly Ser

50 55 60

Leu Lys Ser Val Glu Asp Ile Leu Asn Lys Phe Leu Gly Phe Asp Lys

65 70 75 80

Glu Glu Asp Lys Thr Asn Leu Lys Gln Phe Thr Asn Gln Asn Gln Ser

85 90 95

Val Phe Asp Phe Ser Asn Gln Gln Pro Thr Gly Leu Ile Met Ile Asn

100 105 110

Glu Lys Val Lys Pro Met Ala Ser Thr Asn Asn Lys Arg Ser Arg Gln

115 120 125

Gly Ser Ala Glu Phe Ile Ser Thr Ser Glu Glu Glu Ser Gln Pro Gln

130 135 140

Gln Gln Arg Arg Leu Trp Val Lys Asp Arg Ser Lys Ala Trp Trp Glu

145 150 155 160

Gln Cys Asn Ser Pro Asp Phe Pro Glu Glu Glu Phe Lys Lys Ala Phe

165 170 175

Arg Val Ser Arg Ala Thr Phe Asp Met Ile Cys Glu Glu Leu Glu Ser

180 185 190

Val Val Thr Lys Lys Asp Thr Met Leu Arg Gln Ala Ile Pro Val Arg

195 200 205

Gln Arg Val Ala Val Cys Ile Trp Arg Leu Ala Thr Gly Glu Pro Leu

210 215 220

Arg Glu Val Ser Lys Arg Phe Gly Leu Gly Ile Ser Thr Cys His Lys

225 230 235 240

Leu Val Leu Glu Val Cys Thr Ala Ile Lys Gly Val Leu Met Pro Lys

245 250 255

Phe Val Gln Trp Pro Asn Glu Asp Tyr Lys Met Asn Glu Ile Lys Ser

260 265 270

Glu Phe Gln Met Leu Ser Gly Met Pro Asn Val Gly Gly Ser Ile Tyr

275 280 285

Thr Thr His Val Pro Ile Ile Ala Pro Lys Val Ser Val Ala Ala Tyr

290 295 300

Phe Asn Lys Arg His Thr Glu Arg Asn Gln Lys Thr Ser Tyr Ser Val

305 310 315 320

Thr Val Gln Gly Val Val Asp Pro Lys Gly Val Phe Thr Asp Val Cys

325 330 335

Ile Gly Trp Pro Gly Ser Met Ser Asp Asp Lys Val Leu Glu Lys Ser

340 345 350

Ala Leu Tyr Gln Arg Ala Asn Arg Gly Gln Leu Lys Asp Thr Trp Val

355 360 365

Val Gly Asn Ser Gly Tyr Pro Leu Met Asp Trp Val Leu Ala Pro Tyr

370 375 380

Thr Arg Gln Asn Leu Thr Trp Thr Gln His Ala Phe Asn Glu Lys Val

385 390 395 400

Gly Glu Val Gln Lys Val Ala Lys Glu Ala Phe Met Arg Met Lys Ala

405 410 415

Arg Trp Ser Cys Leu Arg Lys Arg Thr Glu Val Lys Leu Gln Asp Leu

420 425 430

Pro Val Val Leu Gly Ala Cys Cys Val Leu His Asn Ile Cys Glu Met

435 440 445

Arg Gly Glu Gln Leu Asn Pro Gly Leu Arg Phe Asp Leu Phe Asp Asp

450 455 460

Glu Met Val Pro Glu Asn Ile Val Arg Ser Met Asn Ala Val Gln Ala

465 470 475 480

Arg Asp Gln Ile Ala His Gln Leu Leu His Gln Asn His Ala Gly Thr

485 490 495

Asn Phe Leu

<210>7

<211>1809

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>7

atgttacgtc ctgtagaaac cccaacccgt gaaatcaaaa aactcgacgg cctgtgggca 60

ttcagtctgg atcgcgaaaa ctgtggaatt gatcagcgtt ggtgggaaag cgcgttacaa 120

gaaagccggg caattgctgt gccaggcagt tttaacgatc agttcgccga tgcagatatt 180

cgtaattatg cgggcaacgt ctggtatcag cgcgaagtct ttataccgaa aggttgggca 240

ggccagcgta tcgtgctgcg tttcgatgcg gtcactcatt acggcaaagt gtgggtcaat 300

aatcaggaag tgatggagca tcagggcggc tatacgccat ttgaagccga tgtcacgccg 360

tatgttattg ccgggaaaag tgtacgtatc accgtttgtg tgaacaacga actgaactgg 420

cagactatcc cgccgggaat ggtgattacc gacgaaaacg gcaagaaaaa gcagtcttac 480

ttccatgatt tctttaacta tgccggaatc catcgcagcg taatgctcta caccacgccg 540

aacacctggg tggacgatat caccgtggtg acgcatgtcg cgcaagactg taaccacgcg 600

tctgttgact ggcaggtggt ggccaatggt gatgtcagcg ttgaactgcg tgatgcggat 660

caacaggtgg ttgcaactgg acaaggcact agcgggactt tgcaagtggt gaatccgcac 720

ctctggcaac cgggtgaagg ttatctctat gaactgtgcg tcacagccaa aagccagaca 780

gagtgtgata tctacccgct tcgcgtcggc atccggtcag tggcagtgaa gggccaacag 840

ttcctgatta accacaaacc gttctacttt actggctttg gtcgtcatga agatgcggac 900

ttacgtggca aaggattcga taacgtgctg atggtgcacg accacgcatt aatggactgg 960

attggggcca actcctaccg tacctcgcat tacccttacg ctgaagagat gctcgactgg 1020

gcagatgaac atggcatcgt ggtgattgat gaaactgctg ctgtcggctt taacctctct 1080

ttaggcattg gtttcgaagc gggcaacaag ccgaaagaac tgtacagcga agaggcagtc 1140

aacggggaaa ctcagcaagc gcacttacag gcgattaaag agctgatagc gcgtgacaaa 1200

aaccacccaa gcgtggtgat gtggagtatt gccaacgaac cggatacccg tccgcaagtg 1260

cacgggaata tttcgccact ggcggaagca acgcgtaaac tcgacccgac gcgtccgatc 1320

acctgcgtca atgtaatgtt ctgcgacgct cacaccgata ccatcagcga tctctttgat 1380

gtgctgtgcc tgaaccgtta ttacggatgg tatgtccaaa gcggcgattt ggaaacggca 1440

gagaaggtac tggaaaaaga acttctggcc tggcaggaga aactgcatca gccgattatc 1500

atcaccgaat acggcgtgga tacgttagcc gggctgcact caatgtacac cgacatgtgg 1560

agtgaagagt atcagtgtgc atggctggat atgtatcacc gcgtctttga tcgcgtcagc 1620

gccgtcgtcg gtgaacaggt atggaatttc gccgattttg cgacctcgca aggcatattg 1680

cgcgttggcg gtaacaagaa agggatcttc actcgcgacc gcaaaccgaa gtcggcggct 1740

tttctgctgc aaaaacgctg gactggcatg aacttcggtg aaaaaccgca gcagggaggc 1800

aaacaatga 1809

<210>8

<211>1653

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>8

atggaagacg ccaaaaacat aaagaaaggc ccggcgccat tctatccgct ggaagatgga 60

accgctggag agcaactgca taaggctatg aagagatacg ccctggttcc tggaacaatt 120

gcttttacag atgcacatat cgaggtggac atcacttacg ctgagtactt cgaaatgtcc 180

gttcggttgg cagaagctat gaaacgatat gggctgaata caaatcacag aatcgtcgta 240

tgcagtgaaa actctcttca attctttatg ccggtgttgg gcgcgttatt tatcggagtt 300

gcagttgcgc ccgcgaacga catttataat gaacgtgaat tgctcaacag tatgggcatt 360

tcgcagccta ccgtggtgtt cgtttccaaa aaggggttgc aaaaaatttt gaacgtgcaa 420

aaaaagctcc caatcatcca aaaaattatt atcatggatt ctaaaacgga ttaccaggga 480

tttcagtcga tgtacacgtt cgtcacatct catctacctc ccggttttaa tgaatacgat 540

tttgtgccag agtccttcga tagggacaag acaattgcac tgatcatgaa ctcctctgga 600

tctactggtc tgcctaaagg tgtcgctctg cctcatagaa ctgcctgcgt gagattctcg 660

catgccagag atcctatttt tggcaatcaa atcattccgg atactgcgat tttaagtgtt 720

gttccattcc atcacggttt tggaatgttt actacactcg gatatttgat atgtggattt 780

cgagtcgtct taatgtatag atttgaagaa gagctgtttc tgaggagcct tcaggattac 840

aagattcaaa gtgcgctgct ggtgccaacc ctattctcct tcttcgccaa aagcactctg 900

attgacaaatacgatttatc taatttacac gaaattgctt ctggtggcgc tcccctctct 960

aaggaagtcg gggaagcggt tgccaagagg ttccatctgc caggtatcag gcaaggatat 1020

gggctcactg agactacatc agctattctg attacacccg agggggatga taaaccgggc 1080

gcggtcggta aagttgttcc attttttgaa gcgaaggttg tggatctgga taccgggaaa 1140

acgctgggcg ttaatcaaag aggcgaactg tgtgtgagag gtcctatgat tatgtccggt 1200

tatgtaaaca atccggaagc gaccaacgcc ttgattgaca aggatggatg gctacattct 1260

ggagacatag cttactggga cgaagacgaa cacttcttca tcgttgaccg cctgaagtct 1320

ctgattaagt acaaaggcta tcaggtggct cccgctgaat tggaatccat cttgctccaa 1380

caccccaaca tcttcgacgc aggtgtcgca ggtcttcccg acgatgacgc cggtgaactt 1440

cccgccgccg ttgttgtttt ggagcacgga aagacgatga cggaaaaaga gatcgtggat 1500

tacgtcgcca gtcaagtaac aaccgcgaaa aagttgcgcg gaggagttgt gtttgtggac 1560

gaagtaccga aaggtcttac cggaaaactc gacgcaagaa aaatcagaga gatcctcata 1620

aaggccaaga agggcggaaa gatcgccgtg taa 1653

Claims (9)

1. The application of DGM1 protein or its coding gene in improving the root hair generating ability of plants;

   the DGM1 protein is a protein with an amino acid sequence of a sequence 2 in a sequence table;

   the plant is Arabidopsis thaliana.
2. The application of the DGM1 protein or the coding gene thereof in promoting the elongation of plant root hairs and/or promoting the increase of the density of the plant root hairs;

   the DGM1 protein is a protein with an amino acid sequence of a sequence 2 in a sequence table;

   the plant is Arabidopsis thaliana.
3. 3. Use according to claim 1 or 2, characterized in that: the encoding gene of the DGM1 protein is a DNA molecule as described in any one of the following items:

   (B1) a DNA molecule shown in the 156 nd-1778 th site of the sequence 1 in the sequence table;

   (B2) DNA molecule shown in sequence 1 in the sequence table.
4. 4. A method for producing a plant having a higher root hair growth ability, comprising the step of increasing the expression level and/or activity of DGM1 protein in a recipient plant;

   the DGM1 protein is a protein with an amino acid sequence of a sequence 2 in a sequence table;

   the plant is Arabidopsis thaliana.
5. 5. A method for cultivating a transgenic plant with stronger root hair generating capability comprises the following steps: introducing a DGM1 protein coding gene into a receptor plant to obtain a transgenic plant; the transgenic plant has a stronger root hair generating ability than the recipient plant;

   the DGM1 protein is a protein with an amino acid sequence of a sequence 2 in a sequence table;

   the plant is Arabidopsis thaliana.
6. 6. A method for cultivating a plant having increased root hair growth and/or density, comprising the step of increasing the expression level and/or activity of DGM1 protein in a recipient plant;

   the DGM1 protein is a protein with an amino acid sequence of a sequence 2 in a sequence table;

   the plant is Arabidopsis thaliana.
7. 7. A method of growing transgenic plants with increased root hair growth and/or density, comprising the steps of: introducing a DGM1 protein coding gene into a receptor plant to obtain a transgenic plant; said transgenic plant has a greater root hair growth and/or density than said recipient plant;

   the DGM1 protein has an amino acid sequence of a protein of a sequence 2 in a sequence table;

   the plant is Arabidopsis thaliana.
8. 8. The method according to claim 5 or 7, characterized in that: the encoding gene of the DGM1 protein is a DNA molecule as described in any one of the following items:

   (B1) a DNA molecule shown in the 156 nd-1778 th site of the sequence 1 in the sequence table;

   (B2) DNA molecule shown in sequence 1 in the sequence table.
9. 9. The method according to claim 5 or 7, characterized in that: the gene encoding the DGM1 protein is introduced into the recipient plant via a recombinant expression vector containing the gene encoding the DGM1 protein.

Images