CN111154770B

CN111154770B - Application of rice gene OsABCC2 in regulation of absorption and transportation of pesticides

Info

Publication number: CN111154770B
Application number: CN202010072153.2A
Authority: CN
Inventors: 林菲; 张汉林; 徐汉虹
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2020-01-21
Filing date: 2020-01-21
Publication date: 2021-06-25
Anticipated expiration: 2040-01-21
Also published as: CN111154770A

Abstract

The invention discloses application of a rice gene OsABCC2 in regulation of pesticide absorption and transportation. The gene OsABCC2 for regulating and controlling the pesticide absorption and transportation of rice is obtained by separating and cloning from the flower 11 in the rice variety, and the nucleotide sequence, the encoded protein, the recombinant vector containing the gene OsABCC2, the expression cassette, the transgenic cell line and the recombinant bacterium of the gene OsABCC2 can improve the pesticide absorption and transportation of the rice, so that the pesticide reaches the pest-damaged part, and the using amount of the pesticide in the rice field is reduced; can also improve the pesticide transmission and guide performance of rice varieties in heredity and select rice varieties with pesticide high-efficiency utilization. In addition, the OsABCC2 gene can participate in regulating the plant height of rice and has the function of improving the rice germplasm resources.

Description

Application of rice gene OsABCC2 in regulation of absorption and transportation of pesticides

Technical Field

The invention relates to the field of plant genetic engineering, in particular to application of a rice gene OsABCC2 in regulation of absorption and transportation of pesticides.

Background

People eat as days and rice as first. Since the establishment of China, the most remarkable achievement of agricultural development in China is to cultivate land which accounts for 7% of the world and live 22% of the population of the world. The rice is one of the most important food crops in China, and more than 65% of people in China eat rice as food. Therefore, how to guarantee the grain safety and realize the stable grain yield increase becomes the most urgent problem to be solved in the agricultural development of China. The main problem of grain safety is the problem of plant diseases and insect pests. In the actual production, the commonly used pest control means include agricultural control, physical control, chemical control, biological control and the like, and the chemical control becomes the most main means for controlling pests at present by the advantages of wide insecticidal spectrum, rapidness and high efficiency, simple and convenient use method, no limitation by regions and seasons, convenience for large-area mechanized control and the like. However, according to literature reports, due to factors such as drift and rain wash, the loss of pesticide in field spraying is as high as 70%, and the dosage of the pesticide actually reaching the biological action target is only insufficient for 0.1% (Zhao et al, 2018). Therefore, how to improve the targeting property of the pesticide and then improve the utilization rate of the pesticide becomes one of the problems which need to be solved urgently in modern agriculture.

The pesticide transport gene can realize the targeted accumulation of pesticide and improve the effective utilization of the pesticide. Therefore, by utilizing the separation and cloning of the pesticide transport gene and protein of the rice, the targeted accumulation regulation and control of the systemic delivery conductive pesticide can be hopefully realized, the environmental release is reduced, and the method is beneficial to rice breeding and has important economic value. The gene OsABCC2 separated and cloned into rice by the inventor has the function of isolating toxic metal ions such as cadmium, arsenic and the like in vacuoles in Arabidopsis (Park et al, 2011) and can efficiently transport glutathione conjugates and chlorophyll metabolites (Lu et al, 2007) in spinach according to literature reports, but the function of the gene OsABCC2 in rice is not reported yet.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention mainly aims to provide the application of the rice gene OsABCC2 in regulating the absorption and transportation of pesticides.

The invention also aims to provide a molecular marker detection primer of the rice gene OsABCC 2.

The invention further aims to provide a molecular marker detection kit for the rice gene OsABCC 2.

The purpose of the invention is realized by the following technical scheme: the application of the rice gene OsABCC2 in regulation of pesticide absorption and transportation is based on the discovery by the inventor of the invention that the overexpression of the OsABCC2 gene can improve the pesticide absorption and transportation of rice, so that the pesticide reaches the pest-damaged part, and the usage amount of the pesticide in the rice field is reduced; and the pesticide transferring ability of the rice variety can be improved genetically, and the rice variety with high pesticide utilization efficiency can be bred.

The regulation of pesticide absorption and transportation is realized by over-expression of OsABCC2 gene, so that the absorption and transportation of the pesticide by rice are improved.

The pesticide is preferably systemic pesticide; further preferred are systemic insecticides; further preferably one of neonicotinoid insecticide, amide insecticide, organophosphorus insecticide, nereistoxin insecticide or carbamate insecticide; most preferably one of thiamethoxam, chlorantraniliprole, omethoate, dimehypo or methomyl.

The protein coded by the rice gene OsABCC2 has the amino acid sequence of A) or B):

A. as shown in SEQ ID NO: 1;

B. the amino acid sequence of the derivative protein with the same function obtained by substituting and/or deleting and/or adding one or more amino acid residues in the A.

The nucleotide sequence of the rice gene OsABCC2 is any one of the following C) to G):

C. as shown in SEQ ID NO: 2;

D. as shown in SEQ ID NO: 3;

E. hybridizes under stringent conditions to a nucleotide as defined by C or D and encodes a nucleotide sequence as set forth in SEQ ID NO: 1;

F. has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology to the nucleotide sequence defined by C and encodes a polypeptide consisting of the sequence set forth in SEQ ID NO: 1;

G. has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology to the nucleotide sequence defined by D and encodes a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1, or a nucleotide sequence of an amino acid shown in the specification.

The application of the recombinant vector, the expression cassette, the transgenic cell line and the recombinant bacterium containing the rice gene OsABCC2 in regulation of pesticide absorption and transportation also belongs to the protection scope of the invention.

A molecular marker detection primer of a rice gene OsABCC2 is composed of a primer shown as SEQ ID NO: 4 and SEQ ID NO: 5 comprises an upstream primer and a downstream primer which are shown in the specification:

F:5'-AAAGTGAGGAGTGCAGAGCC-3'；

R:5'-CAGGATGCCGTAGCGAGATT-3'。

the application of the molecular marker detection primer of the rice gene OsABCC2 in identifying rice varieties which efficiently utilize pesticides comprises the following steps: the molecular marker detection primer is used for amplifying the germplasm genome DNA or RNA of the rice variety to be detected, and the sensitivity of the target variety responding to pesticide treatment is judged through the change of gene expression.

A molecular marker detection kit of a rice gene OsABCC2 comprises the molecular marker detection primer.

The molecular marker detection kit of the rice gene OsABCC2 further comprises at least one of an enzyme for PCR, water for PCR and a buffer solution for PCR.

The application of the rice gene OsABCC2 in cultivating transgenic rice with efficient pesticide utilization comprises the following steps: the rice gene OsABCC2 is constructed on a plant expression vector, and the obtained recombinant expression vector is transferred into rice for expression to obtain a rice variety which efficiently utilizes pesticides.

The plant expression vector is preferably pCAMBIA 2300-35S.

The obtained recombinant expression vector is transferred into rice for expression, and the obtained recombinant plant expression vector can be transferred into plant cells or tissues by conventional biological methods such as agrobacterium mediation, plant virus vectors, direct DNA transfer, conductance transfer and the like.

The rice gene OsABCC2 is applied to the regulation of rice plant height.

Compared with the prior art, the invention has the following advantages and effects:

1. the invention utilizes Polymerase Chain Reaction (PCR) to separate and clone a gene OsABCC2 for controlling pesticide absorption and transportation from a rice variety flower 11 into rice, and the application of the gene can increase the absorption and transportation of the rice to the pesticide, so that the pesticide reaches the pest position, and the usage amount of the pesticide in the rice field is reduced.

2. The expression of the gene OsABCC2 in rice can be improved genetically to improve the pesticide conductance of rice varieties, select varieties with high pesticide utilization efficiency, and realize the reduction and the increase of the pesticides in rice fields.

3. The invention proves the effect of the gene OsABCC2 in pesticide absorption and transportation, and provides a new clue for researching the utilization mechanism of rice on pesticides.

4. The molecular marker detection primer of the gene OsABCC2 and the detection kit containing the primer provided by the invention quickly judge the sensitivity of a target variety in response to pesticide treatment through the change of gene expression level, and breed and efficiently utilize new varieties with output conductivity.

5. The gene OsABCC2 provided by the invention can adjust the plant height of rice and has the effect of improving rice germplasm resources.

Drawings

FIG. 1 is a real-time quantitative fluorescence PCR detection result diagram of OsABCC2 gene expression level in OsABCC2 over-expressed rice strain.

Fig. 2 is a diagram of the alignment result of the OsABCC2 gene sequences of a CRISPR knockout OsABCC2 gene mutant plant and a wild plant.

FIG. 3 is a graph showing the results of detecting thiamethoxam content in roots and upper parts of roots of mutant rice having OsABCC2 gene.

FIG. 4 is a graph showing the results of measuring chlorantraniliprole contents in the roots and upper parts of roots of mutant rice of OsABCC2 gene.

FIG. 5 is a graph showing the results of examining the omethoate content in the root and upper part of the root of a mutant rice of OsABCC2 gene.

FIG. 6 is a graph showing the results of examining the bisultap content in the roots and upper parts of roots of mutant rice having OsABCC2 gene.

FIG. 7 is a graph showing the results of examining the content of methomyl in the roots and upper parts of roots of mutant rice of OsABCC2 gene.

FIG. 8 is a graph showing the results of examining the transfer coefficient of thiamethoxam in a mutant rice line of OsABCC2 gene.

FIG. 9 is a graph showing the results of examining the transfer coefficient of chlorantraniliprole in a mutant rice line of the OsABCC2 gene.

FIG. 10 is a graph showing the results of examining the transfer coefficient of omethoate in a mutant rice line of the OsABCC2 gene.

FIG. 11 is a graph showing the results of examining the transfer coefficient of bisultap in a mutant rice line of OsABCC2 gene.

FIG. 12 is a graph showing the results of examining the transfer coefficient of methomyl in a mutant rice line of OsABCC2 gene.

FIG. 13 is a real-time fluorescent quantitative PCR detection result chart of OsABCC2 gene under the condition of 100 mu mol/L Thiamethoxam (THX) treatment for 24 hours.

FIG. 14 is a graph showing the result of subcellular localization of OsABCC2 protein-GFP in rice protoplasts; wherein A, B, C and D are the subcellular localization result maps of protein GFP; E. f, G and H are subcellular localization result graphs of the fusion protein OsABCC 2-GFP; a and E are results in the bright field; b and F are green fluorescence in a dark field; c and G are membrane localization protein mCherry-1008 red fluorescence; d and H are overlapping fields of view; scale bar 10 μm.

FIG. 15 shows the phenotype of mutant rice lines (10 cm on scale) of the OsABCC2 gene; wherein, A is wild type rice middle flower 11, B is mutant Crispr-1, C is mutant Crispr-6, and D is mutant Crispr-7.

FIG. 16 is a statistical chart of plant heights of mutant rice of OsABCC2 gene.

FIG. 17 is a statistical chart of the root length of the mutant rice of OsABCC2 gene.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

The test methods in the following examples, in which specific experimental conditions are not specified, are generally performed according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. The materials, reagents and the like used are, unless otherwise specified, reagents and materials obtained from commercial sources.

In the examples, Escherichia coli DH5 alpha and Agrobacterium EHA105 are commonly used strains, and most molecular biology laboratories have preservation and can be commercially purchased; the rice variety is wild type medium flower 11 (publicly used rice variety, commercially available).

The chemical reagents used in the examples were all imported or domestic analytical grade.

The primers used in the examples were synthesized by Shenzhen Huamao Gene Co, and the sequencing was performed by Shenzhen Huamao Gene Co.

Example 1 cloning of OsABCC2 Gene and protein encoded thereby

RNA (OMEGA R6827-01) of 11 seedlings of wild japonica rice was extracted, and reverse transcription (Takara cat #6210A) was performed to obtain gDNA-removed cDNA (having nucleotide sequence shown in SEQ ID NO: 3), which was used as a template for PCR amplification using forward primer F1 and reverse primer R1. An 8940bp PCR product was obtained.

After sequencing, the 8940bp PCR product has the nucleotide sequence shown in SEQ ID NO: 2, and codes 1386 amino acids. The coded protein is named as OsABCC2, and the amino acid sequence of the protein is shown as SEQ ID NO: 1 is shown.

F1：5'-ATGGCCAAAAACAAACATCCTACCA-3'；

R1：5'-CTATGATGATCTTCCCACGAATTCC-3'。

Example 2 construction of plants overexpressing OsABCC2

Over-expression OsABCC2 gene

1. Construction of recombinant expression vector pCAMBIA1300-35S-OsABCC2

RNA of wild type Zhonghua 11 seedling was extracted, and cDNA was obtained by reverse transcription as a template (the method for extraction and reverse transcription was the same as in example 1), and PCR amplification was performed using primer 1(ACCCGGGGATCCTCTAGAGTCGAATGGCCAAAAACAAACATCCTACCA) and primer 2(ATGATACGAACGAAAGCTCTGCACTATGATGATCTTCCCACGAATTCC) (Takara cat # R045) under the following reaction conditions: 1 cycle: heating at 98 deg.C for 3 min; 32 cycles of: 98 deg.C, 30s, 58 deg.C, 30s, 72 deg.C, 1 min; 1 cycle: 72 ℃ for 5 min; the OsABCC2 gene with 18 basic group homologous recombination arms is obtained at 16 ℃.

The PCR product was recovered by gel, and subjected to homologous recombination with a pCAMBIA1300-35S vector backbone (supplied by Wuhan Boehringer) digested with both Sal I and Pst I by an In-fusion kit (Takara cat #639648) to obtain a recombinant plasmid. The recombinant plasmid is subjected to sample feeding and sequencing, is named as pCAMBIA1300-35S-OsABCC2, and is a recombinant expression vector.

2. Preparation of transgenic rice over-expressing OsABCC2

1) The recombinant expression vector pCAMBIA1300-35S-OsABCC2 is transferred into agrobacterium EHA105 (Olivia et al, 2019) by electric shock to obtain recombinant bacteria AGL1/pCAMBIA1300-35S-OsABCC2 (plasmids are extracted from positive clones, and sequencing verification is carried out).

2) The recombinant strain AGL1/pCAMBIA1300-35S-OsABCC2 is used for transforming medium flower 11 rice callus by an agrobacterium-mediated method, and the method comprises the following steps:

a single colony of AGL1/pCAMBIA1300-35S-OsABCC2 was picked, inoculated into 10mL of Agrobacterium culture medium (containing 50mg/L kanamycin and 50mg/L rifampicin), and shake-cultured at 28 ℃ and 180rpm for 2-3 days. Centrifuging 4mL of bacterial solution at 4000rpm for 3min, pouring out the supernatant, adding a small amount of AAM culture medium to reconstitute the suspended cells, adding 20mL of AAM culture medium (containing 0.1mM acetosyringone As), performing shake cultivation at 28 deg.C and 150rpm in the dark for 1-2h, and culturing to OD₆₀₀About 0.4. Selecting rice callus of granular Zhonghua 11 (hereinafter also referred to as wild type rice) with good growth state, soaking in Agrobacterium culture solution, shaking at 28 deg.C and 150-The wounded tissue is spread on a sterile plate containing multiple layers of filter paper, dried on an ultra-clean bench (the callus is scattered and does not block), and then the callus is transferred to a co-culture medium and cultured for 2-3 days under dark conditions. The calli were transferred to NB minimal medium containing 100mg/L hygromycin and 400mg/L cefamycin for 3-4 weeks (one screen). The surviving calli were transferred to a secondary screening medium (NB minimal medium containing 100mg/L hygromycin and 200mg/L cefuroxime) for 3 weeks. Transferring the resistant callus to a differentiation culture medium (containing 100mg/L hygromycin) for differentiation, transferring a regenerated plant to a greenhouse after the regenerated plant takes root on a strong seedling culture medium (about 3-4 weeks) containing 100mg/L hygromycin to obtain T₀Transgenic OsABCC2 rice.

The media used in the above transformation were as follows:

co-culture medium: callus and subculture medium + As (0.1mM/L) + glucose (10g/L), pH 5.2 were induced. (Beijing Huayuyo Biotech Co., Ltd.)

The culture medium of the rice callus infected by agrobacterium comprises: AA macroelement, AA microelement, AA amino acid, MS vitamin, hydrolyzed casein (500mg/L), sucrose (68.5g/L), glucose (36g/L), As (0.1mM) and pH 5.2. (Beijing Huayuyo Biotech Co., Ltd.)

NB minimal medium: macroelement N6 + trace element B5 + organic component B5 + iron salt + hydrolyzed casein (300mg/L) + proline (500mg/L) + sucrose (30g/L) + agar (8g/L), pH 5.8. (Beijing Huayuyo Biotech Co., Ltd.)

Induction of callus and subculture medium: NB minimal medium +2, 4-D (2 mg/L).

Differentiation medium: NB minimal medium +6-BA (3mg/L) + NAA (1 mg/L).

Strong seedling culture medium: 1/2MS inorganic salt + NAA (0.5mg/L) + MET (0.25 mg/L).

Agrobacterium culture medium (YEP): 10g/L tryptone +10g/L yeast extract +5g/L sodium chloride +15g/L agar.

3. Molecular identification of OsABCC2 transgenic rice

1) Preliminary identification by PCR

Extraction of T₀Transgenic OsABCC2 rice genome DNA (OMEGA cat # D2485-02) with primers F2 andr2 (primer sequences are as follows) is subjected to PCR identification under the following reaction conditions: 1 cycle: heating at 98 deg.C for 3 min; 32 cycles of: 98 deg.C, 30s, 60 deg.C, 30s, 72 deg.C, 30 s; 1 cycle: 72 ℃ for 5 min; 16 ℃ is adopted. Screening out PCR positive T₀Transgenic OsABCC2 rice plants #1, #2 and # 3.

F2：5'-GATCCTGGGTTCGACTCCCCATGGA-3'；

R2：5'-TACTGTGACAACCAATATAAAAAAT-3'。

2) Analysis of transcript levels

Extraction of PCR-Positive T₀Total RNA of OsABCC2 rice lines #1, #2 and #3 was transferred by passage, and reverse transcription (OMEGA) was performed to obtain cDNA as a template, and real-time quantitative fluorescent PCR was performed using the following primers to detect the expression level of OsABCC2 gene in each material at the transcription level. The experiment was repeated 3 times and the results averaged. Wild type rice was used as a control (WT).

Real-time quantitative fluorescent PCR was performed using Bio-Rad CFX 96. The PCR reaction system (20. mu.L) was carried out according to the product instruction SYBR Green Real-Time PCR Master Mix reagent (Takara) as follows: 10 μ L SYBR Green Real-Time PCR Master Mix, 2 μ L upstream and downstream primer Mix (both 10 μ M upstream and downstream primer concentration), 7 μ L RNase-free water, 1 μ L cDNA template. The specific reaction procedure is as follows: enzymatic heat activation at 95 deg.C for 30s for 1 cycle; denaturation at 95 ℃ for 5s, extension at 60 ℃ for 30s for 40 cycles.

Wherein the primer sequence for amplifying the OsABCC2 gene is as follows:

F：5'-ATGGAAGCGAAGGACTC-3'；

R：5'-CAAATGTGACAACCGACA-3'。

the primer sequence for amplifying the internal reference UBQ2 by using UBQ2 as an internal reference gene is as follows:

F：5’-GCATCTCTCAGCACATTCCA-3’；

R：5’-ACCACAGGTAGCAATAGGTA-3’。

the data are processed by using a complementary Ct method, i.e., the Ct value is the number of cycles that the fluorescence signal in the PCR tube passes through when reaching a set threshold value, and the delta Ct (OsABCC2) -Ct (ACTIN1) is calculated by 2^－△△CtThe value of (a) measures the level of gene transcription, and the expression of OsABCC2 gene in each materialAnd (5) performing analysis comparison.

The real-time quantitative fluorescent PCR detection result of the OsABCC2 gene expression level in each experimental material is shown in FIG. 1, and the expression of the OsABCC2 gene is relative values, which can be seen as follows: compared with the non-transgenic wild rice japonica rice middle flower 11(WT), the PCR positive T₀The expression level of the OsABCC2 gene in the transgenic OsABCC2 rice lines #1, #2 and #3 is obviously improved on the transcription level. PCR positive T₀The generation-transformed OsABCC2 rice lines #1, #2 and #3 are positive T0 generation-transformed OsABCC2 rice and are named as OsABCC2-OX-1, OsABCC2-OX-2 and OsABCC 2-OX-3.

Example 3 CRISPR knockout construction of OsABCC2 mutant plants

1. Selection of target sequences based on exon sequences of OsABCC2 using CRISPR/Cas9 system

Selecting a specific target sequence according to an OsABCC2 exon sequence by utilizing a simple and efficient CRISPR/Cas9 system, wherein the target sequence comprises the following steps: GTCTTGGAGGCC are provided. The target sequence is specific to the OsABCC2 gene and specifically inactivates the OsABCC2 protein.

2. Construction of pCRISPR/Cas9 recombinant vector containing the target sequence fragment

1) Design of adaptor primer with cohesive end according to target sequence

The designed linker primer was added to the specific sticky end linker (F: GGCA; R: AAAC) of the pCRISPR/Cas9 system and the complete linker primer was synthesized.

F3：5’-GGCA-AAAGTGAGGAGTGCAGAGCC-3’；

R3：5’-AAAC-CAGGATGCCGTAGCGAGATT-3’。

2) Annealing and complementing the adaptor primer with the cohesive end to form a double-stranded small fragment with the cohesive end

Diluting the F3 primer and the R3 primer into 10 mu M solutions, uniformly mixing 10 mu L of each solution, carrying out annealing reaction in a PCR instrument, reducing the temperature from 98 ℃ to 22 ℃, and enabling the F3 primer and the R3 primer to be complementary to form a double-stranded small fragment with a sticky end.

3) Cleavage of the original vector pOs-sgRNA containing sg-RNA (TAKARA Cat #632640)

Cleavage of the original vector pOs-sgR containing sg-RNA with the restriction enzyme Bsa INA, which produces sticky ends that can be complementary to the sticky ends of the target sequence. The pOs-sgRNA original vector system was digested with Bsa I: 10 XBuffer Bsa I2. mu. L, Bsa I enzyme 1. mu. L, pOs-sgRNA vector 4. mu.g, ddH₂The amount of O is up to 20. mu.L, and the enzyme is cleaved at 37 ℃ for 12 h. Checking the size of the cut enzyme product with 1% agarose gel electrophoresis, purifying the cut enzyme product with a column chromatography kit (OMEGA Cat # D2500-02) to obtain pOs-sgRNA vector, adding sterilized ddH₂Dissolving O, and measuring the concentration for later use.

4) Ligating double-stranded small fragments with cohesive ends to the digested pOs-sgRNA vector to form a recombinant vector comprising the target sequence and sg-RNA

Connecting the double-stranded small fragment in the step 2) with the cut pOs-sgRNA vector in the step 3) by using T4 ligase to form a complete recombinant vector containing a target sequence aiming at the OsABCC2 protein and sg-RNA. The 15 μ L linker is: 10 XT 4 ligation buffer 1.5 uL, double-stranded small fragment 4 uL, enzyme-cleaved pOs-sgRNA vector 3 u L, T4 DNA ligation buffer 1 u L, ddH₂O to 15. mu.L, and ligation was performed at 16 ℃ for 12 hours. And transforming the connecting product into escherichia coli DH5 alpha, culturing the kanamycin-resistant LB plate overnight, selecting a positive strain, and sequencing to obtain a recombinant vector which is correctly sequenced and contains a target sequence and sg-RNA.

5) LR-reactive recombination of a recombinant vector comprising a target sequence and sg-RNA and a vector pH-Ubicas9-7 comprising Cas9 with LRmix to form a complete recombinant vector comprising the target sequence-sg-RNA + Cas9

LR mix (North Noro Biotechnology Co., Ltd, Shanghai) was used to recombine the recombinant vector obtained in step 4) with the vector pH-Ubi-Cas9-7 (supplied by Wuhanbo Co., Ltd) containing Cas9 by LR reaction: 25-50ng of recombinant vector containing target sequence and sg-RNA, 75ng of pH-Ubi-cas9-7 vector, 1. mu.L of 5 xlr clone TM Buffer, TE Buffer (pH8.0) were supplemented to 4.5. mu.L of LR clone TM 0.5 uL. The system is incubated for 2h at 25 ℃,2 mu L of 2 mu g/mu L of protease K is added after reaction, the reaction product is treated for 10min at 37 ℃, then 2 mu L of reaction product is transferred into Escherichia coli DH5 alpha, gentamicin resistance LB plate is cultured overnight at 37 ℃, positive strains are selected for sequencing, and the complete pCRISPR/Cas9 recombinant vector containing OsABCC2 protein target sequence-sg-RNA + Cas9 with correct sequencing is obtained.

3. The obtained pCRISPR/Cas9 recombinant vector is introduced into rice callus to obtain transgenic plant

According to the method for transferring OsABCC2 rice by the recombinant vector in example 2, the complete recombinant vector containing the OsABCC2 protein target sequence-sg-RNA + Cas9 obtained in step 5) is introduced into rice callus to prepare transgenic rice, and a transgenic plant with the OsABCC2 protein completely inactivated can be obtained in a T0 generation plant.

4. Screening transgenic positive plants in transgenic plants

Transgenic plants (T) to be transplanted₀Generation) and carrying out target sequence locus detection to detect 40 positive plants in total.

5. Obtaining mutant plants using transgenic positive plants

1) Identification of the site of mutation

And (3) extracting DNA from the transplanted positive plant, designing specific primers F4 and R4 aiming at the DNA fragment containing the target site and within 500bp, amplifying the DNA fragment containing the target site, purifying and then sending the amplified 400bp PCR product to a company for sequencing, comparing the sequencing result with the sequence of the wild plant, and screening out the mutant plant. The results of the partial mutation analysis are shown in FIG. 1.

F4:5’-AAAGTGAGGAGTGCAGAGCC-3’；

R4:5’-CAGGATGCCGTAGCGAGATT-3’。

2) And (3) breeding the mutant plants, detecting that the plants without the transgenic elements such as hygromycin, Cas9 and the like in a T1 generation transgenic segregation population and harvesting seeds of the individual plants to obtain the function-deleted mutants without transgenic components, which are named as Crispr-1, Crispr-6 and Crispr-7 respectively.

Example 4 Effect of OsABCC2 mutant plants on the uptake and transport of pesticides

The following pesticides were selected for the experiments: neonicotinoid insecticides such as thiamethoxam, amide insecticide chlorantraniliprole, organophosphorus insecticide omethoate, nereistoxin insecticide such as bisultap and carbamate insecticide methomyl. The contents of the agricultural chemicals in the rice rhizome and leaves of Crispr-1, Crispr-6 and Crispr-7 rice lines and wild-type rice Zhonghua 11 obtained in example 3 were examined.

(1) The thiamethoxam is dissolved in DMSO to prepare a 40mM mother solution, and the mother solution is stored at 4 ℃ for later use. Picking out rice seedlings growing in a rice incubator for 14 days, carefully washing out root nutrient solution, and grouping 10 rice seedlings. Then placing the roots of the rice seedlings in 0.5mM calcium chloride buffer solution for pre-culture for 2 h; diluting the mother liquor to 100 μm with 0.5mM calcium chloride buffer solution, adjusting pH to 5.8, adding into 50mL centrifuge tube, 40mL each tube, transferring rice seedling into the tube, fixing with fixed value cup to ensure that the stem part of rice contacts the liquid surface, and standing in artificial climate incubator for 24 h. After 24h, the rice was removed and the roots were washed 4 times with 0.5mM (pH 5.8) calcium chloride buffer to ensure complete removal of the drug attached to the root surface. Drying surface water with filter paper, cutting off 1cm below and 1cm above the rhizome junction with a blade, and dividing the rice into root, stem and leaf. Respectively weighing and recording, adding liquid nitrogen into a mortar for grinding, adding 10mL of chromatographic grade acetonitrile for extraction, carrying out ultrasonic treatment for 30min, carrying out 14000g centrifugation for 10min, sucking 1mL of supernatant, filtering through a 0.22 mu m needle microporous filter membrane to remove impurities, filling into a liquid phase bottle, and placing a sample at the low temperature of-80 ℃ for preservation and detection. Each treatment was repeated for 3 groups. The same treatments were carried out on rice seedlings with chlorantraniliprole, omethoate, dimehypo and methomyl, 3 treatments each being repeated.

The results show that the content of Thiamethoxam (THX), chlorantraniliprole, omethoate, dimehypo and methomyl in the upper root (root) of the rice lines Crispr-1, Crispr-6 and Crispr-7 is lower than that of the wild type, and the content in the root (shot) is not obviously different from that of the wild type (figure 3, figure 4, figure 5, figure 6 and figure 7); the transfer coefficient (RCF) was significantly reduced in the rice lines Crispr-1, Crispr-6 and Crispr-7 compared to the wild type (FIG. 8, FIG. 9, FIG. 10, FIG. 11, FIG. 12).

Example 5 development of OsABCC2 molecular Probe

The neonicotinoid insecticide thiamethoxam is taken as an example.

Seedlings of flower 11 of the 14-day-old wild type variety were treated with thiamethoxam in an amount of 100. mu. mol/L in the same manner as in step (1) of example 4, and treated with solvent water as a Control (Control). After treatment, RNA was extracted, and after reverse transcription, expression of OsABCC2 gene was detected by quantitative PCR technique in the same manner as in example 2, with three replicates of the experiment.

As a result, as shown in FIG. 13, the specific expression of OsABCC2 gene in rice roots, stems and leaves was strongly induced under the thiamethoxam-treated condition. Therefore, the primer is used as a molecular probe to perform expression analysis on the OsABCC2 gene in rice germplasm, can quickly judge the response processing capacity of a target variety to thiamethoxam, and can be used for breeding new varieties with high thiamethoxam absorption.

Example 6 subcellular localization of OsABCC2 protein

Extracting total RNA of rice seedlings with 15-day-sized medium flowers 11, carrying out reverse transcription to obtain cDNA (complementary deoxyribonucleic acid) serving as a template, carrying out PCR (polymerase chain reaction) amplification, and amplifying the full-length ORF (removing a stop codon) of OsABCC2 by using primers as follows:

F5：5’-TCAGATCTCGAGCTCAAGCTTCATGGCCAAAAACAAACATCC-3’；

R5：5’-CCTTGCTCACCATCAGGATCCCTATGATGATCTTCCCACGA-3’。

and (3) carrying out enzyme digestion and recovery on the amplified target fragment, connecting the target fragment with an empty carrier 322-d1-eGFPn (Beijing Huayun), fusing OsABCC2 and GFP, transferring the fused carrier 322-d1-eGFPn-OsABCC2 and the empty carrier into the rice protoplast after the sequencing and identification are correct, normally culturing for 16h at room temperature, and observing the subcellular localization of the fused protein OsABCC2-GFP and the protein GFP in the rice protoplast under a laser confocal microscope. The results are shown in FIG. 14, which demonstrates that the OsABCC2 protein is specifically localized in rice cell membranes.

Example 7 Effect of OsABCC2 Gene mutation on plant height

The OsABCC2 rice Crispr-1, Crispr-6 and Crispr-7 mutants obtained in example 3 and the wild type rice middle flower 11 were planted in a rice incubator and the phenotype was observed after two weeks. 15 strains of each strain, the experiment was repeated 3 times, and the results were averaged.

The phenotype was observed, with reduced plant height of the rice lines Crispr-1, Crispr-6 and Crispr-7 compared to the wild type rice mid-flower 11, and no significant change in root length (FIG. 15). By measuring the plant height and root length of rice, the plant heights of the rice lines Crispr-1, Crispr-6 and Crispr-7 are all reduced compared with the wild type rice middle flower 11 (figure 16), and the root length is unchanged (figure 17).

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> southern China university of agriculture

<120> application of rice gene OsABCC2 in regulation of absorption and transportation of pesticides

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1386

<212> PRT

<213> Rice (Oryza sativa)

<220>

<223> OSABCC2 amino acid sequence

<400> 1

Met Ala Lys Asn Lys His Pro Thr Arg Cys Arg Val Pro Gln Ala Leu

1 5 10 15

Ala Gln Gly Thr Leu Glu Ala Arg Thr Trp Lys Trp Asn Leu Lys Asn

20 25 30

His Gly Tyr Val Phe Leu Lys Ile Arg Ala Leu Leu Val Val Asn Glu

35 40 45

Leu Ile Ala Gly Ala Gly Val Val Ser Asn Trp Pro Ser Val Leu Leu

50 55 60

Ser Trp Trp Phe Phe Ser Phe Leu Ser Glu Ser Leu Leu Thr Ser Leu

65 70 75 80

His Leu Leu His Leu Phe Asn Ser Ala Thr Val Val Asp Phe Thr Ser

85 90 95

Leu Pro Leu Cys Thr Phe Ile Cys Leu Val Ala Val Thr Met Arg Pro

100 105 110

Ser Lys Ala Asn Gln Gln Asp Gln Asn Gln Pro Leu Leu Val Arg Glu

115 120 125

Asp Ser Asp Asp Ser Ser Thr Asp Arg Phe Ser Asn Ser Gly Trp Trp

130 135 140

Ser Cys Leu Thr Phe Gln Trp Leu Asn Pro Ile Phe Glu Lys Gly His

145 150 155 160

Lys Val Arg Leu Glu Leu Asp His Ile Pro Ser Val Pro Gln Ser Asp

165 170 175

Thr Ala Asn Gln Ser Tyr Ala Leu Leu Gln Glu Thr Leu His Lys Gln

180 185 190

Lys Pro Glu Pro Met Pro Met Arg Arg Ala Ile Ile Cys Ala Val Trp

195 200 205

Thr Pro Leu Ile Ala Asn Gly Val Phe Ala Gly Leu Asn Thr Ile Ala

210 215 220

Ser Tyr Met Gly Pro Phe Leu Ile Thr Tyr Leu Val Glu Leu Leu Ser

225 230 235 240

Asp Lys Asn Pro Asp Lys Gly His Gly His Gly Tyr Met Leu Ala Cys

245 250 255

Leu Phe Phe Ala Ser Lys Thr Val Glu Ser Leu Ser Gln Arg Gln Trp

260 265 270

Tyr Phe Gly Ala Arg Arg Ile Gly Phe Arg Val Arg Ala Ala Leu Met

275 280 285

Val Ser Ile Tyr Gln Lys Ser Leu Leu Met Lys Asn Ser Ser Thr Ala

290 295 300

Ser Gly Lys Ile Val Asn Phe Leu Asp Val Asp Val Glu Lys Val Ser

305 310 315 320

Glu Phe Phe Trp Tyr Val His Arg Ile Trp Leu Leu Pro Leu Gln Ile

325 330 335

Ser Leu Ala Leu Ala Ile Leu Tyr Arg Ser Leu Gly Ala Met Ala Ser

340 345 350

Leu Ser Ala Val Leu Ala Thr Val Leu Val Met Val Ser Asn Thr Pro

355 360 365

Leu Ala Lys Ser Gln Glu Asn Leu Asn Met Lys Ile Met Glu Ala Lys

370 375 380

Asp Ser Arg Ile Lys Ala Met Ala Glu Ala Met Lys Ser Met Arg Ile

385 390 395 400

Leu Lys Leu His Ala Trp Glu Thr Ala Tyr Phe Asp Lys Leu Leu Asn

405 410 415

Leu Arg Asp Val Glu Arg Gly Trp Leu Arg Lys Tyr Leu Tyr Thr Cys

420 425 430

Ser Ala Ile Ala Phe Leu Phe Trp Ala Ser Pro Thr Leu Val Ser Val

435 440 445

Val Thr Phe Gly Val Cys Ile Leu Val Glu Met Pro Leu Ser Ala Gly

450 455 460

Thr Val Leu Ser Ala Val Ala Thr Phe Arg Ile Leu Gln Asp Pro Ile

465 470 475 480

Tyr Asn Leu Pro Glu Leu Val Ser Met Val Thr Gln Thr Lys Val Ser

485 490 495

Leu Asp Arg Ile Glu Glu Phe Ile Lys Glu Glu His Gln Gly Lys Pro

500 505 510

Ser Arg Ser Asp Asn Asn Thr Arg Thr Lys Asp Leu Ser Met Thr Gly

515 520 525

Ala Met Glu Ile Glu Pro Gly Val Tyr Gly Trp Glu Ile Asp Asn Ser

530 535 540

Leu Lys Lys Thr Lys Phe Met Leu Lys Ile Asp Arg Lys Leu Ser Ile

545 550 555 560

Ser Lys Gly Gln Lys Val Ala Val Cys Gly Pro Val Gly Ser Gly Lys

565 570 575

Ser Ser Leu Leu Tyr Ser Ile Met Gly Glu Ile Pro Arg Ile Asn Gly

580 585 590

Ala Glu Thr Thr Val Phe Gly Ser Arg Ala Tyr Val Ala Gln Ser Ala

595 600 605

Trp Ile Gln Thr Gly Thr Ile Gln Asp Asn Val Leu Phe Gly Lys Asp

610 615 620

Met Asp Arg Ser Phe Tyr Glu Glu Val Leu His Gly Cys Ala Leu Asp

625 630 635 640

Arg Asp Leu Glu Leu Trp Ala Asn Gly Asp Met Thr Met Val Gly Glu

645 650 655

Arg Gly Met Asn Leu Ser Gly Gly Gln Lys Gln Arg Ile Gln Leu Ala

660 665 670

Arg Ala Leu Tyr Ser Asp Ser Asp Val Tyr Leu Leu Asp Asp Pro Phe

675 680 685

Ser Ala Val Asp Ala His Thr Gly Ala His Leu Phe Lys Glu Cys Leu

690 695 700

Leu Arg Leu Met Ser Ser Lys Thr Val Ile Tyr Val Thr His Gln Leu

705 710 715 720

Glu Phe Leu Arg Asp Ala Asp Leu Val Leu Val Met Lys Asp Gly Arg

725 730 735

Ile Val Gln Ser Gly Lys Tyr Asp Asp Leu Val Ala Asp Arg Asn Gly

740 745 750

Glu Leu Ser Met Gln Met Ala Ala His Asn Gln Ser Leu Ser Gln Val

755 760 765

Thr Pro Ala Lys Ala His Val Leu Thr Lys Asn Lys Ser His Lys Arg

770 775 780

Arg Gln Thr Glu Leu Thr Glu Ile Glu Leu Asp His Asn Val Ile Gly

785 790 795 800

Arg Glu Cys Glu Glu Glu Arg Glu Ser Gly Arg Val Lys Trp Asp Ile

805 810 815

Tyr Arg Lys Phe Val Asn Ser Ala Tyr Gly Gly Ala Leu Val Pro Val

820 825 830

Ile Leu Ala Cys Gln Val Leu Phe Gln Gly Leu Gln Ile Cys Ser Asn

835 840 845

Tyr Trp Ile Ala Trp Ala Ala Glu Arg Gln Glu Gln Val Ser Arg Glu

850 855 860

Lys Met Ile Gly Ile Phe Val Leu Leu Ser Ala Gly Ser Ser Val Phe

865 870 875 880

Ile Leu Gly Arg Ala Ile Val Leu Ser Thr Ile Ala Ile Glu Thr Ala

885 890 895

His Gln Phe Phe Leu Gly Met Thr Arg Ser Ile Phe Arg Ala Pro Ile

900 905 910

Asn Phe Phe Asp Ser Thr Pro Ser Ser Arg Ile Leu Asn Arg Ala Ser

915 920 925

Thr Asp Gln Ser Thr Val Asp Thr Asp Ile Pro Tyr Arg Leu Ala Gly

930 935 940

Leu Ile Phe Ala Leu Ile Gln Leu Leu Ser Ile Ile Phe Ile Met Ser

945 950 955 960

Gln Ile Ala Trp Pro Ile Phe Ile Leu Phe Ile Ile Ile Ile Ala Ile

965 970 975

Ser Thr Trp Tyr Gln Ser Tyr Tyr Ile Cys Ser Ala Arg Glu Leu Ala

980 985 990

Arg Met Val Gly Ile Arg Lys Ala Pro Val Leu His His Phe Ser Glu

995 1000 1005

Thr Val Ser Gly Ala Ala Thr Ile Arg Cys Phe Asn Gln Gly Glu Lys

1010 1015 1020

Phe Phe Arg Lys Ser Leu Ala Leu Ile Asp Asp Tyr Ser Arg Ile Thr

1025 1030 1035 1040

Phe His Asn Ser Ala Thr Ile Glu Trp Leu Cys Val Arg Ile Asn Phe

1045 1050 1055

Leu Phe Asn Leu Val Phe Phe Val Thr Leu Val Ile Leu Val Ser Met

1060 1065 1070

Pro Arg Asn Thr Ile Asp Pro Ser Leu Ala Gly Leu Ala Ala Thr Tyr

1075 1080 1085

Gly Leu Asn Leu Asn Val Leu Gln Ala Trp Val Ile Trp Asn Leu Cys

1090 1095 1100

Asn Val Glu Asn Lys Met Ile Ser Val Glu Arg Ile Leu Gln Phe Ser

1105 1110 1115 1120

Asn Ile Thr Ser Glu Ala Pro Leu Val Ile Glu Asp Cys Arg Pro Arg

1125 1130 1135

Glu Ser Trp Pro Trp Cys Gly Thr Ile Gln Ile Asp Ser Leu Gln Val

1140 1145 1150

Arg Tyr Asn Pro Asp Met Pro Met Val Leu Lys Gly Ile Ser Cys Thr

1155 1160 1165

Ile Pro Gly Glu Arg Lys Ile Gly Val Val Gly Arg Thr Gly Ser Gly

1170 1175 1180

Lys Ser Thr Leu Ile His Ala Leu Phe Arg Ile Val Glu Pro Ser Glu

1185 1190 1195 1200

Gly Arg Ile Leu Ile Asp Asp Val Asp Ile Ser Leu Leu Gly Val His

1205 1210 1215

Asp Leu Arg Ser Arg Leu Ser Val Ile Pro Gln Glu Pro Thr Leu Phe

1220 1225 1230

Gln Gly Thr Val Arg Thr Asn Leu Asp Pro Leu Gln Gln His Leu Asp

1235 1240 1245

Thr Glu Ile Trp Glu Val Leu His Lys Cys Arg Leu Glu Glu Ile Val

1250 1255 1260

Arg Glu Asp Ser Arg Leu Leu Asp Ala Pro Val Val Glu Asp Gly Gly

1265 1270 1275 1280

Asn Trp Ser Val Gly Gln Arg Gln Leu Val Cys Leu Ala Arg Val Leu

1285 1290 1295

Leu Met Lys Lys Lys Ile Leu Val Leu Asp Glu Ala Thr Ala Ser Val

1300 1305 1310

Asp Thr Ala Thr Asp Asn Ile Ile Gln Lys Thr Ile Arg Gln Glu Thr

1315 1320 1325

Asn Asn Cys Thr Val Ile Thr Ile Ala His Arg Ile Pro Thr Val Ile

1330 1335 1340

Asp Ser Asp Leu Val Leu Val Leu Gly Glu Gly Lys Ile Leu Glu Phe

1345 1350 1355 1360

Asp Ser Pro Glu Asn Leu Leu Arg Asp Glu Ser Ser Ala Phe Ser Lys

1365 1370 1375

Leu Val Met Glu Phe Val Gly Arg Ser Ser

1380 1385

<210> 2

<211> 8940

<212> DNA

<213> Rice (Oryza sativa)

<220>

<223> gDNA sequence of OsABCC2

<400> 2

gatcctgggt tcgactcccc atggaagtga attttccaga atttaacggc gctgtgcttt 60

cagtggtagg caatgtaccc gtcgacagcg agacgcatgt ggtgacttcg tcaatttatc 120

caggatttgc cggcccagtc ttcgaagatg ctcataaggg tagggtttac gtgcgtgtgt 180

ttataagggt gagtgcgcgt gcgttgtgag tgtctgcgtt gtattgtgta attcttaaaa 240

aaaaaaagag ctgtagccag tagcctgtaa aggctcccag cacgagaaag attcacagct 300

gcaggaaaat gacaagattt ggcaatctga tgatctgatc agaacggcgc cgcgccggca 360

tgtgcagata aaagagcatc gggattcacg ggcactgagt aaaagcagcg tcgggccctt 420

ttctagcacg aatctggatg ctacaggtat accaacagca aaacgactga aaaaaattgg 480

gtccaaacaa tatgcactac cacatatggt gccatggtcc tattctccgc tctttccttg 540

ccaaaaaagg ggcatcgatc gcgacatgca accaaggctc aagtcgtgat taaaaaaaac 600

atatagtcat tccagatcat taatctaaac aagaactact gcttgacggg aggaagtaaa 660

ataaatatca agcatgagac acatttccgg ctgcaacatc gaacaaataa aagaagggaa 720

agaaaagatg ctattgcatg tgttcagtaa ggcacgaaaa taaaatagaa caaaccgtag 780

tcctctcttg gtcaatggca atattgatcg taccgtgctt cctgaatcct tctcccgacc 840

gttttcatgg tcacatgcac ctgaaaaaga gaaactaaat agagaataaa gtgataatta 900

tcatcaaatc aacatgacac gacagtacca tccatccata cagaccacac acacaaaaaa 960

gaagacatta ccacttgcta atacaattga gatgtgcttc tatgctcctc agaaaaaaaa 1020

aagcacgaat gttaaagatg gtgaatggtc tagattaaaa ggtgattaac aggctaaacg 1080

ttattaggaa gggcaatttc gtccttgagg tagttaccca tatcccaaac gttcaatcct 1140

gatgcagcgc cgccccgact gccgccgcat tcgatcgcaa gtacaagaga aaaaaagaag 1200

gcattccatg attccaaaac agcgaatcct cctctgttcc ggctacacat gtgcagcacc 1260

tcaatccacc atttgattgg catccatgtt cttgccaaat caaaaaatga gatgggggta 1320

gagataagaa gcatgacaag aaaaatcaga aatgggcgaa ggcagggagc acgccgcggt 1380

agaccaacgg gacaggcggt gtggcgagag gaggaagaag ggggtggcgc agcaaaagta 1440

tacgggcgat gcacggtgga ggaagcgagc acgatcgctg agagtcatcg atttgtaact 1500

cctcatcggc tgatcgagta tgtgataact tcacaggaca aaattgcccc tccctaatga 1560

cttttactct gttaagcaac ttttaatcta aatcattcat gagctttaat atccgtgcag 1620

gtttttttag tgagaagcat agaagcacat cccaatacaa tttcttttaa gttcacctgc 1680

tactaaaaca tgttctgcga cgtggataat gaacagaaga taagataaaa ccacgaagta 1740

tgaaagttaa gcactcattt tcccattctt tcttcccaag tacatcactt atataaagta 1800

gcggatccag aaaaaaatag caggtatcct atacctatta atagtttact tatcaagtaa 1860

taatattgta attaacatgg ccaaaaacaa acatcctacc aggtgtcgtg tgccccaggc 1920

tctaggttct accttctctt ccacaaccac aaggtcctaa ccaaccaaat tggacgcatg 1980

tatgtgtctt tcgctcacct tctactcaca tgccgtcctc ttttgcattg gccacctcgg 2040

tagttcaatg atcatgcact cgatcgtaca gccgaaggac tcgatgcaag tgcacgcatg 2100

gtggacacat gcatgtctgc acagcacact gttggcagtt tccactgcca ccgagatgcc 2160

gctccaaagt tgccgatccg gcgtcaggat gccgtagcga gatttgatct ctgtgggcaa 2220

cttggattgg tgtcccggtt tgccatactt tctgtctgca tctcataaca tgttgcagat 2280

atagccattg cgtttggata aacacttcag ctgtagttac tacattttct ttatgctgca 2340

gctcaaggta ccttggaggc ccggacatgg aaatggaatc tcaaaaatca tggatatgtc 2400

tttttaaaga tcagagcact tcttgtcgtg aacgagttga ttgcaggtcc gattaaaaag 2460

aggagatccc aagtccagat cctataagtc atatgcaatc aggttctcct tttggtctgc 2520

tcttatcggc tctgcactcc tcactttgtt tgctggctct ctttcaagtt tgccttagcc 2580

ctagactctt gccttgctcc aatgtaacag tgcagttcct gtcatcttgg tgttctgttt 2640

ctctctgcca taagcccatt atccgtctgg tgatttcggc attggatgga gaccttagca 2700

gtattggatt atgtccgcat agcatcgttc gctatcttgc tggtttggat ccttgcagag 2760

cttgccaggc tgaacaagag acatcgccga gaaggacatg gcgacatggt ttcatcacaa 2820

agaaaagggg aagtcctgct accagcttat ataattgtac tttgcaatgc ttcaatctcc 2880

ttgatgcata tttgtttttc tgttcttgtg ttctggaagc gccaaactgt ctccctggat 2940

ttgatcttca aatcagtctc atggcttcta gtgactctct tcttgctcta ctgcaaacat 3000

gaaggtgcag gagttgtatc caactggcct tcagttcttc tctcgtggtg gttcttcagc 3060

ttcttatccg aatcacttct cacttcgttg catttgcttc acctcttcaa ctctgcaact 3120

gttgtcgatt tcacttctct tcccttgtgc acattcatct gcctcgtggc agtaactatg 3180

agaccttcca aagcaaacca gcaagaccag aaccaaccgc tgcttgtgag agaagacagt 3240

gatgacagta gcacagacag gttctccaac tccgggtggt ggagctgcct cacattccag 3300

tggttaaacc caatctttga gaagggacac aaggtgcgtc ttgagctcga ccatatccca 3360

tctgttccac agtctgacac ggcaaaccaa tcttatgcat tgcttcaaga gacacttcac 3420

aagcagaaac ctgagccaat gcctatgcgg agagccatta tttgtgctgt ctggacacct 3480

ttgatcgcca atggagtctt tgcaggttag tgagccattg gaagaacaaa agtggagcta 3540

ccctttgacc tttatattat actaacatga tgctttgcat ttattaccag ggcttaacac 3600

tattgcttcc tatatggggc cattcttgat cacctactta gtggagctac tctctgacaa 3660

gaatcctgac aagggccatg gccatggcta catgctagca tgccttttct ttgcctcaaa 3720

gacagtggag tcactttcac agcggcaatg gtattttggt gcccgcagga ttggtttccg 3780

ggtgcgtgca gcactgatgg tatccatcta tcagaaatcc ctgctgatga agaactcaag 3840

cacagccagc gggaaaattg tgaacttcct cgatgtcgat gttgagaagg ttagcgaatt 3900

cttctggtac gtacatagaa tttggctgct acccttgcaa atatccttgg cacttgccat 3960

tctctaccgt agccttggtg caatggcctc gctgtctgca gtccttgcaa cagttttggt 4020

tatggtgagc aacacaccac ttgcaaagtc acaggagaac ctcaacatga agatcatgga 4080

agcgaaggac tcacggataa aggctatggc tgaagcaatg aagagtatga ggatattgaa 4140

gctgcatgca tgggagacag cttactttga caagctactg aatctaaggg atgtggagag 4200

gggatggctc aggaaatatc tctacacatg ttcagcaatt gccttcctgt tttgggcctc 4260

accgaccttg gtgtcggttg tcacatttgg tgtatgtatt cttgtggaga tgccattatc 4320

agctggaaca gtcttatccg ccgttgccac gttcagaatc ctccaagatc caatctacaa 4380

cctcccagag ctcgtttcaa tggtcacaca aaccaaggtg tccctagata gaattgaaga 4440

gttcatcaaa gaagaacacc aggggaagcc aagtcgttct gacaataaca ctaggactaa 4500

ggacctgtct atgactggtg caatggaaat tgaaccaggg gtatatggtt gggaaattga 4560

caatagcttg aagaagacaa aattcatgct taagattgac agaaagctga gcatcagcaa 4620

gggtcaaaag gttgcagtgt gcgggccagt tggttctggt aaatcaagcc tcctttacag 4680

catcatgggg gagatcccaa ggattaatgg tgcagaaaca acagtttttg ggtcaagggc 4740

atatgttgcg cagagtgcat ggattcagac tgggacaatt caagacaatg tgctctttgg 4800

gaaggatatg gacagaagct tctatgagga ggtgctgcat ggttgtgctt tggatagaga 4860

tttggagtta tgggccaatg gtgatatgac tatggtaggg gagaggggca tgaacctgag 4920

tggaggccag aagcagagga ttcagcttgc cagagcattg tatagtgatt ctgatgttta 4980

cctcttagat gatcccttca gtgccgtgga tgcacacacc ggagcacatc tcttcaaggt 5040

acagtacatg agaaatctgc aacagtttag ctgtaatgag cttcaaatga aatgtacaat 5100

aatgttacag cacaaaggca caaagcaaga accataatca aaacaggaaa acacaaaagt 5160

attccaccca ttagacaatc tgcaaattat ctataagcaa tcaagtacca aatctaatta 5220

gtaaccgcaa atggcttact cactgaatcg tgagatcatc agcacaaata tttcttcaat 5280

ttgtgaaata aactaattca tattttgcat ctgcaggaat gtttactgag gctaatgtcc 5340

tctaagacag tcatatatgt tactcatcag ctagagttct tgagagatgc agatcttgtt 5400

ctggtaaggt atcaactcaa tttcaacatg ttactaattt taacttgtga taaaatggtt 5460

ggtaattgtt agctttaggt caaataaaat ggctatattg ttgtaaatat cttaatttga 5520

gcagctgcta gggatgcaag tgggtcatat tggactttgg tcagcccatt gatgcatcct 5580

agtccctttg cttgaccatt aatgcaagtg ccacacgtgc aaaataaaca tccaactaaa 5640

tgggaagcga accactaagt gggtgggttt tgtatccttc aaacctgtca caagctgtca 5700

tatttcattt ttgcaataat tactaagaac atacatgtag agttatatgg tctaacatat 5760

gattgcaaat gtccaactgt aggtcatgaa agatggaagg attgttcaat ccggaaaata 5820

tgatgatttg gtagcagaca ggaatggaga actctcaatg caaatggctg cacataacca 5880

atcccttagt caggtcacac ctgcaaaagc acatgtcttg actaaaaata agagtcacaa 5940

gagaaggcag actgagctca cagaaataga attagatcac aatgtaatag gcagggaatg 6000

cgaggaggag cgcgaatctg gaagagttaa atgggatatt tatcgcaagt ttgtcaactc 6060

tgcatatggc ggagctctcg ttcctgttat tcttgcatgc caagtccttt tccagggatt 6120

gcagatatgt agcaactatt ggattgcatg ggcagctgag aggcaggaac aagtaagcag 6180

ggagaagatg ataggtatct ttgtgctgtt atcagctgga agttctgtgt ttatattggg 6240

aagagctatt gtcctttcaa cgattgccat tgaaactgct catcagttct tcttaggcat 6300

gaccaggagt atttttcgag caccaatcaa cttctttgac tccactccat caagtagaat 6360

cctcaatagg gtgagccaac tacctcttca tttgaatatc gtaataaaaa cgccccttac 6420

ttccagttct cacggcttag ttttctgctt tgcaggcttc aacagatcaa agcacagttg 6480

acacagacat tccctacagg cttgcagggc ttatcttcgc attaattcag ctcctcagta 6540

ttattttcat catgtctcaa attgcctggc ctatattcat tctattcata attataattg 6600

ccatctctac ttggtatcag gtacaccttc attcattgca atatgttttc ctcaggtttg 6660

aaaatgctag taatttgtaa aaacttcatg cagagctatt acatctgttc agctagagaa 6720

ctagcaagga tggttggcat aagaaaagct ccagtcctcc accatttttc agagactgta 6780

tcaggagcag caactattag atgctttaat cagggagaga agttcttcag gaagagtctt 6840

gcgctaattg atgactactc ccgcatcact ttccacaatt cagcaacaat tgaatggtta 6900

tgtgttcgca tcaacttcct cttcaacctt gtcttctttg tgacgctagt catccttgtc 6960

tcaatgcctc gaaatactat tgatccaagt aagcgttccc atgaaaaaat agtatcgtat 7020

ctaacagcta taattagatc tgcagtcttg cattgcattc ctgcttattc tttttggtaa 7080

aacagtgttt gttgttacaa aaaaaaaaaa ggatttacag agaaaccatg tggttgtatt 7140

ttacgttttt cagaaaccct aaatgtgtaa ctctacagta ctttgataaa tcacaatatt 7200

attacatggc tataaactct aacccatttt ggttttctcc ttgtttaggc ctcgcagggc 7260

tggcagctac ctatggcctt aaccttaatg tgttacaagc atgggtcata tggaatctgt 7320

gcaacgttga gaacaaaatg atttcagtag aaagaatttt gcagttctca aacataacaa 7380

gtgaggcccc tttagtcatt gaggactgta gaccaagaga atcatggccc tggtgtggaa 7440

ccattcagat cgattctctc caagtgaggt acaacccgga catgccaatg gtgctcaaag 7500

gcataagctg cacaattccc ggagaaagga aaattggggt ggtaggacgg acagggagtg 7560

ggaaatcgac tctaattcac gccttgtttc ggattgttga accatctgaa ggacggatac 7620

tcatagatga tgttgatata tcgcttttgg gagtgcatga tctgcggtca agattaagtg 7680

ttataccaca agaaccgact cttttccaag ggacagtcag aacaaacctg gatcctctac 7740

agcagcatct ggacactgaa atatgggagg taaacaatct ataaaatata gtgctgtgaa 7800

gatgctcttc caaatgaaat ttctttaagt gtctatagct gttataggtt ttcaagaaag 7860

cagttaacaa tttaaagaca gcttccttta tcgagtctag tgctgatttt tcccccccat 7920

cttttaggtt ttgcataagt gccgccttga ggagattgtg agagaagaca gtagattgtt 7980

ggatgcacca ggtatgaaga actatctttc cttgcagcag ttttaattct cacgttccaa 8040

attccttgct cgagatggac aagttatatg actaaagttt gatgttgcag ttgttgaaga 8100

tgggggaaac tggagcgtag gacaaaggca acttgtatgc ttggccaggg tattgctaat 8160

gaagaagaaa atacttgttc tggatgaagc cacagcatcg gttgataccg caacagataa 8220

tatcatccaa aagactataa ggcaagagac aaacaattgc acagttatta caattgcaca 8280

taggattcct actgtgattg acagtgacct tgttcttgtc ctaggtgaag gtaaaagata 8340

tccacgaata acccatgttt ttcctttggt tcaacaaaag caattctaat ttataaaaaa 8400

ctatattaag cgatggaagt acctttttta ttgttcgtac tgcaggtaag atactagagt 8460

ttgattctcc agaaaatctc ctcagagatg aatcatcagc tttctcaaag ctggtgatgg 8520

aattcgtggg aagatcatca tagggtagac atcaaccaga gttaacatag agatatcaag 8580

cagccaccaa cctacttaac tccatctaga cttgtattta tcaacattga aactaacagg 8640

gcatgaagaa ggtttacgag tggacagcag gcatcagaag tacagaagga aattttggtt 8700

taagtgaaga ctatgctagc attagatact gatcttttcc tgatctagcc cttaccaatt 8760

ggacagttgc tgaatggtgt tcatattata ttggcaatgc aagtgatctt agatagattc 8820

atattctttt ccaccaacta ctagatcaaa ataaattgta gccttaatta tattcaccaa 8880

atcattcgtt gttgatttgt ttggataacc ggggtatttt ttatattggt tgtcacagta 8940

<210> 3

<211> 4161

<212> DNA

<213> Rice (Oryza sativa)

<220>

<223> cDNA sequence of OsABCC2

<400> 3

atggccaaaa acaaacatcc taccaggtgt cgtgtgcccc aggctctagc tcaaggtacc 60

ttggaggccc ggacatggaa atggaatctc aaaaatcatg gatatgtctt tttaaagatc 120

agagcacttc ttgtcgtgaa cgagttgatt gcaggtgcag gagttgtatc caactggcct 180

tcagttcttc tctcgtggtg gttcttcagc ttcttatccg aatcacttct cacttcgttg 240

catttgcttc acctcttcaa ctctgcaact gttgtcgatt tcacttctct tcccttgtgc 300

acattcatct gcctcgtggc agtaactatg agaccttcca aagcaaacca gcaagaccag 360

aaccaaccgc tgcttgtgag agaagacagt gatgacagta gcacagacag gttctccaac 420

tccgggtggt ggagctgcct cacattccag tggttaaacc caatctttga gaagggacac 480

aaggtgcgtc ttgagctcga ccatatccca tctgttccac agtctgacac ggcaaaccaa 540

tcttatgcat tgcttcaaga gacacttcac aagcagaaac ctgagccaat gcctatgcgg 600

agagccatta tttgtgctgt ctggacacct ttgatcgcca atggagtctt tgcagggctt 660

aacactattg cttcctatat ggggccattc ttgatcacct acttagtgga gctactctct 720

gacaagaatc ctgacaaggg ccatggccat ggctacatgc tagcatgcct tttctttgcc 780

tcaaagacag tggagtcact ttcacagcgg caatggtatt ttggtgcccg caggattggt 840

ttccgggtgc gtgcagcact gatggtatcc atctatcaga aatccctgct gatgaagaac 900

tcaagcacag ccagcgggaa aattgtgaac ttcctcgatg tcgatgttga gaaggttagc 960

gaattcttct ggtacgtaca tagaatttgg ctgctaccct tgcaaatatc cttggcactt 1020

gccattctct accgtagcct tggtgcaatg gcctcgctgt ctgcagtcct tgcaacagtt 1080

ttggttatgg tgagcaacac accacttgca aagtcacagg agaacctcaa catgaagatc 1140

atggaagcga aggactcacg gataaaggct atggctgaag caatgaagag tatgaggata 1200

ttgaagctgc atgcatggga gacagcttac tttgacaagc tactgaatct aagggatgtg 1260

gagaggggat ggctcaggaa atatctctac acatgttcag caattgcctt cctgttttgg 1320

gcctcaccga ccttggtgtc ggttgtcaca tttggtgtat gtattcttgt ggagatgcca 1380

ttatcagctg gaacagtctt atccgccgtt gccacgttca gaatcctcca agatccaatc 1440

tacaacctcc cagagctcgt ttcaatggtc acacaaacca aggtgtccct agatagaatt 1500

gaagagttca tcaaagaaga acaccagggg aagccaagtc gttctgacaa taacactagg 1560

actaaggacc tgtctatgac tggtgcaatg gaaattgaac caggggtata tggttgggaa 1620

attgacaata gcttgaagaa gacaaaattc atgcttaaga ttgacagaaa gctgagcatc 1680

agcaagggtc aaaaggttgc agtgtgcggg ccagttggtt ctggtaaatc aagcctcctt 1740

tacagcatca tgggggagat cccaaggatt aatggtgcag aaacaacagt ttttgggtca 1800

agggcatatg ttgcgcagag tgcatggatt cagactggga caattcaaga caatgtgctc 1860

tttgggaagg atatggacag aagcttctat gaggaggtgc tgcatggttg tgctttggat 1920

agagatttgg agttatgggc caatggtgat atgactatgg taggggagag gggcatgaac 1980

ctgagtggag gccagaagca gaggattcag cttgccagag cattgtatag tgattctgat 2040

gtttacctct tagatgatcc cttcagtgcc gtggatgcac acaccggagc acatctcttc 2100

aaggaatgtt tactgaggct aatgtcctct aagacagtca tatatgttac tcatcagcta 2160

gagttcttga gagatgcaga tcttgttctg gtcatgaaag atggaaggat tgttcaatcc 2220

ggaaaatatg atgatttggt agcagacagg aatggagaac tctcaatgca aatggctgca 2280

cataaccaat cccttagtca ggtcacacct gcaaaagcac atgtcttgac taaaaataag 2340

agtcacaaga gaaggcagac tgagctcaca gaaatagaat tagatcacaa tgtaataggc 2400

agggaatgcg aggaggagcg cgaatctgga agagttaaat gggatattta tcgcaagttt 2460

gtcaactctg catatggcgg agctctcgtt cctgttattc ttgcatgcca agtccttttc 2520

cagggattgc agatatgtag caactattgg attgcatggg cagctgagag gcaggaacaa 2580

gtaagcaggg agaagatgat aggtatcttt gtgctgttat cagctggaag ttctgtgttt 2640

atattgggaa gagctattgt cctttcaacg attgccattg aaactgctca tcagttcttc 2700

ttaggcatga ccaggagtat ttttcgagca ccaatcaact tctttgactc cactccatca 2760

agtagaatcc tcaatagggc ttcaacagat caaagcacag ttgacacaga cattccctac 2820

aggcttgcag ggcttatctt cgcattaatt cagctcctca gtattatttt catcatgtct 2880

caaattgcct ggcctatatt cattctattc ataattataa ttgccatctc tacttggtat 2940

cagagctatt acatctgttc agctagagaa ctagcaagga tggttggcat aagaaaagct 3000

ccagtcctcc accatttttc agagactgta tcaggagcag caactattag atgctttaat 3060

cagggagaga agttcttcag gaagagtctt gcgctaattg atgactactc ccgcatcact 3120

ttccacaatt cagcaacaat tgaatggtta tgtgttcgca tcaacttcct cttcaacctt 3180

gtcttctttg tgacgctagt catccttgtc tcaatgcctc gaaatactat tgatccaagc 3240

ctcgcagggc tggcagctac ctatggcctt aaccttaatg tgttacaagc atgggtcata 3300

tggaatctgt gcaacgttga gaacaaaatg atttcagtag aaagaatttt gcagttctca 3360

aacataacaa gtgaggcccc tttagtcatt gaggactgta gaccaagaga atcatggccc 3420

tggtgtggaa ccattcagat cgattctctc caagtgaggt acaacccgga catgccaatg 3480

gtgctcaaag gcataagctg cacaattccc ggagaaagga aaattggggt ggtaggacgg 3540

acagggagtg ggaaatcgac tctaattcac gccttgtttc ggattgttga accatctgaa 3600

ggacggatac tcatagatga tgttgatata tcgcttttgg gagtgcatga tctgcggtca 3660

agattaagtg ttataccaca agaaccgact cttttccaag ggacagtcag aacaaacctg 3720

gatcctctac agcagcatct ggacactgaa atatgggagg ttttgcataa gtgccgcctt 3780

gaggagattg tgagagaaga cagtagattg ttggatgcac cagttgttga agatggggga 3840

aactggagcg taggacaaag gcaacttgta tgcttggcca gggtattgct aatgaagaag 3900

aaaatacttg ttctggatga agccacagca tcggttgata ccgcaacaga taatatcatc 3960

caaaagacta taaggcaaga gacaaacaat tgcacagtta ttacaattgc acataggatt 4020

cctactgtga ttgacagtga ccttgttctt gtcctaggtg aaggtaagat actagagttt 4080

gattctccag aaaatctcct cagagatgaa tcatcagctt tctcaaagct ggtgatggaa 4140

ttcgtgggaa gatcatcata g 4161

<223> molecular marker detection primer F of OsABCC2

<400> 4

aaagtgagga gtgcagagcc 20

<223> molecular marker detection primer R of OsABCC2

<400> 5

caggatgccg tagcgagatt 20

<223> F1

<400> 6

atggccaaaa acaaacatcc tacca 25

<223> R1

<400> 7

ctatgatgat cttcccacga attcc 25

<223> primer 1

<400> 8

acccggggat cctctagagt cgaatggcca aaaacaaaca tcctacca 48

<223> primer 2

<400> 9

atgatacgaa cgaaagctct gcactatgat gatcttccca cgaattcc 48

<223> F2

<400> 10

gatcctgggt tcgactcccc atgga 25

<223> R2

<400> 11

tactgtgaca accaatataa aaaat 25

<223> primer F for amplifying OsABCC2 gene

<400> 12

atggaagcga aggactc 17

<223> primer R for amplifying OsABCC2 gene

<400> 13

caaatgtgac aaccgaca 18

<223> primer F for amplifying internal reference UBQ2

<400> 14

gcatctctca gcacattcca 20

<223> amplification of primer R of internal reference UBQ2

<400> 15

accacaggta gcaataggta 20

<223> target sequence

<400> 16

gtcttggagg cc 12

<223> F3

<400> 17

ggcaaaagtg aggagtgcag agcc 24

<223> R3

<400> 18

aaaccaggat gccgtagcga gatt 24

<223> F4

<400> 19

aaagtgagga gtgcagagcc 20

<223> R4

<400> 20

caggatgccg tagcgagatt 20

<223> F5

<400> 21

tcagatctcg agctcaagct tcatggccaa aaacaaacat cc 42

Column (Artificial Sequence)

<223> R5

<400> 22

ccttgctcac catcaggatc cctatgatga tcttcccacg a 41

Claims

1. Rice geneOsABCC2The application of the rice gene in regulating the absorption and transportation of pesticides is characterized in that the rice geneOsABCC2The encoded protein has the amino acid sequence of the following A:

A. as shown in SEQ ID NO: 1;

the pesticide is systemic pesticide;

the regulation of pesticide absorption and transport is over-expressionOsABCC2The gene is used for improving the absorption and the transportation of the pesticide by the rice;

the pesticide is one of neonicotinoid pesticide, amide pesticide, organophosphorus pesticide or carbamate pesticide.

2. The rice gene according to claim 1OsABCC2The application of the rice gene in regulating the absorption and transportation of pesticides is characterized in that the rice geneOsABCC2The nucleotide sequence is any one of the following C to D:

C. as shown in SEQ ID NO: 2;

D. as shown in SEQ ID NO: 3.

3. A rice gene comprising the rice gene of claim 1 or 2OsABCC2The recombinant vector, the expression cassette, the transgenic cell line or the recombinant strain are applied to the regulation of the absorption and the transportation of pesticides;

4. Rice geneOsABCC2The application of the molecular marker detection primer in identifying the rice varieties which efficiently utilize the pesticide is characterized by comprising the following steps: the molecular marker detection primer is used for detecting the water to be detectedAmplifying germplasm genome DNA or RNA of the rice variety, and judging the sensitivity of the target variety in response to pesticide treatment through the change of gene expression level;

the selected pesticide is systemic pesticide;

the pesticide is one of neonicotinoid pesticide, amide pesticide, organophosphorus pesticide or carbamate pesticide;

the rice geneOsABCC2The molecular marker detection primer is composed of a primer shown as SEQ ID NO: 4 and SEQ ID NO: 5, the upstream primer and the downstream primer consist of:

F: 5'-AAAGTGAGGAGTGCAGAGCC-3'；

R: 5'-CAGGATGCCGTAGCGAGATT-3'。

5. the rice gene according to claim 1 or 2OsABCC2The application in cultivating the transgenic rice with high-efficiency pesticide utilization is characterized by comprising the following steps: the rice gene is usedOsABCC2Constructed on a plant expression vector, and the obtained recombinant expression vector is transferred into rice for expression to obtain a rice variety which efficiently utilizes pesticides;

6. The rice gene according to claim 5OsABCC2The application of the protein in cultivating the transgenic rice efficiently utilizing the pesticide is characterized in that:

the plant expression vector is pCAMBIA 2300-35S;

the obtained recombinant expression vector is transferred into rice for expression, and the obtained recombinant plant expression vector is transferred into plant cells or tissues by a biological method of agrobacterium mediation, plant virus vector, direct DNA transfer and conductance transfer.

7. The rice gene according to claim 1 or 2OsABCC2The application in reducing the height of rice plants.