CN114085854B

CN114085854B - Drought-resistant and salt-tolerant gene OsSKL2 for rice and application thereof

Info

Publication number: CN114085854B
Application number: CN202111540270.8A
Authority: CN
Inventors: 武健东; 刘雨晴; 李爱琪; 蒋迎利; 章琴
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2021-12-16
Filing date: 2021-12-16
Publication date: 2023-11-17
Anticipated expiration: 2041-12-16
Also published as: CN114085854A

Abstract

The application discloses a drought-resistant and salt-tolerant gene OsSKL2 of rice and application thereof, and relates to the technical field of genetic engineering, wherein the gene has a nucleotide sequence shown as SEQ ID NO. 1. The gene can regulate and control the survival rate of rice under drought and high salt, and has positive regulation and control effects on rice drought and high salt; the gene provides direct evidence for the regulation and control effect of shikimic acid in abiotic stress, provides a new research approach for improving abiotic stress of crops, and has important theoretical and practical significance for cultivating drought-resistant and salt-resistant materials.

Description

Drought-resistant and salt-tolerant gene OsSKL2 for rice and application thereof

Technical Field

The application relates to the technical field of genetic engineering, in particular to a drought-resistant and salt-tolerant gene OsSKL2 for rice and application thereof.

Background

Rice is the main food crop in the world, and provides ration for more than half of the population in the world. However, as the population grows, environmental conditions worsen, and cultivated land area decreases, there is an increasing conflict between demand for food and increased population. At present, the main environmental factors causing the decrease of rice yield are drought and soil salinization. The rice planting area and yield which are statistically dependent on the traditional flooding irrigation mode account for about 55% and 75% of the total area and total yield of the world rice. In recent years, grain yield reduction caused by drought and soil salinization presents an aggravated trend, and the grain safety production is threatened. Therefore, the method for excavating drought-resistant and salt-resistant genes and analyzing the action mechanism thereof is an important target for biotechnology breeding, and has important significance for guaranteeing high and stable yield of rice and grain safety production.

In order to adapt to the change of external environment, plants have evolved various ways and regulation mechanisms in the long-term evolution process to cope with environmental stimulus so as to ensure normal growth and development. Studies have shown that stress receptors located on plant cell surfaces (e.g., cell walls, plasma membranes) and organelles (e.g., cytoplasm, nucleus) capture external stress signals and rapidly transfer stimulus signals to intracellular influencing second messengers (e.g., ca) ²⁺ ROS, NO, phospholipids, etc.), thereby altering expression of regulatory genes and transcription factors. The transcription factor induces plant protection mechanism such as detoxification and stress restoration reaction through combining and regulating the expression of downstream functional genes to ensure the normal growth of plants. The corn transcription factor ZmbHLH124 directly binds and activates the expression of ZmDREB2A, thereby improving the drought tolerance of corn. In rice, osMYB3R-2 is regulated and controlled by OsCycB1;1 and OsKNOLE 2, reduces the sensitivity of ABA, and enhances the resistance of rice to cold, high salt and drought. Although there are few reports on drought salt tolerance genes of plants, little is known about functional major genes whose primary and secondary metabolic pathways are directly involved in drought high salt stress.

Shikimic acid cycle is widely present in plants and microorganisms, is an important hub linking carbohydrate metabolism and secondary metabolism, and provides a substrate for other secondary metabolism. The shikimate pathway is a biochemical reaction catalyzed by a variety of metabolic enzymes, the products of which are phenylalanine, tyrosine and tryptophan. Wherein Shikimate Kinase (SK) is the fifth reaction of catalyzing shikimate pathway, and the encoding genes of SK in rice are SK-1, SK-2, SK-3 and SKL1, SKL2. The formation of SK1 and SK2 and chloroplasts was found to be closely related to development. Although studies have shown that shikimic acid content varies significantly under drought and high salt conditions, there is no direct evidence of how to regulate drought and high salt stress responses, and its functional genes are unclear. Therefore, a drought-resistant and salt-tolerant gene OsSKL2 of rice and application thereof are provided.

Disclosure of Invention

The application aims to overcome the defects of the prior art and provides a drought-resistant and salt-tolerant gene OsSKL2 for rice and application thereof.

The application realizes the above purpose through the following technical scheme:

the application provides a drought-resistant and salt-tolerant gene OsSKL2 of rice, which has a nucleotide sequence shown as SEQ ID NO.1 and has a total length of 1128bp.

The application also provides application of the drought-resistant and salt-tolerant gene OsSKL2 in improving drought resistance and salt tolerance of rice.

The gene OsSKL2 has positive regulation and control effects on drought resistance and salt tolerance of rice, and the over-expression transgenic rice plant can improve the survival rate of rice under drought and high salt, while the survival rate of RNAi silent transgenic rice plant under drought and high salt is obviously reduced

The application also provides a coded protein of the drought-resistant and salt-tolerant gene OsSKL2 of the rice, and the coded protein has an amino acid sequence shown as SEQ ID NO. 2.

A further improvement is that the protein is positioned in chloroplast, is induced to express by drought and high salt, and the encoded shikimate kinase is a key metabolic enzyme for catalyzing shikimate pathway.

The application also provides a plasmid vector which is obtained by inserting the drought-resistant and salt-resistant gene OsSKL2 of rice into a pEASY-T1 vector.

The application also provides a genetically engineered host cell, which is the escherichia coli competent Trans5 alpha cell of the plasmid vector.

The application also provides a method for obtaining the drought-resistant and salt-tolerant gene OsSKL2 of rice, which comprises the steps of designing a specific amplification primer by taking a nucleotide sequence of an OsSKL2 gene as a template, taking a rice Japanese variety as a material, extracting RNA, reversely transcribing the RNA into cDNA, and obtaining the gene OsSKL2 by a PCR amplification technology.

The further improvement is that the specific amplification primers of the PCR amplification are as follows:

SKL2–F-1：ATGAGGATAGGGGCAGGGGCGAACA；

SKL2–R-1：TCAGATATTGGTCGGTGGGGCGTCG。

the application also provides an over-expression vector which is a pCAMBIA1301 plant expression vector with a 35S promoter, the gene OsSKL2 and the NOS terminator sequentially connected to a multiple cloning site region.

The application also provides a subcellular localization vector, which is obtained by cutting the gene OsSKL2 and pCAMBIA1305 vector by SpeI and BamHI at the same time and then connecting, specifically pCAMBIA1305-SKL2, wherein the connection is carried out by using the following upstream and downstream primers:

OsSKL2-F：ATGTTGGCCTCCACTTGCTTCTCCG；

OsSKL2-R：TATGTTGGTGGGTGGTGCGTCGGA。

the application has the following beneficial effects:

compared with the prior art, the application has the following advantages: the application provides a drought-resistant and salt-tolerant gene OsSKL2 of rice and application thereof, wherein the gene can regulate and control the survival rate of the rice under drought and high salt, and has positive regulation and control effects on the drought and high salt of the rice; the gene provides direct evidence for the regulation and control effect of shikimic acid in abiotic stress, provides a new research approach for improving abiotic stress of crops, and has important theoretical and practical significance for cultivating drought-resistant and salt-resistant materials.

Drawings

FIG. 1 is a diagram of RNAi silencing vector pEASY-T1;

FIG. 2 is a map of the overexpression pCAMBIA1301 vector;

FIG. 3 is a high-salinity drought-induced expression pattern of OsSKL 2; respectively treating the flowers in the wild rice with the size of four weeks by using a 100mM mannitol solution and a 200mM NaCl solution for 11 hours, and then sampling and analyzing;

FIG. 4 is a chart of OsSKL2 subcellular localization analysis;

FIG. 5 is a molecular characterization of OsSKL2 over-expression and RNAi silencing lines; WT is wild type, OE3, OE6 are over-expressed transgenic plants, ri6, ri9 are silent transgenic plants;

FIG. 6 is a phenotype diagram and a survival rate statistical diagram of OsSKL2 transgenic rice under normal and salt treatment; FIG. 6a shows the phenotype of wild type and transgenic plants under high salt treatment, and FIG. 6b shows the germination rate statistics. The wild type and the transgenic rice plants with the size of four weeks are respectively treated by 120mM and 140mM NaCl, the WT is the wild type plant, the OE3 and the OE6 are the over-expressed transgenic plants, and the Ri6 and the Ri9 are the silent transgenic plants;

FIG. 7 is a phenotype diagram and a survival rate statistical diagram of OsSKL2 transgenic rice under normal and drought treatment; FIG. 7a is a phenotype of wild type and transgenic plants under drought treatment and FIG. 7b is a statistical plot of germination rate. Four-week-sized wild type and transgenic rice plants were each subjected to 20% peg treatment, WT wild type plants, OE3, OE6 over-expressed transgenic plants, ri6, ri9 silent transgenic plants.

Detailed Description

The present application will be described in further detail with reference to the accompanying drawings, wherein it is to be understood that the following detailed description is for the purpose of further illustrating the application only and is not to be construed as limiting the scope of the application, as various insubstantial modifications and adaptations of the application to those skilled in the art can be made in light of the foregoing disclosure.

1. Material

The methods used in this example are conventional methods known to those skilled in the art unless otherwise indicated, and the materials such as reagents used are commercially available products unless otherwise indicated.

2. Method of

2.1 obtaining of OsSKL2 Gene

Selecting a rice Japanese sunny variety, extracting RNA, reversely transcribing the RNA into cDNA, taking the rice cDNA as a template, designing primers SKL2-F-1 and SKL2-R-1 according to an OsSKL2 gene sequence and a rice genome database and combining multiple cloning sites of a plant expression vector, and carrying out PCR amplification to obtain a PCR amplification product.

The primer sequences are as follows:

SKL2–F-1：ATGAGGATAGGGGCAGGGGCGAACA；

SKL2–R-1：TCAGATATTGGTCGGTGGGGCGTCG；

the PCR reaction procedure was: pre-denaturation at 98 ℃ for 10min; denaturation at 98℃for 20s; annealing at 65 ℃ for 20s; extending for 2min at 72 ℃ for 30 cycles; renaturation is carried out for 10min at 72 ℃; preserving at 10 ℃.

The PCR amplified product was detected by agarose gel electrophoresis with a mass ratio of 2%, and the target fragment was recovered and ligated to pEASY-T1 vector (purchased from full-scale gold biotechnology Co., ltd., carrier pattern shown in FIG. 1) to obtain a ligation product. The ligation product was transformed into E.coli competent Trans5α cells to extract plasmids. And (3) taking the extracted plasmid as a template, taking SKL2-F-1 and SKL2-R-1 as primers for PCR amplification verification, simultaneously detecting by using Kpn I and Pst I double enzyme digestion plasmids, screening positive clones, sending the positive clones to Hua Dada biological company for sequencing, and comparing the sequencing results by using sequencer software, wherein the results are consistent with predictions. The obtained recombinant plasmid was designated as T-SKL2.

2.2 construction of OsSKL2 Gene overexpression vector and silencing expression vector

The modified vector p1 was obtained by using pCAMBIA1301 (purchased from Shanghai Jielan Biotechnology Co., ltd., vector map shown in FIG. 2) as the original vector, ligating a 35S promoter between EcoRI and SacI cleavage sites of its multiple cloning site, and adding a NOS terminator between SphI and HindIII cleavage sites. The target gene fragment is obtained by double-enzyme cutting of T-SKL2 by Kpn I and PstI, and the carrier fragment is obtained by double-enzyme cutting of p1 by KpnI and PstI, and T is used for the two fragments ₄ And (3) connecting by using a ligase, and constructing and obtaining a vector p1-OsSKL2 serving as an OsSKL2 gene over-expression vector for transferring rice. Using rice cDNA as template, using OsSKL2 specific primer to amplify partial OsSKL2 gene fragment, using BamHI and HindIII double enzyme to make the product respectively cut, cloning into pRNAi-Ubi carrier cut by same enzyme and converting TOP10 competent cell, using antibiotic (kanamycin) and PCR screening to obtain the invented target fragmentAnd (3) an intermediate recombinant plasmid which is assembled successfully. Amplifying the intermediate recombinant plasmid by using a vector specific universal primer RNAi-Pst/RNAi-Mlu, cloning the product into the same digested intermediate recombinant plasmid after double digestion by using PstI and MluI, converting DH10B competent cells, and completing construction of pRNAi-ubi SKL2 transformation vector by kanamycin LB plate screening\PCR\digestion and sequencing identification. pRNAi-ubiSKL2 is subjected to single digestion by BamH I, cloned into pRNAi-IP subjected to same digestion (pRNAi-IP vector subjected to alkaline phosphatase treatment) and transformed into DH10B competent cells, and then construction of pRNAi-IP-SKL2 vector is completed through kanamycin LB plate screening, enzyme digestion detection and sequencing identification.

2.3 analysis of inducible expression Pattern of OsSKL2

Respectively treating flowers 11 in wild rice with the size of four weeks by using a mannitol solution and a NaCl solution with the size of 200mM, selecting roots and leaves of the rice after 12 hours of treatment, extracting RNA of the rice, respectively obtaining cDNA of the rice by reverse transcription, and determining the expression quantity of the roots and leaves after treatment by qRT-PCR.

The quantitative primers were designed as follows:

SKL2-F:TTGGCTTCGGAAGGAGTGGATT

SKL2-R:TTCCCGAGCTCACACTTCTACG

the qPCR reaction procedure was: pre-denaturation at 94 ℃ for 5min; denaturation at 94℃for 20s; annealing at 60 ℃ for 20s;72℃and 1min for 30 cycles. The results were plotted.

The result is shown in figure 3, the gene OsSKL2 is subjected to significant induction expression of drought and high salt.

2.4 subcellular localization analysis of OsSKL2

First, construct pCAMBIA1305-SKL2 vector. The SKL2 and p1305 vectors were cut with SpeI and BamHI simultaneously, then the target bands were recovered by gel electrophoresis, and then the pCAMBIA1305-SKL2 vector was recovered by overnight ligation with T4 ligase. Transferring the vector into rice leaf protoplast by using PEG transient transformation system, wherein the transformation system is as follows: 100. Mu.L of protoplast, 100. Mu.L of pCAMBIA1305-SKL2 vector plasmid and 200. Mu.L of 45% PEG. Transformation was induced for 30 minutes, centrifuged at 440. Mu. L W5 by dilution with a solution, and after incubation in the dark for 12-18 hours with 200. Mu.L of WI solution, observed by a confocal laser microscope.

The primers used in subcellular localization were as follows:

OsSKL2-F:ATGTTGGCCTCCACTTGCTTCTCCG

OsSKL2-R:TATGTTGGTGGGTGGTGCGTCGGA

as a result, as shown in FIG. 4, it was found that the gene OsSKL2 was localized in chloroplasts.

2.5 acquisition and identification of Agrobacterium-mediated OsSKL2 Gene overexpression and silencing expression plants

Methods for obtaining agrobacterium-mediated over-expression plants and silenced expression plants and medium formulations used in the culture process are described in the literature: methods in Molecular Biology, vol.343: agrobacterium Protocols,2/e, volume 1, comprising the steps of:

(1) Rice mature embryo induced callus acquisition

Mature and full rice seeds are selected and shelled for standby. 1-2L of sterile water, 75% (mass fraction) alcohol, sterilizing water prepared from hypochlorous acid and tween (specific ratio: sterilizing water: hypochlorous acid=1:1, total volume: tween=1 ml:1 ul) was prepared. Washing with 75% alcohol for about 5min, sterilizing with sterilizing water for 15 min for 7-8 min for two periods of time, defoaming with 75% alcohol for 3 times, washing with sterilizing water for several times until the water becomes clear, placing mature seeds on sterilizing filter paper, absorbing water, and culturing at 26+ -1deg.C on callus induction culture medium; after 10-15d, the induced milky yellow callus is transferred to a secondary culture medium for secondary culture. Subculturing once every two weeks, selecting the subculture for 5-7d after twice subculturing, and using the light yellow callus for co-culture.

(2) Preparation of Agrobacterium solution for transformation of Rice

The p1-OsSKL2 and pRNAi-IP-SKL2 vectors are transformed into agrobacterium LBA4404 to obtain recombinant agrobacterium LBA4404/p1-OsSKL2 and LBA4404/pRNAi-IP-SKL2. Recombinant Agrobacterium LBA4404/p1-OsSKL2 and LBA4404/pRNAi-IP-SKL2 were inoculated into YEP liquid medium (containing 50. Mu.g/mL kanamycin and 50. Mu.g/mL rifampicin) and shake-cultured at 28℃to OD ₆₀₀ =0.6-1.0; the cells were collected by centrifugation at 5000rpm for 5min at room temperature and then suspended inIn the liquid co-culture medium, the concentration of the thalli is adjusted to OD ₆₀₀ =0.4, the agrobacterium suspension used for co-cultivation of transformed rice.

(3) Agrobacteria infection rice vegetative organ

Selecting callus which is fresh and tender in color and is in cream yellow, intensively placing the callus into a 100mL sterile triangular flask, and adding the prepared agrobacterium suspension; culturing at 28deg.C on a shaking table at 220rpm for 20-30min; pouring out the bacterial liquid, placing the infected callus on a culture dish containing sterile filter paper to suck out the excessive bacterial liquid, and then transferring the infected callus to a solid co-culture medium for dark culture at 22 ℃ for 2-3d.

(4) Selective culture

Washing the co-cultured callus with sterilized water until the water becomes clear, discarding the washing liquid, transferring into a solution containing carbenicillin (100 mg/ml), washing for more than 30min under shaking, sucking with sterile filter paper, and drying in a culture dish containing sterile filter paper; the calli were then selected on selection medium containing carbenicillin (500 mg/ml) and hygromycin (50 mg/L) and incubated at 28℃for about 30 days with light until new resistant calli developed.

(5) Differentiation of resistant callus

Selecting new callus which has better cream yellow growth vigor from a screening culture medium, performing dark culture at 28 ℃ for 3d, transferring to 30 ℃ for full-illumination culture for 15-30d, and generating green spots on the new callus; seedlings were differentiated after 30-40 d.

(6) Rooting, strengthening seedling and transplanting

Transferring to rooting culture medium when the height of the differentiated seedling is 3cm, and culturing for 2-3 weeks; selecting seedlings with 15cm height and developed root systems, hardening the seedlings for 2-3d at the water adding room temperature, washing the culture medium with warm water, and transferring the seedlings into a bucket containing rice culture soil for cultivation. And after the seedlings grow robustly, the seedlings are moved into a paddy field for growth. 21 transgenic rice seedlings of 32 independent transformation events are simultaneously amplified into a target gene OsSKL2 fragment and a hygromycin gene, and 8 RNAi silencing plants are obtained. T (T) ₀ After the transgenic plants are mature, T is harvested ₁ Seed generation, T ₁ Selfing and breeding the generation seeds to obtain T ₂ Seed generation.

2.6 identification of transgenic Rice

In order to detect transgenic rice, the extracted total DNA of the transgenic rice is taken as a template, a target gene OsSKL2 fragment and a hygromycin gene are taken as detection objects, primers are designed, and PCR amplification is carried out to preliminarily identify transgenic plants.

Primer for detecting target gene OsSKL2 fragment:

SKL2–F-2：ATGAGGATAGGGGCAGGGGCGAACA

SKL2–R-2：TCAGATATTGGTCGGTGGGGCGTCG

the PCR reaction conditions were: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s; annealing at 60 ℃ for 30s; extending for 1min at 72℃for 35 cycles; total extension at 72℃for 5min.

Primer for detecting hygromycin gene:

Hyg-F：5’-TAGGAGGGCGTGGATATGGC-3’

Hyg-R：5’-TACACAGCCATCGGTCCAGA-3’

the PCR reaction procedure was: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 62℃for 30s, elongation at 72℃for 1min,34 cycles; total extension at 72℃for 5min.

Primer for detecting pRNAi-IP-SKL 2:

SKL2-Ri-N-F：TCCAGTCTGCACAAGTGAGC

SKL2-Ri-N-R：TCCAGCACAACACATTCAGC

pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s; annealing at 60 ℃ for 30s; extending for 1min at 72℃for 35 cycles; total extension at 72℃for 5min.

As a result, as shown in FIG. 5, transgenic rice plants overexpressing (OE 3 and OE 6) and RNAi silencing (Ri 6 and Ri 9) were obtained.

2.7 phenotype identification and survival statistics of OsSKL2 transgenic rice under high-salinity drought treatment

The above identified rice with OsSKL2 transgene over-expression and silencing expression was selected for study, and each group of treatments was controlled by wild type medium flower 11. Four week-sized wild-type and transgenic plants were treated with 120mM NaCl, 140mM NaCl, and 20% PEG, respectively, and rehydrated for 1 day after drought treatment. Photographing and survival rate statistics are respectively carried out after treatment.

The results are shown in FIGS. 6 and 7, wherein the survival rate of the over-expressed plants is obviously higher and the survival rate of the silent plants is obviously lower after the treatment of 120mM NaCl and 140mM NaCl compared with the wild type; the result of rehydration experiments after drought treatment also shows that the survival rate of the over-expression plants is obviously higher, and the survival rate of the silent plants is obviously lower; these results indicate that the OsSKL2 gene has salt resistance and drought resistance.

The foregoing examples illustrate only a few embodiments of the application and are described in detail herein without thereby limiting the scope of the application. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the application, which are all within the scope of the application.

Sequence listing

<110> Anhui university of agriculture

<120> a drought-resistant and salt-tolerant gene OsSKL2 for rice and its application

<141> 2021-12-16

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1128

<212> DNA

<213> Rice (Oryza sativa)

<400> 1

atgttggcct ccacttgctt ctccgccccg ccgccctcct cctcctcccc gtcaatcccg 60

acccacctcg ccactctctg ctgctgcttc aggcctcccg ctcgcccacc ttggcctcgc 120

tctcttcttc ttcttggtgc cttcccaccg ccgacccgcc ccctcccccg cgcctccgtc 180

tcgtcatcga ccgccccagc gaaagactac gagtttactg atggtggcgg agaggtggag 240

ctgaggctgg acataggaaa gctcggcatt gagaattcaa gagatgtatt tgttgacgtc 300

gatgatacgt ctctgttggt cagagccaag tcggatggga cactgcggac tttgatcaat 360

gttaaacaac tctttgatag gattaagtct tctgagacta tatggttcat tgatgaggat 420

caattggtag tgaatctaaa gaaagttgag caagagctga aatggcccga cattgatgaa 480

tcttgggaat cccttacttc tggaatcact cagcttttga cagggattag tgttcatatt 540

gttggtgatt ccacagatat aaacgaggca gttgctaaag aaatagctga gggaattggt 600

taccttccag tctgcacaag tgagctgcta gaaagtgcca ccgaaaagtc tattgacaaa 660

tggttggctt cggaaggagt ggattcggta gcagaagctg aatgtgttgt gctggaaagc 720

cttagcagcc atgttcgtac agtcgtagca actctggggg gaaagcaagg agcagctagc 780

agatttgata aatggcagta tcttcatgct ggatttacgg tttggttgtc ggtctccgat 840

gccagcgatg aagcttctgc caaagaagag gcccgtagaa gtgtgagctc gggaaatgtt 900

gcgtacgcga aagctgatgt agtagtgaag cttggtggat gggatccgga gtacacacga 960

gctgttgccc agggttgcct tgtggccttg aagcagctaa cattggcaga caagaagcta 1020

gcaggtaaga agagcctata catgaggctg ggatgccgag gggattggcc caacatcgag 1080

cctcccggct gggatcctga ctccgacgca ccacccacca acatatga 1128

<210> 2

<211> 375

<212> PRT

<213> Rice (Oryza sativa)

<400> 2

Met Leu Ala Ser Thr Cys Pro Ser Ala Pro Pro Pro Ser Ser Ser Ser

1 5 10 15

Pro Ser Ile Pro Thr His Leu Ala Thr Leu Cys Cys Cys Pro Ala Pro

20 25 30

Pro Ala Ala Pro Pro Thr Pro Ala Ser Leu Leu Leu Leu Gly Ala Pro

35 40 45

Pro Pro Pro Thr Ala Pro Leu Pro Ala Ala Ser Val Ser Ser Ser Thr

50 55 60

Ala Pro Ala Leu Ala Thr Gly Pro Thr Ala Gly Gly Gly Gly Val Gly

65 70 75 80

Leu Ala Leu Ala Ile Gly Leu Leu Gly Ile Gly Ala Ser Ala Ala Val

85 90 95

Pro Val Ala Val Ala Ala Thr Ser Leu Leu Val Ala Ala Leu Ser Ala

100 105 110

Gly Thr Leu Ala Thr Leu Ile Ala Val Leu Gly Leu Pro Ala Ala Ile

115 120 125

Leu Ser Ser Gly Thr Ile Thr Pro Ile Ala Gly Ala Gly Leu Val Val

130 135 140

Ala Leu Leu Leu Val Gly Gly Gly Leu Leu Thr Pro Ala Ile Ala Gly

145 150 155 160

Ser Thr Gly Ser Leu Thr Ser Gly Ile Thr Gly Leu Leu Thr Gly Ile

165 170 175

Ser Val His Ile Val Gly Ala Ser Thr Ala Ile Ala Gly Ala Val Ala

180 185 190

Leu Gly Ile Ala Gly Gly Ile Gly Thr Leu Pro Val Cys Thr Ser Gly

195 200 205

Leu Leu Gly Ser Ala Thr Gly Leu Ser Ile Ala Leu Thr Leu Ala Ser

210 215 220

Gly Gly Val Ala Ser Val Ala Gly Ala Gly Cys Val Val Leu Gly Ser

225 230 235 240

Leu Ser Ser His Val Ala Thr Val Val Ala Thr Leu Gly Gly Leu Gly

245 250 255

Gly Ala Ala Ser Ala Pro Ala Leu Thr Gly Thr Leu His Ala Gly Pro

260 265 270

Thr Val Thr Leu Ser Val Ser Ala Ala Ser Ala Gly Ala Ser Ala Leu

275 280 285

Gly Gly Ala Ala Ala Ser Val Ser Ser Gly Ala Val Ala Thr Ala Leu

290 295 300

Ala Ala Val Val Val Leu Leu Gly Gly Thr Ala Pro Gly Thr Thr Ala

305 310 315 320

Ala Val Ala Gly Gly Cys Leu Val Ala Leu Leu Gly Leu Thr Leu Ala

325 330 335

Ala Leu Leu Leu Ala Gly Leu Leu Ser Leu Thr Met Ala Leu Gly Cys

340 345 350

Ala Gly Ala Thr Pro Ala Ile Gly Pro Pro Gly Thr Ala Pro Ala Ser

355 360 365

Ala Ala Pro Pro Thr Ala Ile

370 375

Claims

1. Drought-resistant and salt-resistant gene of riceOsSKL2The application of the gene in improving drought resistance and salt tolerance of rice is characterized in that the geneOsSKL2The nucleotide sequence of (2) is shown as SEQ ID NO. 1.

2. According to claim 1The use of (2) is characterized in that the geneOsSKL2The over-expression has positive regulation and control effect on drought resistance and salt tolerance of rice.