WO2010024269A1

WO2010024269A1 - Dwarf transgenic plant, and gene for induction of dwarfing

Info

Publication number: WO2010024269A1
Application number: PCT/JP2009/064824
Authority: WO
Inventors: 優高木; 美穂池田
Original assignee: 独立行政法人産業技術総合研究所
Priority date: 2008-08-29
Filing date: 2009-08-26
Publication date: 2010-03-04
Also published as: JP2010051293A; JP4528953B2

Abstract

The object aims to find a factor involved in the regulation of plant cell elongation and produce a superior plant having a reduced height and having the similar numbers of branches and leaves to those of the original type one by manipulating the factor. A protein comprising an amino acid sequence depicted in any one of the amino acid sequences (a) to (d) shown below and capable of inhibiting the elongation of a plant cell or a chemeric protein produced by linking a transcription inhibition domain to the C-terminal of the protein is allowed to express in a cell of a transgenic plant: (a) the amino acid sequence depicted in SEQ ID NO:1; (b) an amino acid sequence having the deletion, substitution or addition of one or several amino acid residues in the amino acid sequence depicted in SEQ ID NO:1; (c) an amino acid sequence encoded by the nucleotide sequence depicted in SEQ ID NO:2; and (d) an amino acid sequence encoded by a nucleotide sequence which can hybridize with a sequence complementary to the nucleotide sequence depicted in SEQ ID NO:2 under stringent conditions.

Description

Dwarfing transformed plants and genes for inducing dwarfing

The present invention relates to a gene encoding a transcriptional regulatory factor involved in dwarfing by suppressing cell elongation of a plant and dwarfing a plant transformed using the gene.

In the agricultural field, fertile traits are very important traits for preventing lodging due to storm and flood damage and improving convenience of work, and so far, fertile varieties have been actively produced by conventional breeding methods. However, enormous time is required to produce a new variety in the conventional breeding method. On the other hand, the number of types of plants that human beings cultivate and use as edible or other raw materials has grown enormously even from those that have been cultivated continuously since ancient times, and among these, dwarfing is required. It is very difficult to produce fertile varieties for all varieties that do so.
In addition, due to recent changes in the global environment and changes in human lifestyles, the types of crops that humans need and the traits they need for crops are constantly changing. For example, a trial of so-called “plant factory”, in which plants are cultivated under closed-type fully artificial environment control instead of field cultivation and used as a place for producing useful substances such as pharmaceuticals, has been started. For the purpose of cultivation in a closed plant production facility, the varieties that have been bred and developed so far are not necessarily optimal, and the volume can be effectively used in a form that allows more effective use of space, that is, the area of the cultivation space. Therefore, it is important to have a trait suitable for multi-stage cultivation, and it is necessary to produce a dwarfed plant variety more than conventionally required.
In response to such changes in needs, a genetic breeding method that can induce the necessary morphological changes in a shorter time is very useful in place of the conventional breeding method that has a huge time for breeding. As a result, it has become an urgent task to find genetic resources involved in the induction of useful traits, establish their use, and elucidate their functions.
In addition, since the need to create new varieties extends to various plant varieties, it is also important to develop breeding methods that can easily and uniformly induce the same trait changes in various plant species and plant varieties. It is done.

Recently, technological development for producing fertile plants using plant transformation technology by genetic recombination has been activated, and various methods have been developed.
In rice and the like, methods for suppressing genes related to biosynthesis of plant hormones and other substances important for growth by antisense (Patent Documents 1 to 7), methods for introducing mutations into these genes (Patent Documents 8 to 10) In addition, a method using a promoter that specifically works in the rice node (Patent Document 11) and a method of causing metabolic abnormality in the cell wall using a microorganism-derived enzyme (Patent Document 12) have also been studied. However, even if the target gene is suppressed by antisense or mutagenesis, it is difficult to completely suppress the gene function if there is a duplicated gene, and there are multiple target synthetic pathways. However, it is almost impossible to suppress all genes involved in multiple pathways, and on the other hand, genes that are important for growth and metabolic pathways involved are completely inhibited from functioning. Since it deteriorates remarkably, it is necessary to control at an appropriate level, but the control is not easy. In addition, since the base sequence of the target gene is slightly different for each plant, a method for suppressing the function of the gene by an antisense method or the like cannot be said to be a versatile technique applicable to plants in general.
In addition, we created an overexpression construct for the gene derived from the model plant, Arabidopsis thaliana, introduced it into Arabidopsis thaliana, induced dwarfism, identified the causative gene, etc., At4g31910, At1g04910,
At4g35700, At1g49770 genes (WO2005 / 026345) and At1g66820 genes (Patent Document 2) have been identified, and a method (Patent Document 2) in which these genes are overexpressed and dwarfed has also been developed. It cannot be said that the goal of complete dwarfing has been achieved. In general, when these techniques are used, the plant height is lowered, and at the same time, the number of branches and leaves is decreased, and the change in leaf thickness and stem thickness is often induced. It is a general technique that can be applied to general cultivated plants where high yield is important as crops such as vegetables and cereals.
Therefore, it is possible to produce excellent plants with the same number of branches and leaves as conventional plants, with only a low plant height and almost no change in biomass. At the same time, there is versatility that can be applied to cultivated plants in general. Technology was sought.

Japanese Patent Laid-Open No. 2001-238686 Japanese Patent Laid-Open No. 2001-178468 Japanese Patent Laid-Open No. 2003-334085 JP 2005-278636 A JP 2005-204673 A Republished 2003-84314 JP 2008-161192 A JP 2007-049970 A JP2003-000260 JP 2002-010786 A JP 2007-215416 A JP 2005-040036 A International Publication 2005/026345 Pamphlet (WO2005 / 026345) JP2008-099637 Patent No. 3829200 Japanese Patent No.3995211 JP 2001-269177 A JP 2001-269178 A JP 2001-292776 Japanese Patent Laid-Open No. 2001-292777 Japanese Patent Laid-Open No. 2001-269176 JP 2001-269179 A

An object of the present invention is to find a factor that controls cell elongation between nodes of a plant, and by manipulating this factor, the plant height of the plant is lowered, it is resistant to lodging, is easy to farm, and is not inferior to conventional plants. It is to enable the production of excellent plants having the number of branches and leaves. In addition, it can contribute to the production of plants adapted to multi-stage cultivation in indoor plant cultivation facilities being conducted in recent years.

The present inventors previously determined from transcriptional activators derived from Arabidopsis thaliana a transcriptional repression domain that imparts strong transcriptional repression activity to the transcriptional activator, and CREST-T using the transcription repression domain. The CREST-T method has been shown to be an epoch-making technique that can be widely applied to plants including monocotyledonous rice (Patent Documents 15 to 22, Non-Patent Documents 1 to 3). . Recently, as these transcriptional repression domains, conventionally known motifs composed of (L / F) DLN (L / F) (X) P (where X represents any amino acid residue. SEQ ID NO: 3) ) And “DLELLL (SEQ ID NO: 4)”, a new conserved motif of the transcription domain has been determined and has been filed as Japanese Patent Application No. 2008-62113. (The contents described in this application specification shall be incorporated as the description contents of this specification.)
In order to solve the above problems, the present inventors have focused on the transcriptional control gene of Arabidopsis thaliana and, as a result of intensive research, overexpressed a chimeric protein in which SRDX, a typical transcription repression domain, is linked to the At2g43060 gene. And found that it has a remarkable plant dwarfing function, and elucidated the mechanism by which the chimeric protein suppresses the expression of enzymes that promote plant cell elongation. Furthermore, we found that the protein encoded by the At2g43060 gene has the function of suppressing the vertical elongation of plant cells even when it is overexpressed, and has the function of dwarfing transformed plants. .
As a result of transforming tobacco plants using the gene and a transcriptional repressor domain linked to this gene and transforming it into a repressor, knowledge that can produce excellent fertile plants with low plant height beyond the species Thus, the present invention has been completed.
That is, in the present invention, a gene that dominantly induces a fertile trait can be isolated and identified, and a transcriptional repressor domain gene bound to the gene and functionally converted to a repressor can be expressed ectopically. Thus, it is possible to reliably and easily produce fertile plants.

Specifically, the present inventors encoded a construct (35S: At2g43060) that expresses the gene of accession number At2g43060, which is classified as a transcriptional gene in the Arabidopsis database, under the control of the CaMV35S promoter, and a protein of this gene. A 35S: At2g43060SRDX construct was prepared by inducing a chimeric gene in which the DNA encoding the SRDX peptide was fused with the C-terminus of the DNA to be read by the CaMV35S gene promoter (35S). Transformed Arabidopsis plants introduced with these chimeric gene constructs showed clear fertile traits. Detailed analysis of these transformed Arabidopsis thaliana revealed that the longitudinal elongation of the flower stem cells was suppressed.
Furthermore, when this Arabidopsis chimera gene (35S: At2g43060SRDX) was introduced into a tobacco plant and the resulting transformed plants were observed, the internodes of these tobaccos were shorter than the wild type, and the plant height was remarkably high. It turned out to be lower. Furthermore, in order to elucidate the cause, the epidermal cells were also observed on tobacco stems, and it was found that longitudinal elongation was suppressed as in Arabidopsis flower stem cells. Based on these results, the chimeric gene produced using the Arabidopsis transcriptional regulator At2g43060 suppresses the vertical elongation of stem cells regardless of plant species and growth stage, and induces the dwarfing of plants. It has been shown.

That is, the present invention is as follows.
[1] A protein comprising the amino acid sequence of any one of the following (a) to (b), which has a function of suppressing the elongation of plant cells;
(A) the amino acid sequence shown in SEQ ID NO: 1,
(B) an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1;
(C) an amino acid sequence encoded by the base sequence shown in SEQ ID NO: 2,
(D) an amino acid sequence encoded by a base sequence that hybridizes with a complementary sequence of the base sequence shown in SEQ ID NO: 2 under stringent conditions.
[2] The protein according to [1] above, wherein the protein is a chimeric protein having a transcription repression domain bound to the C-terminal side thereof.
[3] The transcription repression domain is a motif consisting of (L / F) DLN (L / F) (X) P (where X represents any amino acid residue) or “DLELLL”, 2].
[4] The protein according to [2] above, wherein the transcription repression domain is a peptide having a plant transcription function, comprising an amino acid sequence represented by the following formula (I):
Formula (I)
X ₁ -X ₂ -Leu-Phe-Gly-Val-X ₃
(Wherein X ₁ and X ₃ represent an amino acid sequence composed of 1 to 10 arbitrary amino acids, and X ₂ represents Lys or Arg).
[5] A nucleic acid molecule encoding the protein according to any one of [1] to [4].
[6] An expression vector comprising the nucleic acid molecule according to [5].
[7] A transformed cell into which the nucleic acid molecule according to [5] has been introduced.
[8] A dwarfed transformed plant into which the nucleic acid molecule according to [5] has been introduced and its progeny.
[9] A method for producing a protein having a function of suppressing the elongation of plant cells, comprising culturing and collecting the transformed cells according to [7].
[10] A method for producing a dwarfed transformed plant, wherein the nucleic acid molecule according to [5] is introduced into a plant cell, and the plant is regenerated from the plant cell.
[11] A method for dwarfing a plant, comprising expressing the nucleic acid molecule according to [5] in a cell of a plant body.

By overexpressing in the plant body the gene encoding the transcriptional regulatory factor of the present invention and a chimeric protein in which a transcription repressing domain such as SRDX peptide is fused to the C-terminal side thereof, gene expression of an enzyme involved in cell elongation is expressed. It has a function of inhibiting and suppressing the elongation in the longitudinal direction of cells. As a result, Arabidopsis plants become extremely fertile.
In addition, induction of dwarfing of plants by the gene of the present invention can be applied to plants in general, and this gene affects the elongation of plant stem cells but does not affect the number of leaves and branches. It is very useful in the field of plant breeding.

Photograph of 35S: At2g43060SRDX gene-expressing Arabidopsis thaliana plant. It shows a remarkable form of fertility. The left is a photograph of an At2g43060SRDX gene-expressing Arabidopsis plant, and the right is a wild-type plant. Scanning electron micrograph of the stem of At2g43060SRDX gene expressing Arabidopsis thaliana plant. A round cell line is observed. Scanning electron micrograph of the stem of a wild type plant. A state in which vertically long cells are lined up is observed. Analysis of AtEXP8 expression level in Arabidopsis thaliana expressing At2g43060SRDX. AtEXP8 encodes a kind of Arabidopsis-derived expansin (an enzyme involved in cell longitudinal elongation). It can be seen that the expression level of this gene is reduced in At2g43060SRDX gene expression Arabidopsis thaliana. The expression level of Arabidopsis thaliana UBQ gene (ubiquitin gene) is quantified as 1. The same applies to the following experiments. Analysis of ENT expression level in At2g43060SRDX gene expression Arabidopsis thaliana. ENT encodes a type of Arabidopsis endoxyloglucan transferase (an enzyme involved in the longitudinal elongation of cells). It can be seen that the expression level of this gene is reduced in At2g43060SRDX gene expression Arabidopsis thaliana. The photo on the left shows a 35S: At2g43060 gene overexpressing Arabidopsis plant, and the photo on the right shows a wild type plant. 35S: At2g43060 gene overexpressing Arabidopsis thaliana shows a remarkable fertile morphology. Analysis of the expression level of AtEXP8 in 35S: At2g43060 gene overexpressing Arabidopsis thaliana. Analysis of ENT expression in 35S: At2g43060 gene overexpressing Arabidopsis thaliana. It can be seen that in 35S: At2g43060 gene overexpression Arabidopsis thaliana, the expression level of this gene is decreased. The photo on the right shows a tobacco plant expressing the At2g43060SRDX gene, and the photo on the left shows a control plant. In the At2g43060SRDX gene-expressing tobacco plant, it is observed that the internodes are contracted. Scanning electron micrograph of the stem of tobacco plant expressing At2g43060SRDX gene. A round cell line is observed. Scanning electron micrograph of the stem of a tobacco control plant. A state in which vertically long cells are lined up is observed. The graph which shows the plant height of an At2g43060SRDX gene expression tobacco plant and a wild type plant. The average value of wild-type plant height was expressed as 1. At2g43060SRDX gene-expressing tobacco shows a decrease in plant height of more than 40% compared to the wild type. The graph which shows the number of leaves formed in one individual of an At2g43060SRDX gene expression tobacco plant and a wild type plant. In At2g43060SRDX gene-expressing tobacco, the number of leaves is slightly increased compared to the wild type. B is a photograph taken from above of the leaf shape of At2g43060SRDX transgenic tobacco, and A is a control.

Hereinafter, the present invention will be described in more detail.
The gene encoding the transcriptional regulatory factor used in the present invention is typically an At2g43060 gene derived from Arabidopsis thaliana and represented by SEQ ID NO: 2.
The protein encoded by the gene is overexpressed in the transformed plant alone or as a chimeric protein fused with the transcriptional regulatory domain, thereby suppressing the expression of the enzyme gene involved in the longitudinal elongation of the cells in the plant. It is thought to do. Such an expression suppression mechanism is the same as the transcription control mechanism that the present inventors have conventionally developed as the CREST-T method, and the present invention is generally applicable to general-purpose plants including monocotyledonous plants such as rice. It is an applicable method for suppressing the expression of an enzyme gene.

That is, the gene encoding the transcriptional regulatory factor that can be used in the present invention is not limited to the At2g43060 gene derived from Arabidopsis thaliana, but also includes corresponding genes derived from other plant species, and fragments thereof can be used as long as they retain the same function. Good. Such a gene has a homology (identity) of 70% or more, preferably 80% or more, more preferably 90% or more, and even more preferably 95% or more with SEQ ID NO: 2 in the nucleotide sequence. The amino acid sequence encoded by has a homology (identity) of SEQ ID NO: 1 of 70% or more, preferably 80% or more, more preferably 90% or more, and still more preferably 95% or more.
Specifically, it can be expressed as a nucleic acid molecule encoding the following protein.
A protein comprising the amino acid sequence of any one of the following (a) to (b), wherein the protein has a function of suppressing the elongation of plant cells;
(A) the amino acid sequence shown in SEQ ID NO: 1,
(B) an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1;
(C) an amino acid sequence encoded by the base sequence shown in SEQ ID NO: 2,
(D) an amino acid sequence encoded by a base sequence that hybridizes with a complementary sequence of the base sequence shown in SEQ ID NO: 2 under stringent conditions.
Here, stringent conditions refer to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed. For example, a highly homologous nucleic acid, that is, a complementary strand of DNA consisting of a nucleotide sequence having a homology of 90% or more, preferably 95% or more, is hybridized with the nucleotide sequence shown in SEQ ID NO: 2 and has a lower homology. A condition in which the complementary strand of the nucleic acid does not hybridize is mentioned. More specifically, it refers to a condition in which the sodium concentration is 15 to 300 mM, preferably 15 to 75 mM, and the temperature is 50 to 60 ° C., preferably 55 to 60 ° C.
One or several amino acids means 1 to 100, preferably 1 to 50, more preferably 1 to 30, and still more preferably about 1 to 10.

In the present invention, the transcription repression domain is a motif ((L / F) DLN (L / F) (X) P) which is a transcription repression domain shown in Patent Documents 15 to 22 and Non-Patent Documents 1 to 3. X represents any amino acid residue, a transcription repressing peptide comprising SEQ ID NO: 3) and “DLELLL (SEQ ID NO: 4)”, and the following formula (I) described in Japanese Patent Application No. 2008-62113 These transcriptional repressing peptides are used. The typical motif of the former is SRDX (LDLELRLGFA: SEQ ID NO: 5), and the latter motif is represented as follows.
Formula (I)
X ₁ -X ₂ -Leu-Phe-Gly-Val-X ₃
In the above formula (I), X ₂ represents Lys or Arg. X ₁ and X ₃ may be any amino acid, and the number of amino acids constituting the amino acid sequence of X ₁ and X ₃ may be any number as long as each is within the range of 1 to 10. From the viewpoint of ease of synthesis of the peptide to be used, the shorter one is better, but in order to surely increase the suppressing effect, the total number of X ₁ and X ₃ is preferably 3 or more. More preferably, X ₁ + X ₃ is 6 or more, more preferably 10 or more. If the conserved motif contained here is indicated by a single letter, it is “(R / K) LFGV” or “(X) (R / K) LFGV (X)”. (However, X represents any amino acid residue.) (SEQ ID NO: 6) Typical nucleotide sequences contained in this motif are included in Arabidopsis transcription factors At3g11580, At2g46870, At1g13260, At1g68840, At4g36990, At4g11660, and the like. (R / K) can be obtained as a base sequence corresponding to the LFGV motif.

In the present invention, the inventors developed the present invention when expressing in a plant cell of a transformed plant body a chimeric protein in which a transcriptional regulatory factor having a plant cell elongation suppressing function and a transcriptional repression domain are bound. This is performed according to the CRES-T method (Chimeric repressor silencing technology) (Patent Documents 15 to 22, Non-Patent Documents 1 to 3).
The CRES-T method uses a transcription repression domain (dominant repressor) isolated from a plant and binds to the carboxyl group terminal of the transcriptional activator to impart a strong transcriptional repression activity to the transcriptional activator. It is a technology that strongly suppresses transcription of the target gene by expressing in vivo the chimeric gene of the nucleic acid molecule that encodes each. A chimeric gene fused with a transcriptional repression domain was created using the CRES-T method because it suppresses not only the transcriptional activator, but also all other functions of the transcriptional activator acting on the same gene. Plants have the advantage of showing a form in which the expression of the target gene is completely suppressed.
The transcription repression domain used in the CRES-T method is a motif of (L / F) DLN (L / F) (X) P or (X) (R / K) LFGV (X) motif (where X is any Has also been identified not only in Arabidopsis thaliana, but also in a wide range of plant transcriptional repressors such as tobacco and rice, and related genes similar in sequence and function in the CRES-T method. It has been confirmed that the function can be suppressed and that it can be applied to plants in general beyond species.

The promoter that controls the transcription control factor of the present invention may be any promoter that can be expressed in the stem extension. Therefore, plant constitutive expression-inducing promoters containing CaMV35S and promoters that control expression in stems are all suitable for this invention. Furthermore, promoters that induce particularly strong expression in the stem extension are particularly preferred. For example, rice D18 promoter (Japanese Patent Laid-Open No. 2007-215416). A promoter that induces gene expression by an external factor is also suitable for the present invention.
Examples of methods for introducing the gene or recombinant vector of the present invention into plants include the Agrobacterium method, the PEG-calcium phosphate method, the electroporation method, the liposome method, the particle gun method, and the microinjection method.
Whether or not a gene has been incorporated into a plant can be confirmed by PCR, Southern hybridization, Northern hybridization, or the like.

Plants to be transformed in the present invention include whole plants, plant organs (eg leaves, petals, stems, roots, seeds, etc.), plant tissues (eg epidermis, phloem, soft tissue, xylem, vascular bundles, etc.) ) Or plant cultured cells.
Examples of plants used for transformation include plants belonging to the Brassicaceae, Eggplant, Gramineae, Legumes, etc., but are not limited to these plants.
Thus, in the present invention, it can be applied to general breeding of food-producing plants such as rice, wheat and other grains, beans, and corn, together with vegetables such as solanaceous plants, and therefore from the viewpoint of future food production technology. I have great expectations.
Tobacco is a plant that has long been used for research as a model plant of the solanaceous family, but there is very little knowledge about its genetic resources. However, the knowledge of tobacco can be expected to be widely available in the solanaceous family, which contains many major crops such as tomatoes and potatoes.
Tobacco is a diploid that is difficult to modify in traits, whether by mating breeding or molecular breeding. The polyploid plants include soybeans and wheat, which are important crops for food and feed, and the knowledge obtained in tobacco seems to be useful for breeding these polyploid plants.
Furthermore, because Arabidopsis is rosette and there is no internode elongation during the vegetative growth phase, it is difficult to evaluate dwarfing during the vegetative growth phase, whereas in tobacco, the vegetative growth and reproductive growth It is easy to evaluate dwarfism because of the growth of nodes in each period. The dwarfing of plants by the chimeric protein of the present invention is due to the suppression of the elongation of stem cells in the longitudinal direction. In order to prove this, the present inventors made detailed observations of epidermal cells using a scanning electron microscope in epidermal cells of stems ectopically expressing the chimeric protein, and the cells were elongated vertically. Confirmed that there is no.
In addition, the protein or chimeric protein of the present invention can also be produced using a plant cell host, another microbial host such as E. coli, an animal cell host, or the like. These proteins may be able to dwarf the plant body by acting directly on the plant body.

In order to elucidate the details of the cell growth inhibitory function of the chimeric protein of the present invention, the present inventors extracted RNA from a plant ectopically expressing the chimeric protein and analyzed various genes involved in stem cell elongation. The expression level was analyzed. As a result, it was found that in transgenic plants ectopically expressing the chimeric protein, the expression of enzyme groups (such as EXP8) that promote cell longitudinal elongation was suppressed.

The cell elongation suppression function by the chimeric protein of the present invention is due to the suppression of the expression of enzymes that promote cell elongation. That is, because the stem elongation suppression function of the present transcription control protein and the chimeric protein requires that the protein be ectopically expressed in a tissue in which the target enzyme group of the protein is transcribed. A group of enzymes that promote cell elongation by combining a gene encoding the protein with a promoter region capable of controlling expression in a tissue in which the target enzyme gene is expressed to form a chimeric vector and introducing it into a plant body The expression of this gene can be suppressed, and the elongation of the plant stem in the vertical direction can be suppressed.

Although the embodiment of the present invention is specifically shown below, the present invention is not limited to this. Here, a representative At2g43060 gene is used as a gene (transcription control factor) encoding a protein having a function of suppressing the elongation of plant cells of the present invention, and SRDX is used as a representative transcription repression domain that binds to the gene. .
First, in order to show that not only the chimeric gene in which the transcription repression domain SRDX is fused to the transcriptional regulatory factor At2g43060 gene, but also the transcriptional regulatory factor itself encoded by this gene induces the dwarfing of Arabidopsis thaliana. Et al. Performed a detailed analysis in a transgenic plant in which the transcription factor was ectopically expressed under the control of the CaMV35S promoter.
In transformed Arabidopsis thaliana expressed ectopically under the control of the CaMV35S promoter, remarkable dwarfing was observed as in transformed Arabidopsis thaliana expressed ectopically with a chimeric protein fused with SRDX. It was.
When RNA was extracted from transformed Arabidopsis thaliana in which the transcription factor was ectopically expressed under the control of the CaMV35S promoter, the expression level of each gene was analyzed. In this plant, the chimeric protein fused with SRDX was ectopic. It was found that the expression of enzymes that promote the elongation of cells in the longitudinal direction was suppressed in the same manner as in transgenic Arabidopsis thaliana expressed in an artificial manner.

The function of inhibiting the elongation in the vertical direction of plant stem cells by the transcriptional control protein and chimeric protein of the present invention acts regardless of the type of plant. In order to prove this, the present applicant introduced a construct for expressing a chimeric protein in which SRDX was fused to the Arabidopsis transcriptional regulatory factor under the control of the CaMV35S promoter, and observed its morphology.
In the tobacco into which the chimeric construct was introduced, the internodes of the stem were shortened and the final plant height was also lowered. When the epidermal cells of the stem were observed using a scanning electron microscope, the suppression of the elongation of the stem cells in the vertical direction was observed, as in Arabidopsis. Therefore, the action of the chimeric construct is common between Arabidopsis and tobacco. Turned out to be.
Furthermore, the reduction of internodes in the tobacco introduced with the chimeric construct was common to the stems of the vegetative growth stage and the reproductive growth stage. Therefore, the action of the chimeric construct is common to the vegetative growth stage and the reproductive growth stage. It has been found.
That is, the action of the chimeric construct is not limited to the suppression of the elongation of flower stems of rosette plants, but also functions widely for the suppression of elongation of stems during the vegetative growth stage of plants.
In addition, in the chimeric construct-introduced tobacco, the number of leaves did not decrease even though the plant body became dwarf. This indicates that the action of the chimeric construct is limited to the suppression of the elongation of stem cells in the vertical direction, and does not act on the formation patterns of branches and leaves that have a great influence on fruit formation and biomass.

Examples of the present invention will be described below, but the present invention is not limited to these examples.

In Example 1, the At2g43060 gene was ligated with a gene fragment encoding SRDX, which is a transcriptional repression domain, and connected to the downstream of the cauliflower mosaic virus 35S promoter to construct a transformed plasmid. The plasmid was transformed into an Arabidopsis plant. The effect of At2g43060SRDX chimera gene on suppression of plant height elongation in Arabidopsis thaliana was examined by introducing and observing the morphology of transformed plants and analyzing the effect on the expression of cell elongation promoting enzymes.
In Example 2, a transformed plasmid was constructed by connecting the At2g43060 gene downstream of the cauliflower mosaic virus 35S promoter, the plasmid was introduced into an Arabidopsis plant, the morphology of the transformed plant was observed, and the cell elongation promoting enzyme By analyzing the effect on expression, we investigated the inhibitory effect of At2g43060 gene on plant height elongation in Arabidopsis thaliana.
In Example 3, a gene fragment encoding SRDX, which is a transcriptional repression domain, was ligated to the At2g43060 gene, and this was connected downstream of the cauliflower mosaic virus 35S promoter to construct a transformed plasmid, which was introduced into a tobacco plant. Then, by observing the morphology of the transformed plant, the plant height elongation inhibitory effect of the At2g43060 gene in tobacco was investigated.

Example 1
(1-1) Construction of Transformation Vector pBIG2 A DNA fragment containing the cauliflower mosaic virus 35S promoter (CaMV 35S) by cleaving the plasmid p35S-GFP of Clontech (Clontech, USA) with restriction enzymes HindIII and BamHI. Were separated and collected by agarose gel electrophoresis. A plant transformation vector pBIG-HYG (Becker, D. 1990 Nucleic Acid Research, 18: 203) assigned by Michigan State University, USA was cleaved with restriction enzymes HindIII and SstI, and the GUS gene was removed by agarose gel electrophoresis. A DNA fragment was obtained.
DNA having the following sequence was synthesized, heated at 70 ° C. for 10 minutes, and then annealed by natural cooling to obtain double-stranded DNA. This DNA fragment has a BamHI restriction enzyme site at the 5 ′ end, an omega sequence derived from tobacco mosaic virus that enhances translation efficiency, and restriction enzyme sites SmaI and SalI.
5'-GATCCACAATTACCAACAACAACAAACAACAAACAACATTACAATTACAGATCCCGGGGGTACCGTCGACGAGCTC-3 '(SEQ ID NO: 7)
5'-CGTCGACGGTACCCCCGGGATCTGTAATTGTAATGTTGTTTGTTGTTTGTTGTTGTTGGTAATTGT-3 '(SEQ ID NO: 8)
A double-stranded DNA synthesized with a DNA fragment containing the CaMV 35S promoter region was inserted into the HindIII and SstI sites of pBIG-HYG excluding the GUS gene to obtain a plant transformation vector pBIG2.

(1-2) Transformation vector 35S: Construction of At2g43060SRDX Partial base sequence of SUPERMAN) Two complementary DNA sequences with GGG 3 'and stop codon 3'
5'-GGGCTCGATCTGGATCTAGAACTCCGTTTGGGTTTCGCTTAAG-3 '(SEQ ID NO: 9)
5'-CTTAAGCGAAACCCAAACGGAGTTCTAGATCCAGATCGAGCCC-3 '(SEQ ID NO: 10)
Was annealed and inserted into the pBIG2 vector cut with SmaI. The sequence was confirmed and the one introduced in the forward direction was selected and designated as p35SRDX.
Using Arabidopsis At2g43060 cDNA as a template,
5 end upper primer
5'-GATGGCCTCTGCAGACAAACTCATAAACAC-3 '(SEQ ID NO: 11)
3 end lower primer
5'-TTTGGGAGATAAGCCATCAACGAGACACTG-3 '(SEQ ID NO: 12)
A PCR reaction was used to amplify the full length sequence of At2g43060 excluding the stop codon. The PCR reaction was performed for 30 cycles, with a denaturation reaction at 94 ° C. for 1 minute, an annealing reaction at 50 ° C. for 1 minute, and an extension reaction at 72 ° C. for 3 minutes. Next, insert it into the above-mentioned p35SRDX cut with SmaI and collected by agarol gel electrophoresis. From the sequence confirmed and the At2g43060 gene introduced in the forward direction, the reading frame of At2g43060 gene and SRDX match. The thing was selected and it was set as 35S: At2g43060SRDX.

(1-3) Preparation of plant body transformed with 35S: At2g43060SRDX Transformation of Arabidopsis plants with 35S: At2g43060SRDX is carried out by Transformation of Arabidopsis thaliana byvacum infiltration (http: //www.bch.msu.proto htm). However, I did not use vacuum to infect it, but just dipped it. The plasmid was introduced into a soil bacterium [(Agrobacterium tumefaciens strain GV3101 (C58C1Rifr) pMP90 (Gmr) (koncz and Schell 1986)] strain by culturing in the 250 ml LB medium for 2 days. .
Subsequently, the bacterial cells were collected from the culture solution and suspended in 500 ml of an infection medium. In this solution, Arabidopsis thaliana grown for 14 days was soaked for 1 minute, infected, and then grown and seeded again. The collected seeds are sterilized with 50% bleach and 0.02% Triton X-100 solution for 7 minutes, rinsed three times with sterilized water, and the sterilized seeds are added to 1/2 MS selective medium containing 30 mg / l hygromycin. I was slaughtered.
A transformed plant growing on the hygromycin plate was selected, replanted in soil, and grown.

(1-4) Traits of Arabidopsis plants transformed with 35S: At2g43060SRDX Traits of plants transformed with 35S: At2g43060SRDX are shown on the left side of FIGS. The plant on the right side of B is wild type. In Arabidopsis thaliana transformed with 35S: At2g43060SRDX, remarkable flower stem dwarfing was confirmed. This demonstrates that the 35S: At2g43060SRDX chimeric construct induces flower stem dwarfing in Arabidopsis.
A view of the morphology of the epidermal cells of the transformed Arabidopsis stem using a scanning electron microscope is shown in FIG. D is a photograph of a wild-type stem taken at the same scale. In Arabidopsis thaliana transformed with 35S: At2g43060SRDX, the stem cells were markedly reduced in the vertical direction. From this, it was proved that 35S: At2g43060SRDX chimera construct inhibits the longitudinal elongation of flower stem cells in Arabidopsis thaliana.

(1-5) Gene expression analysis in Arabidopsis thaliana plants transformed with 35S: At2g43060SRDX RNA was extracted from Arabidopsis thaliana plants transformed with 35S: At2g43060SRDX (Day 10 seedlings), and a reverse transcription reaction was performed using this as a template. CDNA was obtained.
Using this as a template, quantitative PCR reaction was performed to analyze the expression levels of EXP8 and EXT genes. Here, EXP8 is Arabidopsis thaliana-derived expansin, and ENT is Arabidopsis thaliana endoxyloglucan transferase, both of which are involved in the longitudinal elongation of cells. In quantitative PCR reactions, the expression level of Arabidopsis thaliana UBQ gene (ubiquitin gene), which is generally used as an internal standard, is set to 1, and the amount of the target gene expressed is quantified. The same applies to the following experiments.

As a sense primer for EXP8 PCR
5'-GTTCCTGTCTCTTTCCGAAGAG-3 '(SEQ ID NO: 13)
As an antisense primer
5'-TACGTCTCCTGCTCCTCCTA-3 '(SEQ ID NO: 14)
Was used.
As a sense primer for ENT PCR
5'-CCTTTGGAACATGTACCAGATCGT-3 '(SEQ ID NO: 15)
As an antisense primer
5'-GGTTGAATGGGAAACGTACTCCTA-3 '(SEQ ID NO: 16)
Was used.
The results of this quantitative PCR are shown in E and F of FIG. In Arabidopsis transformed with 35S: At2g43060SRDX, the expression levels of the enzyme genes EXP8 and ENT involved in the longitudinal elongation of the cells were reduced. This demonstrates that the 35S: At2g43060SRDX chimeric construct inhibits gene expression of enzymes involved in longitudinal cell growth in Arabidopsis thaliana.

(Example 2)
(2-1) Construction of Transformation Vector 35S: At2g43060 Using Arabidopsis At2g43060 cDNA as a template,
5 end upper primer
GATGGCCTCTGCAGACAAACTCATAAACAC (SEQ ID NO: 17)
3 end lower primer
GGGGTCGACTCATTTGGGAGATAAGCCATC (SEQ ID NO: 18)
Was used to amplify the full-length sequence of At2g43060 by PCR reaction. The PCR reaction was performed for 30 cycles, with a denaturation reaction at 94 ° C. for 1 minute, an annealing reaction at 50 ° C. for 1 minute, and an extension reaction at 72 ° C. for 3 minutes. This amplified fragment was cut with SmaI and inserted into the pBIG vector recovered by agarol gel electrophoresis. The sequence was confirmed, and the one with the At2g43060 gene introduced in the forward direction was selected to obtain 35S: At2g43060.

(2-2) Production of Plant Transformed with 35S: At2g43060 Transformation of Arabidopsis plants with 35S: At2g43060 is carried out by Transformation of Arabidopsis thaliana byvacuum inflation (http: //www.bch. htm). However, I did not use vacuum to infect it, but just dipped it. The plasmid was introduced into a soil bacterium [(Agrobacterium tumefaciens strain GV3101 (C58C1Rifr) pMP90 (Gmr) (koncz and Schell 1986)] strain by culturing in the 250 ml LB medium for 2 days. .
Subsequently, the bacterial cells were collected from the culture solution and suspended in 500 ml of an infection medium. In this solution, Arabidopsis thaliana grown for 14 days was soaked for 1 minute, infected, and then grown and seeded again. The collected seeds are sterilized with 50% bleach and 0.02% Triton X-100 solution for 7 minutes, rinsed three times with sterilized water, and the sterilized seeds are added to 1/2 MS selective medium containing 30 mg / l hygromycin. I was slaughtered.
A transformed plant growing on the hygromycin plate was selected, replanted in soil, and grown.

(2-3) Traits of Arabidopsis plants transformed with 35S: At2g43060 The traits of the plants transformed with 35S: At2g43060 are shown on the left side of FIG. The plant on the right side of A is wild type. This was similar to the plant transformed with 35S: At2g43060SRDX shown in FIGS. This demonstrates that the 35S: At2g43060 construct induces flower stem dwarfing in Arabidopsis without fusion with SRDX.

(2-4) Gene Expression Analysis in Arabidopsis Plants Transformed with 35S: At2g43060 RNA was extracted from Arabidopsis plants transformed with 35S: At2g43060 (Day 10 seedlings), and a reverse transcription reaction was performed using this as a template. CDNA was obtained.
Using this as a template, quantitative PCR reaction was performed to analyze the expression levels of EXP8 and EXT genes.
As a sense primer for EXP8 PCR
5'-GTTCCTGTCTCTTTCCGAAGAG-3 '(SEQ ID NO: 13)
As an antisense primer
5'-TACGTCTCCTGCTCCTCCTA-3 '(SEQ ID NO: 14)
Was used.
As a sense primer for ENT PCR
5'-CCTTTGGAACATGTACCAGATCGT-3 '(SEQ ID NO: 15)
As an antisense primer
5'-GGTTGAATGGGAAACGTACTCCTA-3 '(SEQ ID NO: 16)
Was used.
The results of this quantitative PCR are shown in FIGS. In Arabidopsis transformed with 35S: At2g4306S0, the expression levels of the enzyme genes EXP8 and ENT involved in the longitudinal elongation of the cells were decreased. This demonstrates that the 35S: At2g43060 construct inhibits gene expression of enzymes involved in longitudinal cell growth in Arabidopsis.

(Example 3)
(3-1) Preparation of tobacco plant transformed with 35S: At2g43060SRDX Tobacco transformation with 35S: At2g43060SRDX was performed by the leaf disk method.
The plasmid was introduced into a soil bacterium [(Agrobacterium tumefaciens strain GV3101 (C58C1Rifr) pMP90 (Gmr) (koncz and Schell 1986)] strain by culturing in the 100 ml LB medium for 2 days. .
Next, the bacterial cells are collected from the culture solution, suspended in 5 ml of LB medium, and immersed in a disc in which tobacco leaves grown in a sterile state are cut into approximately 1 cm squares for 5 minutes to be infected. After that, the cells were grown on MS plates for 2 days at 24 ° C. for 16 hours with a light period of 8 hours and a dark period. After that, the leaf disc was transplanted to a medium containing 0.5 mg / l of claforan, 1 mg / l of benzylaminopurine, and 100 mg / l of kanamycin, and sterilized and selected, and adventitious buds were formed. The formed adventitious buds were isolated and transplanted to a medium containing 0.5 mg / l of claforan, 1 mg / l of naphthalene acetic acid and 100 mg / l of kanamycin to induce rooting. The rooted individuals were transplanted to a medium containing kraforan 0.5 mg / l and kanamycin 100 mg / l, grown, and transplanted to soil when seeded to a certain extent, and then seeded. The collected seeds are sterilized with 50% bleach and 0.02% Triton X-100 solution for 7 minutes, rinsed three times with sterilized water, and the sterilized seeds are seeded in MS selective medium containing 100 mg / l kanamycin. did.
A transformed plant growing on the kanamycin plate was selected, replanted in soil, and grown.

(3-2) Traits of tobacco plants transformed with 35S: At2g43060SRDX The next generation traits of tobacco plants transformed with 35S: At2g43060SRDX are shown on the right side of FIG. The plant on the left side of A is a vector control. This showed a fertile morphology similar to the Arabidopsis plant transformed with 35S: At2g43060SRDX shown in FIGS. In addition, inhibition of internode elongation in transformed tobacco was observed throughout the vegetative and reproductive growth periods. The graph which investigated the plant height of the plant is shown to D of FIG. In the transformed plant, the plant height was 40% or more dwarf compared to the wild type. On the other hand, as shown in E of FIG. 3, the number of leaves formed in one individual was not decreased. From this, it was proved that the 35S: At2g43060SRDX construct induces stem elongation inhibition widely in tobacco, but does not affect the number of leaves formed.
FIG. 4B shows a view obtained by observing the morphology of epidermal cells of this transformed tobacco stem using a scanning electron microscope. C is a photograph of a wild-type stem taken at the same scale. Tobacco transformed with 35S: At2g43060SRDX showed significant reduction of stem cells in the vertical direction, similar to Arabidopsis thaliana introduced with this construct. From this, it was proved that the 35S: At2g43060SRDX chimeric construct inhibits the longitudinal elongation of stem cells even in tobacco.
A photograph of the shape of the transformed tobacco leaf taken from above is shown in FIG. FIG. 4A is a wild-type diagram. In the transformed tobacco, it was observed that the longitudinal elongation of the leaf was inhibited and the leaf was rounded. In order to show the change in leaf size more clearly, the length and width of three leaves were measured from the larger of each individual. The length of the leaves of the transformant was 0.5 when the control was 1. The lateral length was 0.7 to 1.0 when the control was set to 1. From this result, it was clearly shown that the elongation in the vertical direction was significantly suppressed rather than the lateral elongation of the leaves. In addition, since the change in plant height of the transformant is 0.2 to 0.45 when the control is 1, the suppression of stem elongation is more remarkable in this transformant than in the case of leaf size reduction. It became clear to be observed.

All publications, patents and patent applications cited in this specification shall be incorporated into this specification as they are.

Claims

A protein comprising the amino acid sequence of any one of the following (a) to (b), wherein the protein has a function of suppressing the elongation of plant cells;
(A) the amino acid sequence shown in SEQ ID NO: 1,
(B) an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1;
(C) an amino acid sequence encoded by the base sequence shown in SEQ ID NO: 2,
(D) an amino acid sequence encoded by a base sequence that hybridizes with a complementary sequence of the base sequence shown in SEQ ID NO: 2 under stringent conditions.
The protein according to claim 1, wherein the protein is a chimeric protein in which a transcription repression domain is bound to the C-terminal side thereof.
The transcriptional repression domain is a motif consisting of (L / F) DLN (L / F) (X) P (where X represents any amino acid residue) or "DLELLL". Protein.
The protein according to claim 2, wherein the transcription repression domain is a peptide having a plant transcription function, comprising an amino acid sequence represented by the following formula (I):
Formula (I)
X 1 -X 2 -Leu-Phe-Gly-Val-X 3
(Wherein X 1 and X 3 represent an amino acid sequence composed of 1 to 10 arbitrary amino acids, and X 2 represents Lys or Arg).
A nucleic acid molecule encoding the protein according to any one of claims 1 to 4.
An expression vector comprising the nucleic acid molecule according to claim 5.
A transformed cell into which the nucleic acid molecule according to claim 5 has been introduced in an expressible state.
A dwarfed transformed plant into which the nucleic acid molecule according to claim 5 has been introduced and its progeny.
A method for producing a protein having a function of suppressing the elongation of plant cells, comprising culturing and collecting the transformed cells according to claim 7.
A method for producing a dwarfed transformed plant, comprising introducing the nucleic acid molecule according to claim 5 into a plant cell and regenerating the plant from the plant cell.
A method for dwarfing a plant, characterized in that the nucleic acid molecule according to claim 5 is expressed in cells of a plant body.