CN107459565A

CN107459565A - Application of the soybean drought resisting GAP-associated protein GAP in regulating and controlling soybean drought resistance

Info

Publication number: CN107459565A
Application number: CN201710873361.0A
Authority: CN
Inventors: 矫永庆; 沈欣杰; 王岩岩; 包爱丽; 张永兴; 郭葳; 周新安
Original assignee: Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Current assignee: Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Priority date: 2017-09-25
Filing date: 2017-09-25
Publication date: 2017-12-12
Anticipated expiration: 2037-09-25
Also published as: CN107459565B

Abstract

The invention discloses application of the soybean drought resisting GAP-associated protein GAP in regulating and controlling soybean drought resistance.Soybean drought resisting GAP-associated protein GAP (GmSQE1) disclosed by the invention is following A1) or A2) or A3)：A1) amino acid sequence is the protein of sequence 1；A2) in the amino acid sequence of sequence 1 by substitution and/or missing and/or add that one or several amino acid residues obtain have identical function as A1) derived from protein；A3) in A1) or the obtained fused protein of N-terminal A2) or/and C-terminal connection label.It is demonstrated experimentally that compared with not turning the plant of GmSQE1 genes, the positive turns GmSQE1 gene plants after Osmotic treatment, shows drought-enduring character；And after rehydration processing, do not turn the plant death of GmSQE1 genes, and the positive turns GmSQE1 gene plant energy normal growths.Show, GmSQE1 and its encoding gene can improve the drought resistance of plant.

Description

Application of the soybean drought resisting GAP-associated protein GAP in regulating and controlling soybean drought resistance

Technical field

The present invention relates in biological technical field, application of the soybean drought resisting GAP-associated protein GAP in regulating and controlling soybean drought resistance.

Background technology

With global warming and increasing desertification of land, arid have become threaten Global Agriculture development and One and its important factor of grain security.Drought stress can cause the withered and depauperation of crops, in turn result in work The underproduction of thing.It is highly difficult to change the main trend of global warming in short time, so being cultivated by modern biotechnology means Crop with drought-resistant ability is a good solution route.

Soybean (Glycine max) is originate in China worldwide five big with important grain security status One of economical crops.China is global maximum Soybean import state and country of consumption, and soybean is to ensureing China's grease supply security Has ponderable strategic importance.Soybean can provide high-quality soybean oil, soybean vegetable protein to people.After soybean is processed Accessory substance soya-bean cake is applied by high-quality breeding feed is widely used as.But with global warming and freshwater resources Gradually deficient, arid generates important influence to soybean yields.Therefore, the soybean varieties pair with good drought-resistant character are cultivated Have great importance in Soybean production.At present, soybean drought resisting breeding is concentrated mainly on traditional crossbreeding and transgenosis is educated The aspect of kind technology two.Traditional crossbreeding is because excellent germplasm resourses with drought resistance is deficienter, and conventional hybridization breeding needs Constantly to hybridize the gregarious body of combo, find drought resisting Progeny plants after then taking segregating population, then constantly breeding is selected Stablize hereditary drought resisting offspring.The time-consuming length of traditional Soybean Cross-breeding, workload is big to be needed to put into substantial amounts of manpower and materials.And And traditional Soybean Cross-breeding is likely to result in parent and original merit is lost after drought-resistant character is obtained, such as Yield, plant type, disease resistance etc..Soybean transgene breeding can rapidly pass through plant on the premise of clear and definite drought resisting key gene Genetic transfoumation imported into anti-drought gene in the parent soybean kind with merit background, by transgenic positive The screening of soybean plant strain determines the homozygous Progeny plants of single copy gene insertion.Genetically engineered soybean Drought-resistant Breeding can facilitate, fast New soybean varieties of the incubation with clear and definite drought resistance of speed.Mainly concentrated for soybean transgene breeding on internal and international at present Antiweed is being cultivated, in terms of pest-resistant and regulation is grown.Reported at present in terms of soybean drought resisting transgenic breeding less.

The content of the invention

The technical problems to be solved by the invention are how to improve plant drought resistance.

In order to solve the above technical problems, the answering in plant drought resistance is regulated and controled present invention firstly provides drought resistant correlative protein With；The entitled GmSQE1 of the drought resistant correlative protein, be following A1) or A2) or A3)：

A1) amino acid sequence is the protein of sequence 1；

A2 it is) residual by substituting and/or lacking and/or add one or several amino acid in the amino acid sequence of sequence 1 Base obtain have identical function as A1) derived from protein；

A3) in A1) or the obtained fused protein of N-terminal A2) or/and C-terminal connection label.

In order that A1) in protein be easy to purify, what amino acid sequence that can be in by sequence table shown in sequence 1 formed The upper label as shown in table 1 of amino terminal or carboxyl terminal connection of protein.

The sequence of table 1, label

Label	Residue	Sequence
			Poly-Arg	5-6 (being usually 5)	RRRRR
Poly-His	2-10 (being usually 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned A2) in GmSQE1 protein, the substitution of one or several amino acid residues and/or missing and/or It is added to substitution and/or missing and/or addition no more than 10 amino acid residues.

Above-mentioned A2) in GmSQE1 protein can be artificial synthesized, also can first synthesize its encoding gene, then carry out biological expression Obtain.

Above-mentioned A2) in GmSQE1 protein encoding gene can by will in the DNA sequence dna shown in sequence 2 lack one Or the codon of several amino acid residues, and/or carry out the missense mutation of one or several base-pairs, and/or its 5 ' end and/ Or 3 ' end connect the coded sequence of label shown in table 1 and obtain.

Present invention also offers application of the biomaterial related to GmSQE1 in plant drought resistance is regulated and controled；

Any of the biomaterial, it is following B1) to B14)：

B1 GmSQE1 nucleic acid molecules) are encoded；

B2 B1) is contained) expression cassettes of the nucleic acid molecules；

B3 B1) is contained) recombinant vectors of the nucleic acid molecules；

B4 B2) is contained) recombinant vector of the expression cassette；

B5 B1) is contained) recombinant microorganisms of the nucleic acid molecules；

B6 B2) is contained) recombinant microorganism of the expression cassette；

B7 B3) is contained) recombinant microorganism of the recombinant vector；

B8 B4) is contained) recombinant microorganism of the recombinant vector；

B9 B1) is contained) the transgenic plant cells systems of the nucleic acid molecules；

B10 B2) is contained) the transgenic plant cells system of the expression cassette；

B11 B1) is contained) Transgenic plant tissues of the nucleic acid molecules；

B12 B2) is contained) Transgenic plant tissue of the expression cassette；

B13 B1) is contained) the genetically modified plants organs of the nucleic acid molecules；

B14 B2) is contained) the genetically modified plants organ of the expression cassette.

In above-mentioned application, B1) nucleic acid molecules can be following b1), b2), b3) or b4) shown in gene：

B1) nucleotide sequence is the cDNA molecules or DNA molecular of sequence 2 in sequence table；

B2) nucleotide sequence is the cDNA molecules or DNA molecular of sequence 3 in sequence table；

B3) and b1) or b2) or the nucleotide sequence that limits there is 75% or more than 75% homogeneity, and coding GmSQE1 CDNA molecules or genomic DNA molecule；

B4) under strict conditions with b1) or b2) limit nucleotide sequence hybridization, and encode GmSQE1 cDNA molecules Or genomic DNA molecule.

Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules also may be used To be RNA, such as mRNA or hnRNA.

Wherein, the GmSQE1 protein shown in the DNA molecular coded sequence 1 shown in sequence 2.

Those of ordinary skill in the art can be easily using known method, such as the side of orthogenesis and point mutation Method, the nucleotide sequence of the coding GmSQE1 protein of the present invention is mutated.Those by manually modified, have and this The nucleotide sequence 75% of isolated GmSQE1 protein or the nucleotides of higher homogeneity are invented, as long as coding GmSQE1 protein and there is GmSQE1 protein functions, be the nucleotide sequence derived from the present invention and be equal to this hair Bright sequence.

Term " homogeneity " used herein refers to the sequence similarity with native sequence nucleic acid." homogeneity " includes and this hair Shown in bright coded sequence 1 amino acid sequence composition protein nucleotide sequence have 75% or higher, or 85% or It is higher, or 90% or higher, or the nucleotide sequence of 95% or higher homogeneity.Homogeneity can with the naked eye or computer software Evaluated.Using computer software, homogeneity between two or more sequences can use percentage (%) to represent, it can be with For evaluating the homogeneity between correlated series.

In above-mentioned application, the stringent condition is in 2 × SSC, 0.1%SDS solution, hybridizes at 68 DEG C and washes film 2 times, each 5min, and in 0.5 × SSC, 0.1%SDS solution, hybridize at 68 DEG C and wash film 2 times, each 15min； Or, in 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS solution, hybridize under the conditions of 65 DEG C and wash film.

Above-mentioned 75% or more than 75% homogeneity, can be 80%, 85%, 90% or more than 95% homogeneity.

In above-mentioned application, B2) described in the nucleic acid molecules containing coding GmSQE1 protein expression cassette (GmSQE1 genes Expression cassette), it is to refer to express GmSQE1 protein DNAs in host cell, the DNA not only may include to start GmSQE1 bases Because of the promoter of transcription, the terminator for terminating GmSQE1 genetic transcriptions may also include.Further, the expression cassette may also include increasing Hadron sequence.Promoter available for the present invention includes but is not limited to：Constitutive promoter, tissue, organ and development are special Promoter, and inducible promoter.The example of promoter includes but is not limited to：The constitutive promoter of cauliflower mosaic virus 35S：Wound-inducible promoter from tomato, leucine aminopeptidase (" LAP ", Chao et al. (1999) Plant Physiol 120：979-992)；Chemical inducible promoter from tobacco, pathogenesis correlation 1 (PR1) (by salicylic acid and BTH (diazosulfide -7- carbothioic acid S-methyl esters) is induced)；Tomato protease inhibitors II promoters (PIN2) or LAP are opened Mover (available methyl jasmonate induction)；Heat-shock promoters (United States Patent (USP) 5,187,267)；Tetracycline-inducible starts Sub (United States Patent (USP) 5,057,422)；Seed specific promoters, such as Millet Seed specificity promoter pF128 (CN101063139B (Chinese patent 200710099169.7)), the special promoter of seed storage protein matter is (for example, Kidney bean ball (Beachy et al. (1985) EMBO is J.4 for albumen, napin, oleosin and soybean beta conglycin promoter：3047- 3053)).They can be used alone or are used in combination with other plant promoters.All references cited herein is complete Text is quoted.Suitable transcription terminator includes but is not limited to：Agrobacterium nopaline syntase terminator (NOS terminator), flower coconut palm Cauliflower mosaic virus CaMV 35S terminators, tml terminators, pea rbcS E9 terminators and nopaline and octopine synthase Terminator (see, e.g.：Odell et al. (I⁹⁸⁵)Nature313:810；Rosenberg et al. (1987) Gene, 56:125； Guerineau et al. (1991) Mol.Gen.Genet, 262:141；Proudfoot(1991)Cell,64:671；Sanfacon Et al. Genes Dev., 5:141；Mogen et al. (1990) Plant Cell, 2:1261；Munroe et al. (1990) Gene, 91:151；Ballad et al. (1989) Nucleic Acids Res.17:7891；Joshi et al. (1987) Nucleic Acid Res.,15:9627)。

The recombinant vector of the GmSQE1 expression casettes can be contained with existing expression vector establishment.The plant expression Carrier includes double base agrobacterium vector and the carrier available for plant micropellet bombardment etc..As pAHC25, pBin438, PCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or PCAMBIA1391-Xb (CAMBIA companies) etc..The plant expression vector can also include 3 ' end non-translational regions of foreign gene Domain, i.e., comprising polyadenylation signals and the DNA fragmentation of any other participation mRNA processing or gene expression.The polyadenylic acid letter Number bootable polyadenylic acid is added to 3 ' ends of mRNA precursor, as Agrobacterium crown gall nodule induces (Ti) plasmid gene (such as nopaline Synthase gene Nos), plant gene (such as soybean storage protein genes) 3 ' end transcription non-translational region be respectively provided with similar functions. During using gene constructed plant expression vector of the invention, enhancer, including translational enhancer or transcriptional enhancer also can be used, These enhancer regions can be ATG initiation codon or neighboring region initiation codon etc., but must be read with coded sequence Frame is identical, to ensure the correct translation of whole sequence.The source of the translation control signal and initiation codon be it is extensive, It can be natural or synthesis.Translation initiation region can come from transcription initiation region or structural gene.In order to just In transgenic plant cells or plant are identified and screened, plant expression vector used can be processed, can as added The coding expressed in plant can produce the enzyme of color change or gene (gus gene, the luciferase genes of luminophor Deng), the marker gene of antibiotic (as assigned to kanamycins and the nptII genes of associated antibiotic resistance, assigned to herbicide The bar genes of phosphinothricin resistance, the hph genes to antibiotic hygromycin resistance are assigned, and assigned to methotrexate resistance Dhfr genes, assign the EPSPS genes to glyphosate) or (such as anti-herbicide base such as anti-chemical reagent marker gene Cause), provide metabolism mannose ability mannose-6-phosphate isomerase gene., can not from the security consideration of genetically modified plants Add any selected marker, transformed plant is directly screened with adverse circumstance.

In above-mentioned application, the carrier can be plasmid, sticking grain, bacteriophage or viral vector.The plasmid concretely carries Body pGWC or plasmid pB2GW7.0.

Concretely GmSQE1-pGWC or GmSQE1-pB2GW7.0, the GmSQE1-pGWC are to incite somebody to action to the recombinant vector DNA fragmentation shown in sequence 2 imports in carrier pGWC obtained recombinant vector, and the GmSQE1-pB2GW7.0 is by the institute of sequence 2 The DNA fragmentation shown imports in plasmid pB2GW7.0 obtained recombinant vector, shown in the GmSQE1-pGWC energy expressed sequence 1 GmSQE1 protein.

In above-mentioned application, the microorganism can be yeast, bacterium, algae or fungi.Wherein, bacterium can be Agrobacterium, such as agriculture Bacillus EHA105.

In above-mentioned application, the transgenic plant cells system, Transgenic plant tissue and genetically modified plants organ do not wrap Include propagating materials.

Present invention also offers application of the GmSQE1 or described biomaterials in drought resistance enhancing plant is cultivated.

Present invention also offers a kind of method for cultivating drought resistance enhancing plant, methods described includes：Increase purpose plant GmSQE1 content in middle GmSQE1 activity, increase purpose plant, promote GmSQE1 encoding gene expression, obtain and institute State the drought-resistant plant that purpose plant compares drought resistance enhancing.

In the above method, the drought-resistant plant can be to be obtained by importing GmSQE1 encoding gene into the purpose plant The genetically modified plants arrived.

In the above method, GmSQE1 encoding gene can be B1) nucleic acid molecules.

Present invention also offers the product of regulation and control plant drought resistance, the product contains GmSQE1 or described biomaterials.

The product can be using GmSQE1 or described biomaterials as its active component, can also be by GmSQE1 or described biologies Material has the material of identical function together as its active component with other.

Present invention also offers application of the product in plant drought resistance is regulated and controled.

In the present invention, the plant can be dicotyledon or monocotyledon；The purpose plant can be dicotyledonous plant Thing or monocotyledon.The dicotyledon can be legume.The legume can be soybean, as soybean varieties day is grand No.1.

In the present invention, the genetically modified plants are interpreted as not only including and obtain the GmSQE1 genetic transformation purpose plant First generation genetically modified plants, also including its filial generation.For genetically modified plants, the gene can be bred in the species, also may be used The gene transfer is entered to other kinds of same species with traditional breeding method, particularly including in commercial variety.It is described to turn base Because plant includes seed, callus, intact plant and cell.

It is demonstrated experimentally that compared with not turning the plant of GmSQE1 genes, the positive turns GmSQE1 gene plants after Osmotic treatment, Show drought-enduring character；And after rehydration processing, do not turn the plant death of GmSQE1 genes, and the positive turns GmSQE1 gene plant energy Normal growth.Show, GmSQE1 and its encoding gene can improve the drought resistance of plant.

Brief description of the drawings

Fig. 1 is the result that anti-phosphine oxamate transgenosis test strips screen positive transgenic soybean.

Fig. 2 is the Identification of Drought of genetically engineered soybean.

Embodiment

The present invention is further described in detail with reference to embodiment, the embodiment provided is only for explaining The bright present invention, the scope being not intended to be limiting of the invention.Experimental method in following embodiments, unless otherwise specified, it is Conventional method.Material used, reagent, instrument etc., unless otherwise specified, are commercially obtained in following embodiments. Quantitative test in following examples, it is respectively provided with and repeats to test three times, results averaged.

PGWC (Huang et al., Cloning and Expression Analysis of in following embodiments The Soybean CO-Like Gene GmCOL9, Plant Mol Biol Rep (2011) 29:352-359), the public can be from The biomaterial is obtained at applicant, the biomaterial is only attached most importance to used in the related experiment of duplicate invention, can not be used as other use Way uses.

CCM fluid nutrient mediums in following embodiments, 1L contain B-5 powder 0.321g, MES 5.9g, the organic 9ml of 100*B5, Sucrose 30g, Na₂S₂O₃Solution 1ml, L-cys solution 4ml, DTT solution 1ml, AS solution 2ml, 6-BA solution 1.67ml and GA3 is molten The μ l of liquid 100, surplus is water.CCM solid mediums are that the culture medium that agar powder obtains, PH=are added into CCM fluid nutrient mediums 5.4。

Liquid bud inducement cultivation base in following embodiments, 1L contain B-5 powder 3.21g, MES 0.59g, sucrose 30g, Timentin solution 1ml, 6-BA solution 1.12ml and Cef solution 0.4ml, surplus is water.SIM solid mediums are to liquid The culture medium that agar powder and the μ l/500ml of PPT solution 500 are obtained is added in bud inducement cultivation base.

Solid bud elongation medium in following embodiments, it is organic that 1L contains MS 4.43g, MES 0.59g, 100*B5 9ml, μ l of sucrose 30g, IAA solution 100, μ l of Cef solution 400, μ l of GA3 solution 600, μ l of PPT solution 400, Glu solution 1ml, Timentin solution 1ml, ZR solution 1ml, Asp solution 1ml and agar powder, surplus are water, PH=5.6.

Root media in following embodiments, 1L contain the organic 9ml of MS 2.22g, MES 0.59g, 100*B5, sucrose μ l of 20g, Cef solution 400, Timentin solution 1ml, IBA solution 1ml, Glu solution 1ml, Asp solution 1ml and agar powder, Surplus is water, PH=5.7.

Wherein, per 500ml 100*B5 it is organic containing：Inositol (myo-lnositol) 5g, nicotinic acid (Nicotinic acid) 0.05g, hydrochloric acid pyridoxic acid (vitamin B6) 0.05g, thiamine hydrochloride (Thiamine hydrochloride) 0.5g, surplus are Water.

Na₂S₂O₃(sodium thiosulfate) solution：3.16g Na₂S₂O₃/ 20ml, distillation are water-soluble.

L-cys (Cys) solution：10g L-cys/100ml, distillation are water-soluble.

DTT (dithiothreitol (DTT), DL-Dithiothreitol) solution：3.08g DTT/20ml, with the 3M NaAC aqueous solution It is molten.

AS (acetosyringone) solution：0.392g AS/20ml, 95% ethanol water are molten.

6-BA (6- benzyls aminoadenine) solution：1mg6-BA/ml, first a small amount of 1M NaOH aqueous dissolutions, rear distilled water Constant volume.

GA3 (gibberellin) solution：1mg GA3/ml, 95% ethanol water are molten.

Temetime (Ticarcillin/Clavulanate Acid) solution：80mg Temetime/ml, distillation are water-soluble.

Cef (cephalo) solution：250mg Cef/ml, distillation are water-soluble.

IAA (heteroauxin) solution：1mg IAA/ml, first a small amount of 95% ethanol water dissolving, rear distilled water constant volume.

PPT (herbicide-glufosinate-ammonium, Glufosinate-ammonium) solution：5mg PPT/ml, distillation are water-soluble.

Glu (glutamic acid) solution：50mg Glu/ml, distillation are water-soluble.

ZR (anti-Maize kernel thuja acid) solution：1mg ZR/ml, first a small amount of 1M HCl solutions dissolving, rear distilled water constant volume.

Asp (aspartic acid) solution：50mg Asp/ml, first a small amount of 1M HCl/waters solution dissolving, rear distilled water constant volume.

IBA (indolebutyric acid) solution：1mg IBA/ml, 95% ethanol solution are molten.

Embodiment 1, soybean drought resisting GAP-associated protein GAP GmSQE1 can be with regulating and controlling soybean drought resistances

The soybean drought resisting GAP-associated protein GAP from soybean varieties willam82 is present embodiments provided, is named as GmSQE1, GmSQE1 sequence are sequence 1 in sequence table.In soybean varieties willam82, GmSQE1 CDS sequences are sequence Sequence 2 in table, genome sequence are classified as sequence 3 in sequence table.

DNA molecular (i.e. GmSQE1 encoding genes) shown in sequence 2 is gone in soybean and detects GmSQE1 in regulating and controlling soybean In function, specific method is as follows：

1st, GmSQE1 expression recombinant vectors and recombinant bacterium are built

Utilize sense primer (F:AGGCTTTGACTTTAGGTC ATGATGGGTTATGAGTATATTTTGG) and downstream draw Thing (R:GTCTAGAGACTTTAGGTC TTAATCTTCCAAATTGGTAGGG) composition primer pair to soybean varieties willam82 CDNA enter performing PCR amplification, obtained PCR primer is made by way of homologous recombination and intermediate carrier pGWC generations are homologous heavy Group, the GmSQE1 encoding genes shown in sequence 2 are transferred on intermediate carrier pGWC, the restructuring containing correct sequence that will be obtained Carrier is named as GmSQE1-pGWC.

The mode of homologous recombination is by GmSQE1-pGWC and plasmid pB2GW7.0 (Fibrillin 5Is Essential for Plastoquinone-9Biosynthesis by Binding to Solanesyl Diphosphate Synthases in Arabidopsis gateway reactions) are carried out, the correct recombinant vector of sequence is obtained, the recombinant vector is named as GmSQE1- PB2GW7.0, GmSQE1-pB2GW7.0 are that GmSQE1 expresses recombinant vector, the GmSQE1 shown in energy expressed sequence 1.

GmSQE1-pB2GW7.0 is imported in Agrobacterium tumefaciems EHA105, recombinant bacterium is obtained, the recombinant bacterium is named as EHA105/GmSQE1-pB2GW7.0；PB2GW7.0 is imported in Agrobacterium tumefaciems EHA105, obtains recombinant bacterium EHA105/ GmSQE1, as empty vector control.

2nd, the structure of genetically engineered soybean

The grand No.1 in recombinant bacterium EHA105/GmSQE1-pB2GW7.0 soybean transformation kinds day is utilized by Agrobacterium infestation method Genetically engineered soybean is obtained, and turns empty carrier plant as control by the use of what recombinant bacterium EHA105/GmSQE1 was obtained, specific method is such as Under：

2.1 Agrobacteriums infect the preparation of liquid：

Recombinant bacterium is added into the LB fluid nutrient mediums containing rifampin (50ng/L) and spectinomycin (50ng/L), 28 DEG C, 200rpm, it is incubated overnight.Period detects bacterial concentration, when OD600 values reach 1.2-1.5,4000rpm, centrifuges 10min, receives Collect thalline.CCM fluid nutrient mediums (Co-culture Medium, CCM) are resuspended in, OD600 to 0.6 or so is adjusted, obtains thalline Suspension, it is standby.

The preparation of 2.2 explants：

Select the seed that full, surface is smooth, the grand No.1 in the soybean varieties day of disease-free scar is ripe, chlorination 5h standby With.Sterilized soya seeds are immersed in sterilized water, at room temperature overnight, with scalpel by the soya seeds after immersion along Hilum is divided into two from centre, it is ensured that cotyledon both sides embryo is complete, removes kind of a skin, cuts most of hypocotyl, only stays close to cotyledon 3-5mm hypocotyls, 1-3 knives are drawn in the range of cotyledon and plumular axis junction diameter about 3mm.Obtain half with complete embryo Seed is as explant.

2.3 Agrobacteriums infect explant and co-cultivation：

The explant that step 2.2 is obtained is dipped in the thalline suspension that step 2.1 obtains, at 28 DEG C, 200rpm conditions Under infect 30min after, explant is taken out, drying to surface does not have obvious bacterium solution, is layered on and is placed with nothing by the explant outside of belly down On the CCM solid mediums of bacterium filter paper, in 26 DEG C of light cultures three days.

The cleaning of 2.4 explants and the induction of Multiple Buds：

After light culture terminates, successively with sterilized water and liquid bud inducement cultivation base (Shoot Induction Mediium, SIM the bacterium solution on explant surface) is cleaned, excessive moisture is sucked on aseptic filter paper, will be grown up with scalpel during light culture Hypocotyl block again, only stay the 3-5mm hypocotyls close to cotyledon, and the newborn bud near growing point is scraped off with knife, finally, will The explant handled well is with cut side up, and down, about 45 degree of angle oblique cuttings enter SIM solid mediums and carry out screening and culturing cotyledonary node, Sealing, place culturing room's culture, 26 DEG C of cultivation temperature, photoperiod 16h/8h.Once, subculture three times, obtains subculture altogether every two weeks Induce the explant of Multiple Buds.

The elongation of 2.5 Multiple Buds and take root：

The explant of Multiple Buds will be induced, after cutting cotyledon, access solid bud elongation medium (Shoot Elongation Mediium, SEM) in, 26 DEG C of cultivation temperature, photoperiod 16h/8h.Every two weeks subculture once, optionally subculture 3-5 times.During each subculture, the tissue of outer layer browning blackening is wiped off with pocket knife, solid SEM is accessed after exposing nexine chlorenchyma In.When Multiple Buds are elongated to 5cm or so, it is cut from explant, and access root media (Rooting Mediium, RM taken root in).

2.6 hardenings and transplanting：

After the seedling well developed root system of step 2.5, the lid of blake bottle is opened, in tissue culture room hardening, keeps its growth Ambient humidity, seedling is removed into culture medium after 3 days, the culture medium of root is rinsed well, transplantation of seedlings is entered into soil (Nutrition Soil： Vermiculite ratio is 1：2) in, and preservative film moisturizing is covered, film, 25 DEG C of cultivation temperature, photoperiod 16h/8h is taken off after 3 days.Pay attention to liquid manure Deng management, wait seedling some cans sampling of slightly growing up identifies whether be positive plant.

2.7 transfer-gen plants are identified：

By using special anti-phosphine oxamate transgenosis test strips of the identification with basta resistances, soybean gene group is carried out The aspect of PCR amplifications two determines whether transfer-gen plant there is anti-basta Herbicid resistants to screen positive transgenic soybean.Its In, PCR amplification the primers are F：5’-CAAAACCAAGAGTGGACAAGA-3’；R:5’-AAGGATCACCCAAGATAACGT- 3’.It is that positive plant (i.e. positive transgenic soybean) is further tested by two kinds of experimental results, anti-phosphine oxamate turns The testing result of gene test strips is as shown in Figure 1.

3rd, the Identification of Drought of genetically engineered soybean

Three independent positive transgenic soybean strains (line-1, line-2 and line-3) that step 2 is obtained and right The grand No.1 in soybean varieties day according to non-transgenosis (CK) and turn empty carrier plant, uniformly done after 50 days after seed sprouting Non-irrigated Stress treatment, at least 10 plants of every kind of soybean, specific Stress treatment is as follows：

1) before processing is uniformly watered, and ensures the soil moisture content of before processing between each basin young plant (T2 is for transgenosis young plant) It is basically identical；

2) the soybean young plant of processing is positioned over 26 degree of room temperature, incubated the inside of humidity 50%, periodicity of illumination is white In 16 hours daytimes/dark 8h, during which do not water, carry out Osmotic treatment, coprocessing 8 days；

3) Osmotic treatment observes phenotype after 8 days, and then normal watering, irrigation amount all same, carries out rehydration processing；

4) rehydration observes phenotype after handling 8 days.

As a result show, the upgrowth situation of each middle plant of before processing is basically identical.After Osmotic treatment 8 days, soybean varieties day is grand No.1 is turned to be yellow with turning the blade of empty carrier plant, is sagging, withered, and three independent positive transgenic soybean strains only have portion The yellow leaf of the foot of point plant, all blades of plant do not occur it is improper it is sagging with it is withered.Rehydration is handled 8 days Afterwards, the grand No.1 in soybean varieties day is dead with turning empty carrier plant, and three independent positive transgenic soybean strains can be just It is frequently grown.Show, GmSQE1 and its encoding gene can improve the drought resistance of soybean.Wherein, positive transgenic soybean strain with The result of the grand No.1 in soybean varieties day (CK) is as shown in Figure 2.

<110>Inst. of Oil Crops, Chinese Academy of Agriculture

<120>Application of the soybean drought resisting GAP-associated protein GAP in regulating and controlling soybean drought resistance

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 529

<212> PRT

<213>Soybean

<400> 1

Met Met Gly Tyr Glu Tyr Ile Leu Gly Gly Ile Ile Ala Ser Ser Leu

1 5 10 15

Val Leu Val Phe Val Ile Tyr Gly Ser Val Ser Lys Arg Lys Ala Lys

20 25 30

Ser Ser Val His Ala Glu Ser Asn Gly Gly Ser Ile Ile Arg Thr Ser

35 40 45

Pro Glu Asn Gly Asn His His Gln Glu Ile Ser Glu Thr Thr Asp Val

50 55 60

Ile Ile Val Gly Ala Gly Val Ala Gly Ala Ala Leu Ala Tyr Thr Leu

65 70 75 80

Gly Lys Glu Gly Arg Arg Val His Val Ile Glu Arg Asp Leu Thr Glu

85 90 95

Pro Asp Arg Ile Val Gly Glu Leu Leu Gln Pro Gly Gly Tyr Leu Lys

100 105 110

Leu Ile Glu Leu Gly Leu Gln Asp Cys Val Gly Glu Ile Asp Ala Gln

115 120 125

Pro Val Phe Gly Tyr Ala Leu Tyr Lys Asp Gly Lys Asn Thr Lys Leu

130 135 140

Ser Tyr Pro Leu Glu Asn Phe Ala Ser Asp Val Ser Gly Arg Ser Phe

145 150 155 160

His Asn Gly Arg Phe Ile Gln Arg Met Arg Glu Lys Ala Ser Ser Leu

165 170 175

Pro Asn Val Lys Leu Glu Gln Gly Thr Val Thr Phe Leu Leu Glu Glu

180 185 190

Asp Arg Ile Ile Lys Gly Val Asn Phe Lys Thr Lys Ser Gly Gln Glu

195 200 205

Leu Thr Ala Lys Ala Pro Leu Thr Ile Val Cys Asp Gly Cys Phe Ser

210 215 220

Asn Leu Arg Arg Ser Leu Cys Asn Pro Lys Val Asp Val Pro Ser His

225 230 235 240

Phe Val Gly Leu Val Leu Glu Asn Cys Asn Leu Pro Tyr Ala Asn His

245 250 255

Gly His Val Ile Leu Gly Asp Pro Ser Pro Ile Leu Phe Tyr Pro Ile

260 265 270

Ser Ser Thr Glu Ile Arg Cys Leu Val Asp Val Pro Gly His Lys Leu

275 280 285

Pro Ser Leu Gly Asn Gly Asp Met Ala Arg Tyr Leu Lys Thr Val Val

290 295 300

Ala Pro Gln Val Pro Pro Glu Leu Arg Asp Ser Phe Ile Ala Ala Val

305 310 315 320

Glu Lys Gly Asn Ile Arg Ser Met Pro Asn Arg Ser Met Pro Ala Ser

325 330 335

Pro Tyr Pro Thr Pro Gly Ala Leu Leu Met Gly Asp Ala Phe Asn Met

340 345 350

Arg His Pro Leu Thr Gly Gly Gly Met Thr Val Ala Leu Ser Asp Ile

355 360 365

Val Leu Leu Arg Asn Leu Leu Arg Pro Leu His Asp Leu His Asp Ala

370 375 380

Asn Ala Leu Cys Lys Tyr Leu Glu Ser Phe Tyr Thr Leu Arg Lys Pro

385 390 395 400

Val Ala Ser Thr Ile Asn Thr Leu Ala Gly Ala Leu Tyr Lys Val Phe

405 410 415

Cys Ala Ser Pro Asp Pro Ala Ser Lys Glu Met Arg Gln Ala Cys Phe

420 425 430

Asp Tyr Leu Ser Leu Gly Gly Val Phe Ser Asp Gly Pro Ile Ala Leu

435 440 445

Leu Ser Gly Leu Asn Pro Arg Pro Leu Ser Leu Val Leu His Phe Phe

450 455 460

Ala Val Ala Ile Tyr Gly Val Gly Arg Leu Leu Ile Pro Phe Pro Ser

465 470 475 480

Pro Lys Arg Met Trp Ile Gly Ala Arg Leu Ile Ser Gly Ala Ser Ala

485 490 495

Ile Ile Phe Pro Ile Ile Lys Ala Glu Gly Ile Arg Gln Met Phe Phe

500 505 510

Pro Val Thr Val Pro Ala Tyr Tyr Arg Thr Pro Pro Thr Asn Leu Glu

515 520 525

Asp

<210> 2

<211> 1590

<212> DNA

<213>Soybean

<400> 2

atgatgggtt atgagtatat tttgggaggc attatagctt ctagcttggt gcttgtgttt 60

gttatatatg gttctgtatc aaagaggaag gccaaaagtt cagtacatgc agaaagtaat 120

ggtggtagta ttataaggac atcaccagaa aatggaaacc accatcaaga aatctcagaa 180

actacggacg tcatcattgt cggtgctggg gttgctggcg cagcccttgc ttacacactt 240

ggcaaggaag gaaggcgagt gcatgttatt gaaagggact tgactgaacc agacaggatt 300

gtgggggaat tgctacaacc tggggggtat cttaagttaa ttgaattggg tctccaagat 360

tgtgtgggtg agattgatgc tcagccagtc tttggctatg ctctttacaa ggacgggaaa 420

aatactaagc tttcttaccc cttggaaaat tttgcctctg atgtttctgg aagaagcttt 480

cacaatggcc gtttcataca aaggatgcgc gaaaaggctt catctcttcc aaatgtaaaa 540

ttagaacaag gaactgtcac atttctacta gaagaagata gaatcatcaa aggggtaaac 600

ttcaaaacca agagtggaca agagctcaca gctaaggctc ccctcaccat tgtatgtgat 660

ggctgttttt ccaacctgag acgttctctt tgcaacccaa aggttgatgt accatctcat 720

tttgttggtc tggtcctaga gaactgcaat cttccatatg caaaccacgg gcacgttatc 780

ttgggtgatc cttctcccat tttgttttat cccatcagta gcactgagat tcggtgtttg 840

gttgatgtgc ctggccataa attaccttcc cttggcaatg gtgacatggc ccgttatttg 900

aaaacagtag tagctcccca ggttcctcca gagctgcgtg actcttttat agcagcagtt 960

gagaaaggaa acataagaag catgccaaac agaagcatgc ccgcatctcc ttatcccaca 1020

cctggtgccc ttctcatggg agatgccttc aacatgcgtc accctttaac cggaggggga 1080

atgactgtgg ctttgtctga cattgttttg ctaaggaacc ttcttagacc cctgcatgat 1140

ctgcatgacg ctaatgctct ttgcaaatat cttgaatcat tctacaccct acgcaagcca 1200

gtggcatcta caataaacac attagctggg gcattgtaca aggtgttttg tgcatcccct 1260

gatccagcta gtaaggaaat gcgccaggca tgttttgatt atttaagcct tggaggtgtt 1320

ttctcagatg gaccaattgc tctactctct ggtctaaatc ctcgtccatt aagcttggtt 1380

ctccacttct ttgccgtggc tatatatggt gttggtcgct tactcatacc attcccttct 1440

ccaaaacgaa tgtggattgg agctagattg atttccggtg cctctgctat cattttcccc 1500

attatcaagg ccgaaggaat tagacaaatg ttcttcccag taactgtgcc agcgtattac 1560

agaacacccc ctaccaattt ggaagattaa 1590

<210> 3

<211> 3323

<212> DNA

<213>Soybean

<400> 3

atgatgggtt atgagtatat tttgggaggc attatagctt ctagcttggt gcttgtgttt 60

gttatatatg gttctgtatc aaagaggaag gccaaaagtt cagtacatgc agaaagtaat 120

ggtggtagta ttataaggac atcaccagaa aatggaaacc accatcaaga aatctcagaa 180

actacggacg tcatcattgt cggtgctggg gttgctggcg cagcccttgc ttacacactt 240

ggcaaggtag aacaaacctt ttcttgacac gactttgtga aatctaatcc atatgtgtga 300

tgttttttct tagttactac ctgcaaatat gttttgattc atagatatat gcaaaactta 360

tgttgaggta aaataataac aataacaatt atgttagaaa gtcatgtttg attgccagaa 420

agtagaggtt ggaagataga agagtagttt tctaagtgtt attctgaatg aaattataca 480

agtgatacag ttataagtta taaccttata taggcttcat agaacattta ttctaaagat 540

agatttccca tttttttttt attttcattt tcatgaatat atttttcttg caaccagaca 600

aaaacatgaa aagttaaact gtggaaagtc caagatctct tcctttccat gatctgttct 660

tagaaccaca acacaaacta catatgcagt cagattcaga cttctagtta tatataaact 720

ttatggtaat ttaaaagaat ggtctaaaat atttttacac aatgaatcat atagtttgtg 780

ttgtaaaagg atcaatgatg ttggtctatg gttcttgctt caggaaggaa ggcgagtgca 840

tgttattgaa agggacttga ctgaaccaga caggattgtg ggggaattgc tacaacctgg 900

ggggtatctt aagttaattg aattgggtct ccaaggtaac caagcaagaa acatgtcaca 960

tattatgtca cataagtaga tgtatggaag attgtgtgag aattgaagta atcaatctta 1020

ggtgtgaact cccttgcctt tgcttgtcaa attcaaggct cttattaaca gattaagttg 1080

tgagttgttt cagattgtgt gggtgagatt gatgctcagc cagtctttgg ctatgctctt 1140

tacaaggacg ggaaaaatac taagctttct taccccttgg aaaattttgc ctctgatgtt 1200

tctggaagaa gctttcacaa tggccgtttc atacaaagga tgcgcgaaaa ggcttcatct 1260

cttccaaagt acagactctt atcatccttt ttcaaaaact gtttctgaaa aggatttttt 1320

tttattaaat cctttccttc cgttacttgc tcttattgtt ccaaattttg tgcagtgtaa 1380

aattagaaca aggaactgtc acatttctac tagaagaaga tagaatcatc aaaggggtaa 1440

acttcaaaac caagagtgga caagagctca cagctaaggc tcccctcacc attgtatgtg 1500

atggctgttt ttccaacctg agacgttctc tttgcaaccc aaaggtaact atgctgtttt 1560

ttttattatt atttatgtta aaagtgtgaa atatattctg actttgttga tgattaattt 1620

ccattgaaaa attggttgac cattttagta gtcttctctt ctaatggtgt ttttttttct 1680

gtcacaaggc tccaagccaa gactttactt ataggtccga gtccaagtca agctaactta 1740

atgttggtat ctatttgtct ttgctagtac ttagatgggt ttatttgttt atttatttat 1800

gcaggttgat gtaccatctc attttgttgg tctggtccta gagaactgca atcttccata 1860

tgcaaaccac gggcacgtta tcttgggtga tccttctccc attttgtttt atcccatcag 1920

tagcactgag attcggtgtt tggttgatgt gcctggccat aaattacctt cccttggcaa 1980

tggtgacatg gcccgttatt tgaaaacagt agtagctccc caggtacaaa tatcctagtc 2040

tttggcttgg cttaatattc aaaacatgga acatattctt caattccact aatggaggaa 2100

attgtgtttt aggttcctcc agagctgcgt gactctttta tagcagcagt tgagaaagga 2160

aacataagaa gcatgccaaa cagaagcatg cccgcatctc cttatcccac acctggtgcc 2220

cttctcatgg gagatgcctt caacatgcgt caccctttaa ccggaggggg aatgactgtg 2280

gctttgtctg acattgtttt gctaaggaac cttcttagac ccctgcatga tctgcatgac 2340

gctaatgctc tttgcaaata tcttgaatca ttctacaccc tacgcaaggt taatatatat 2400

ataatcgaaa gagtttaata gtcatgcacc ttagaataaa agtattttct ttataaacta 2460

attagaaaac atccttattc cttagtatgc agtactatga ctttggtggt tattataaaa 2520

gtgaacgagt ttatcttaca tgacagtttg taattgaata atcgtataag aaacctttac 2580

attgttttct taaccaaata ccctgtcatg ttttatcagt attggtttga gcaaatttaa 2640

taggtggttc ttgattgtgt ttgcagccag tggcatctac aataaacaca ttagctgggg 2700

cattgtacaa ggtgttttgt gcatcccctg atccagctag taaggaaatg cgccaggcat 2760

gttttgatta tttaagcctt ggaggtgttt tctcagatgg accaattgct ctactctctg 2820

gtctaaatcc tcgtccatta agcttggttc tccacttctt tgccgtggct atatatggtg 2880

ttggtcgctt actcatacca ttcccttctc caaaacgaat gtggattgga gctagattga 2940

tttccgtgag tgtttcttgc atttctttat agacataatt tttcacatat taaccataac 3000

ctttgctgca acaatattct attacaaatt atgaataatt ctagcatgag tagagtgttt 3060

aatattcaaa taaattcaac acggtctata tattttgatt aattgagtct gtaaatgttg 3120

tggtcataaa agaattgttc ccaaaatatt agttaatggt acaacaaaat ttatgatttt 3180

gaaccaagtt tgttcttgac attttcaggg tgcctctgct atcattttcc ccattatcaa 3240

ggccgaagga attagacaaa tgttcttccc agtaactgtg ccagcgtatt acagaacacc 3300

ccctaccaat ttggaagatt aaa 3323

Claims

1. application of the drought resistant correlative protein in plant drought resistance is regulated and controled；The drought resistant correlative protein is following A1) or A2) or A3)：

A1) amino acid sequence is the protein of sequence 1；

A2) obtained in the amino acid sequence of sequence 1 by substituting and/or lacking and/or add one or several amino acid residues Arrive have identical function as A1) derived from protein；

2. application of the biomaterial related to drought resistant correlative protein described in claim 1 in plant drought resistance is regulated and controled；

Any of the biomaterial, it is following B1) to B14)：

B1 the nucleic acid molecules of drought resistant correlative protein described in claim 1) are encoded；

B2 B1) is contained) expression cassettes of the nucleic acid molecules；

B3 B1) is contained) recombinant vectors of the nucleic acid molecules；

B4 B2) is contained) recombinant vector of the expression cassette；

B6 B2) is contained) recombinant microorganism of the expression cassette；

B7 B3) is contained) recombinant microorganism of the recombinant vector；

B8 B4) is contained) recombinant microorganism of the recombinant vector；

B11 B1) is contained) Transgenic plant tissues of the nucleic acid molecules；

B12 B2) is contained) Transgenic plant tissue of the expression cassette；

3. application according to claim 2, it is characterised in that：B1) nucleic acid molecules are following b1), b2), b3) or B4 the gene shown in)：

B3) and b1) or b2) or the nucleotide sequence that limits there is 75% or more than 75% homogeneity, and in coding claim 1 The cDNA molecules or genomic DNA molecule of the drought resistant correlative protein；

B4) under strict conditions with b1) or b2) limit nucleotide sequence hybridization, and encode claim 1 described in drought resisting phase Close the cDNA molecules or genomic DNA molecule of albumen.

4. biomaterial described in drought resistant correlative protein described in claim 1 or Claims 2 or 3 is cultivating drought resistance enhancing Application in plant.

5. a kind of method for cultivating drought resistance enhancing plant, including：Increase drought resisting correlation described in claim 1 in purpose plant The activity of albumen, increase the content of drought resistant correlative protein described in claim 1 in purpose plant, promote institute in claim 1 The expression of the encoding gene of drought resistant correlative protein is stated, obtains the drought-resistant plant that drought resistance strengthens compared with the purpose plant.

6. according to the method for claim 5, it is characterised in that：The drought-resistant plant is by being led into the purpose plant Enter the plant that the encoding gene of drought resistant correlative protein described in claim 1 obtains.

7. according to the method for claim 6, it is characterised in that：The coding base of drought resistant correlative protein described in claim 1 Because B1 in claim 3) nucleic acid molecules.

8. regulating and controlling the product of plant drought resistance, contain institute in drought resistant correlative protein described in claim 1 or Claims 2 or 3 State biomaterial.

9. application of the product described in claim 8 in plant drought resistance is regulated and controled.

10. according to any described method or claim 8 in any described applications of claim 1-4 or claim 5-7 Application described in described product or claim 9, it is characterised in that：The plant is dicotyledon or monocotyledon； The purpose plant is dicotyledon or monocotyledon.