CN106480069B

CN106480069B - Cucumber CsERF025 gene and its promote the straight developmental application of cucumber fruits

Info

Publication number: CN106480069B
Application number: CN201611175747.6A
Authority: CN
Inventors: 辛明; 秦智伟; 王春华; 周秀艳; 王蕾
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2016-12-19
Filing date: 2016-12-19
Publication date: 2019-05-17
Anticipated expiration: 2036-12-19
Also published as: CN106480069A

Abstract

The invention discloses a kind of cucumber CsERF025 gene and its promoting the straight developmental application of cucumber fruits, the nucleotide sequence of the cucumber gene CsERF025 is as shown in SEQ ID NO.1, CsERF025 overall length 513bp；The amino acid sequence that it is encoded encodes 170 amino acid, belongs to AP2/ERF family protein gene as shown in SEQ ID NO.2.The present invention utilizes agrobcterium-mediated transformation transformation of cucumber, the transgenic plant of acquisition is through biological function verification, show that the CsERF025 gene that the present invention is cloned has the function of promoting the straight development of fruit, new genetic resources can be provided for the straight fruit Molecular design breeding of plant, to implement green agriculture, safe agricultural provides new genetic resources；The development and utilization of the gene simultaneously is conducive to the best buy rate for instructing breed cucumber and cultivation, improving cucumber production, reduces agriculture production cost, increases farmers' income, it reduces curved fruits and gives peasant's bring economic loss, the economic benefit of cucumber cultivation is improved, agricultural industry high-efficient development is promoted.

Description

Cucumber CsERF025 gene and its promote the straight developmental application of cucumber fruits

Technical field

The invention belongs to genetic engineering applied technical field, it is related to a kind of cucumber transcription factor CsERF025 and its is promoting The straight developmental application of cucumber fruits.

Background technique

Cucumber is the first big crop of the important vegetables and China's Protectorate cultivation in facility cultivation.But China is yellow The standard merchandise rate of melon production is but very low, and commodity rate more than average secondary only has 65%, every year because fruit deformity causes Commodity is lost, and causes very huge economic loss (Zhou et al., 2009) to peasant.In order to solve the cucumber of nature growth It is easy to appear curved melon phenomenon, the big more options of vegetable grower " dipping in anther (chloropyuril) " processing promotes cucumber straight, to improve cucumber Commodity value.The molecule mechanism that research cucumber fruits are formed by bending, it will for instructing breed cucumber and cultivation, reducing and " dip in flower The use of medicine ", the best buy rate for improving cucumber production, increasing farmers' income etc. has extremely important production practical significance. In addition, illustrating the mechanism that regulation cucumber fruits are formed by bending, it will us is helped to more fully understand the molecule of cucumber fruits development Mechanism.Therefore, mechanism is formed by bending to cucumber fruits to be studied not only with important production application value, while also having Important theoretical significance, related ends push this ambit in terms of research and technology Using will play an important role.

ERF is the distinctive a kind of transcription factor of plant, has a conservative ERF type DNA binding domain.ERF transcription Influence plant development may be influence ABA, the synthesis of plant hormones such as ethylene indirect consequence (Wu et al., 2002; Zhang et al., 2005).When overexpressing tomato ERF transcription Pti4 such as in arabidopsis, transgenic plant is shown Extension, top overbending and the blade dimensions of root and hypocotyl are inhibited to become smaller isophenous, this may be that Pti4 influence turns base Because of the result (Wu et al., 2002) of arabidopsis ethylene synthase.Overexpressing TERF1 transgene tobacco, there is ethylene excessively to generate Form, the overexpression tobacco for showing as dark-grown shows typical " triple response " form, raw under normal lighting conditions Long tobacco also shows that blade is narrow, elongated ethylene excessively generates form (Zhang et al., 2009).

In research before, show that being bent the elongation of fruit abdominal cell is suppressed by anatomy and cytology research, Cell liquid alveolation, the Partial digestions such as nuclear membrane, tonoplast, cell are presented aging trend, lead to abdomen slow growth.And then it utilizes Illumina technology carries out sequencing analysis to transcript profile, detects through qRT-PCR, determines transcription factor CsERF025 and ethylene synthase Key geneCsACS2Expression there are consistency, and CsERF025 is the 70 of spine in cucumber fruits abdomen up-regulated expression amount Times, show that CsERF025 is played an important role during cucumber fruits are formed by bending.Ethylene response response factor ERF is planting Important regulating and controlling effect is played in the growth and development and Stress response reaction process of object, but whether the ERF factor regulates and controls in cucumber Synthesis pathway influences cucumber fruits bending and has not been reported.

Summary of the invention

The purpose of the present invention is from the cucumber (Cucumis sativus L.) separation, that clone obtains a regulating fruit is suitable Straight and bending development ERF transcription CsERF025, and be conducted into cucumber by Agrobacterium-mediated genetic transformation, it reflects Its fixed function in fruit development.

The purpose of the present invention is what is be achieved through the following technical solutions:

The present invention is expanded using being bent fruit cDNA as template with following primer:

Forward primer: 5 '-ATGATCACTACAAAGGAATCCGCT-3 '；

Reverse primer: 5 '-CTAGTGGTAGCTCCAAAGATTTCCA-3 '；

A new cucumber gene CsERF025 is obtained, nucleotide sequence is as shown in SEQ ID NO.1, CsERF025 overall length 513bp；The amino acid sequence that it is encoded encodes 170 amino acid, belongs to AP2/ERF family protein as shown in SEQ ID NO.2 Gene.

The present invention utilizes agrobcterium-mediated transformation transformation of cucumber, and the transgenic plant of acquisition is through biology function It is able to verify that, shows that the CsERF025 gene that the present invention is cloned has the function of promoting the straight development of fruit, expression quantity is curved The straight fruit of Qu Guoshi >, and the expression quantity for being bent fruit is spine > abdomen.

Compared with prior art, the invention has the following advantages that

1, rely on the present invention that can effectively facilitate the straight development of fruit, once transgenic line is obtained, it can be effective in production It reduces and uses " dipping in anther (chloropyuril) ", economize on resources, reduce production cost.On the other hand, the present invention can be according to actual production Demand is widely used, approval easy to be accepted for improving stock material or other.

2, the gene is led in plant by Agrobacterium-mediated genetic transformation, identifies its function in fruit development Can, new genetic resources are provided for the straight fruit Molecular design breeding of plant, are provided for implementation green agriculture, safe agricultural new Genetic resources；The development and utilization of the gene simultaneously is conducive to instruct breed cucumber and cultivation, the high-quality quotient for improving cucumber production Product rate reduces agriculture production cost, increases farmers' income, and reduces curved fruits and gives peasant's bring economic loss, improves cucumber The economic benefit of cultivation promotes agricultural industry high-efficient development.

Detailed description of the invention

Fig. 1 is techniqueflow chart of the invention.

Fig. 2 is that CsERF025 gene of the invention shows in straight and bending cucumber fruits different development stage expression pattern It is intended to.

Fig. 3 is CsERF025 gene of the invention in straight and bending cucumber fruits different parts expression pattern schematic diagram.

Fig. 4 is CsERF025 gene subcellular localization fluorescence schematic diagram of the invention, and Bright is light field in figure, and GFP is Green fluorescence, Chlorophy are chlorophyll autofluorescence, and Merged is stack result, and scale is 10 μm in figure.

Fig. 5 is cucumber genetic transformation flow chart of the invention.

Fig. 6 is that the PCR of CsERF025 justice transgenic plant of the invention identifies schematic diagram, and M is DNA marker in figure DL2000；+ it is positive control (pCXSN-CsERF025 plasmid)；- it is negative control (water)；1-15 is that CsERF025 justice turns Gene plant.

Fig. 7 is that the PCR of CsERF025 antisense transgene plant of the invention identifies schematic diagram, and M is DNA marker in figure DL2000；+ it is positive control (pCXSN-CsERF025 plasmid)；- it is negative control (water)；1-18 is that CsERF025 antisense turns Gene plant.

Fig. 8 is that the qRT-PCR for turning CsERF025 gene plant of the invention identifies schematic diagram, and WT is wild type strain in figure System；Col-2 is unloaded control；3,4,5,6,8,13,14 be to turn CsERF025 justice transgenic line；Turn CsERF0252,3,4, 5,6,7,9: antisense transgene strain.

Fig. 9 is the dynamic change comparison schematic diagram of transgenosis cucumber curved fruits ratio of the present invention and curvature, and A is in figure The ratio schematic diagram of 15 single plants bending fruit in F2 generation；B is the dynamic change schematic diagram of justice expression strain curved fruits degree； OE1, OE2, OE3 are 3 justice expression strains；AS1, AS2, AS3 are 3 antisense expression strains.

Specific embodiment

Further description of the technical solution of the present invention with reference to the accompanying drawing, and however, it is not limited to this, all to this Inventive technique scheme is modified or replaced equivalently, and without departing from the spirit and scope of the technical solution of the present invention, should all be covered Within the protection scope of the present invention.

Embodiment 1:

CsERF025Gene Isolation clone and expression analysis

Bear fruit the phase (2d of blooming) bending fruit spine and abdomen to cucumber fruits, straight fruit carries out transcript profile sequencing, mirror One is made in the bending fruit abdomen and significant ERF transcription CsERF025 gene of spine's differential expression, in order to obtain its Full length sequence information, we search for the complete of CsERF025 in Cucumber germplasm database (http://www.icugi.org/) Long sequence designs specific primer using Primer premier 5.0, carries out PCR amplification.Primer sequence is as follows:

CsERF025-F:5 '-ATGATCACTACAAAGGAATCCGCT-3 '；

CsERF025-R:5 '-CTAGTGGTAGCTCCAAAGATTTCCA-3 '.

Trizol(Invetrigen is used first^TM) method extract cucumber fruits, stem, leaf, flower total serum IgE (kit is purchased from Invetrigen company, operating method is to specifications).RNA sample in 1ul is then taken, according to Toyobo reverse transcription reagent box ReverTra Ace qPCR RT-Kit specification reverse transcription is at the 1st chain of cDNA.Resulting first chain cDNA is used for fluorescent quantitation The template of PCR reaction amplifying target genes.Each component such as table 1 in reverse transcription system:

Table 1

Ingredient	Additional amount (μ L)
		5×RT Buffer	2
RT Enzyme Mix	0.5
		Primer Mix	0.5
RNA template	1
		Nuclease-free Water	6
Total system	10

By in Cucumber germplasm database (http://www.icugi.org/) Searching I D be The CDS full length sequence (being named as CsERF025) of Csa3M042390.1 designs specific primer using Primer 5.0, carries out PCR amplification.Each component such as table 2 in PCR clone's system:

Table 2

Composition	Additional amount (μ L)
		10 × PCR Buffer (contains 20 mmol L^-1Mg²⁺)	2
DNTPs(10 mmolL^-1)	2
		Upstream primer (20 μm of ol L^-1)	0.5
Downstream primer (20 μm of ol L^-1)	0.5
		Taq enzyme (2 U)	0.2
cDNA	2
		ddH₂O	12.8
Total system	20

Pcr amplification reaction is completed on Bio-Rad DNA Engine Systems amplification instrument by following procedure: 94 DEG C 5 min of initial denaturation；94 DEG C of denaturation 30s, 54 DEG C of annealing 30s, 72 DEG C of 1 min(of extension are recycled for 30 totally)；72 DEG C after the completion of circulation Extend 10 min.Product is saved in -20 DEG C after PCR amplification.

The recycling of pcr amplification product is quickly to cut purpose band in the UV lamp using 1% agarose gel electrophoresis, is returned The target fragment of CsABC19 gene is received, specific method is carried out referring to the full formula gold size QIAquick Gel Extraction Kit specification in Beijing.

pEASY-T₃Carrier connection is by the glue recovery product of CsERF025 gene and the full formula in Beijing with positive colony screening The pEASY-T3 carrier of King Company connects, and is transferred in competent escherichia coli cell DH5 α, and specific method is referring to Beijing Quan Shijin Company pEASY-T3 carrier specification carries out blue hickie screening.Several white single bacteriums of picking are fallen within containing resistance LB Liquid Culture In base, at 37 DEG C, 200 rpm/min shaken cultivation casees are stayed overnight, and using bacterium solution as template, carry out PCR inspection and EcoR I digestion Positive bacterium colony (PCR system is same as above) is verified, the positive bacterium solution for the CsERF025 gene that identification is obtained, sending to Suzhou Jin Weizhi has Limit company is sequenced.Endonuclease reaction system such as table 3:

Table 3

Ingredient	Additional amount (μ L)
		Buffer	1
EcorI	1
		Plasmid	3
ddH₂O	6
		Total system	10

In order to probe into CsERF025 gene in cucumber fruits different development stage expression pattern, pole is analyzed using QRT-PCR The expression pattern of flexible kind " Chang Chun Mi Ci ".The result shows that: highest is expressed in CsERF025 gene fruit, secondly in female flower It is expressed in root.Relatively very low (Fig. 2) is expressed in stem, leaf, stem apex and male flower.Different development stage, straight fruit CsERF025, which is presented, slowly rises expression, and the expression that 2-8d is bent fruit CsERF025 gene is higher than straight fruit, sends out in fruit The expression for educating 2d abdomen is 2.73 times of spine, however since fruit development 4d, the expression of spine is expressed higher than abdomen, and 4d spine and abdomen difference are maximum, are 5.39 times (Fig. 3).It is inferred that CsERF025 gene is likely to be bent with cucumber fruits Formation it is related.

Embodiment 2:

CsERF025 gene subcellular localization

Tuning on-line prediction points out the CsERF025 assignment of genes gene mapping in nucleus, and the present invention utilizes protoplasts of Arabidopsis thaliana broken by ultrasonic cell To study the subcellular localization of CsERF025 gene.We have selected the positioning of EGFP vector construction CsERF025 gene herein Carrier.Amplify the entire ORF(reading frame of CsERF025 gene using RT-PCR), using PCR amplification without terminate Codon sequences, Purified pcr product and pEASY-T₃Carrier connection, the pEASY-T of open reading frame is had using HindIII and BamhI double digestion₃ Carrier and EGFP carrier recycle target fragment, use T₄It is glimmering to be fused to green by the connection overnight of 25 DEG C of DNA ligase for target fragment Position among the upstream photoprotein (GFP) HindIII and BamhI constructs green plant fluorescent expression vector CsERF025- EGFP is transferred to Escherichia coliDH5αPositive bacterium colony is screened and verified to (method and system are same as above), send to the limited public affairs of Suzhou gold only intelligence Department's sequencing.

Take 10 μ L sequencing correct and the CsERF025 without termination codon-EGFP bacterium solution is added to 50 mL(and contains 50 μ L Kan it) in LB liquid medium, is incubated overnight in 37 DEG C, the constant-temperature table of 200 rpm.With 20 pipe matter of extraction after bacterium solution packing Grain, then the plasmid mentioned is mixed, and isometric isopropanol precipitating is added, adds 1/10 3M NaAC, low temperature from 4 DEG C in scheming, 14000 rpm are centrifuged 10 min and are dried at room temperature with washes of absolute alcohol 2 times of 75%, and precipitating uses kit In EB dissolved.With UV spectrophotometer measuring plasmid concentration, concentration can be used in the purity of 1 μ g/ μ L or so Protoplasts of Arabidopsis thaliana broken by ultrasonic cell is incorporated, the success rate of subcellular localization can be improved in the plasmid of the concentration.

CsERF025-EGFP plasmid arabidopsis thaliana transformation protoplast:

1, the arabidopsis protogonocyte 100g for having examined upper step is centrifuged 3min, abandons supernatant, as far as possible removal W5 solution, adds Enter 2 mL MMG solution, protoplast is resuspended, is allowed to ultimate density 2 × 10⁵A/mL；

2, take 2 clean mL centrifuge tubes, about 30 μ g of 20 μ L(be added) pCAMBIA1302-CsABC19 Plasmid DNA and 200 μ L protogonocytes, soft to mix, 25 DEG C of static 5 min；

3, it is isometric that 220 μ L(are added) 40% PEG4000 solution, soft to mix, 25 DEG C of static 5 min；

4, the W5 solution of 1 mL pre-cooling is added, it is soft to mix；

5, step 4 is repeated, the W5 solution and 1% BSA of 1 mL pre-cooling is added, it is soft to mix, in 25 DEG C of illumination cultivations 16 h；

6, expressing fusion protein situation is observed using laser confocal microscope (Leica, Germany), test repeats 3 It is secondary.After 48 hours, with GermanyLeicaTCS SP2 type laser confocal microscope, CsERF025 fusion protein is observed Subcellular localization situation.The results show that GFP control plasmid is all expressed in entire cell, CsERF025-EGFP fusion protein exists Only in cell nuclear expression, illustrate that the albumen of CsERF025 gene coding belongs to the albumen (Fig. 4) of nuclear location.

Embodiment 3:

Plant Transformation overexpression vector and antisense expression vector construction

The plasmid XCM1 digestion of pCXSN will be extracted, digestion products are run electrophoresis by 37 DEG C of digestion 1h of digestion condition, and glue returns After receipts obtain purified product, in the large fragment T of CsERF025 and pCXSN that the ratio of 1:1 recycles glue₄DNA ligase 16 DEG C connection 16h, connection product is transferred toTrans1-T1Competent cell, bed board are incubated overnight under conditions of 37 DEG C, choose single bacterium It falls and shakes bacterium, after carrying out PCR and XCMI digestion detection target stripe, sample presentation sequencing.Recombinant plasmid is transferred to crown gall agriculture bar later It in bacterium LBA4404 and saves, is used for subsequent genetic transformation.

Each component such as table 4 in the endonuclease reaction system of 20 μ L:

Table 4

Plasmid	7 μL
		XCM1	1μL
Buffer	1 μL
		ddH₂O	10μL
Total system	20 μL

Each component such as table 5 in 10 μ L coupled reaction systems:

Table 5

Glue recycles CsERF025	a μL
		The large fragment of glue recycling pCXSN	b μL
T₄DNA ligase	1 μL
		Buffer	1 μL
Total system	10μL

Embodiment 4:

Cucumber genetic transformation

Steps are as follows for Agrobacterium tumefaciens mediated cucumber genetic transformation:

1, Agrobacterium tumefaciems is cultivated: the Agrobacterium bacterium solution containing CsERF025 gene plant over-express vector being taken to contain It crosses on the YEB solid medium of Rif and Kan resistance, is placed in 28 DEG C of constant incubators and cultivates, it is clear to grow after 36-48 h Visible single colonie；It chooses single bacterium and falls within 5 mL and contain in the YEB fluid nutrient medium of Rif and Kan resistance, 28 DEG C, 200 rpm are stayed overnight Cultivate 16 h；Then it is transferred to 250 mL with 1:50 ratio to contain in Rif and Kan resistance YEB fluid nutrient medium, 28 DEG C, 200 Rpm is cultivated to OD600=0.5；The bacterium solution shaken is taken, is dispensed, 4 DEG C, 6000 rpm, 10min is centrifuged, in superclean bench, Supernatant is discarded, thallus is collected；By thallus permeabilization buffer (1/2+5% sucrose of MS culture medium+final concentration 0.02%-0.03% Silwet L-77) it is resuspended, when OD600=0.2-0.3 of resuspended bacterium solution, which does, infects.

2, it infects: taking the cotyledonary node of preculture 2-3d cucumber, be put into autoclaved triangular flask, appropriate be added has been lived The bacterium solution of change, 200 revs/min, disseminates cotyledonary node, time unsuitable too long, about 15min by 28 DEG C.

3, it co-cultures: will be saved after aseptic filter paper blots with the cotyledon that During Agrobacterium is crossed, be inserted into additional 30mg/ with tweezers In the co-culture medium of L acetosyringone, 28 DEG C, dark culturing 3-4d, there is the visible bacterium colony of white and is in media surface It can.

4, degerming and screening and culturing: take cotyledonary node by co-cultivation in sterile triangular flask, on aseptic operating platform first With aseptic water washing 3-4 times, with the plant liquid culture medium containing 500 mg/L Cefotaxime Sodium bacteria removers, 28 DEG C, 200r/ Min impregnates 20 min, blots with aseptic water washing 6-8 times, then with sterilized filter paper, and cotyledonary node is inserted into degerming screening and culturing Base is sterilized using cephalo, screens resistant buds using Ka Na.Temperature setting is 25 DEG C, when intensity of illumination 1500lx, illumination Between be set as 16 hours.

5, culture of rootage: when adventitious bud grows to 2-3cm, adventitious bud being cut, and pays attention to being sure not to cut from root at this time, In order to avoid resistant buds are sticky with Agrobacterium, it is not easy to survive.By the resistant buds cut be inserted into root media, carry out culture of rootage, two weeks Left and right grows adventitious root.

6, cucumber seedling is transferred to earth culture: the plant to have taken root being taken out from culture medium, root culture medium is washed away, plants into dress In the nutritive cube for having sterilized net river sand, nutrient solution, and cover preservative film moisturizing, 24/18 DEG C of temperature in the incubator, Illumination 16/8h culture grows young leaves for one week or so and throws off preservative film, completes domestication, and transplant in the Nutrition Soil of sterilizing.Cucumber Transformation seedlings used medium is shown in Table 6, and conversion process is as shown in Figure 5.

Table 6

7, positive transgenic cucumber primarily determines

By the T of harvest₀It after seed thorough disinfection, is seeded in the MS culture containing 50 mg/L Kan, 4 DEG C of dark spring After changing 2 d, 22 DEG C/18 DEG C are placed in, 16 h of illumination, 8 h of dark, humidity are maintained in 70% or so illumination box and cultivate, Screen resistant plant.After growing 31 d, blade is normally flattened, and the plant to take root can primarily determine as positive plant.

Embodiment 5:

Transgenic plant Molecular Identification

1, the extraction of cucumber leaves DNA

The fresh Arabidopsis leaf of 3-5 mg is taken, is put into 1.5 mL centrifuge tubes, 200 μ L DNA extracting solutions are added, and be added Small steel ball shakes 45s in nucleic acid purifier, takes out steel ball, and 14000 rpm of remaining liq is centrifuged 5 min, 1 μ L is taken to be used for PCR identification.

The preparation of Edwards liquid: 200 Tris--HCl(PH=7.5 mM), 250 mM Nacl, 25 mM EDTA, 0.5% SDS；

The preparation of TE Buffer: Tris--HCl(PH=7.5 10mM), 1 mM EDTA；

DNA extracting solution: Edwards liquid is diluted with 10 times of TE Buffer.

2, the PCR detection of positive transgenic plant

In addition to analyzing target gene from rna level other than whether DNA level verifying transgenic plant contains target gene Expression can be verified further.It extracts the RNA of cucumber, and carries out quantitative fluorescent PCR analysis (method and system are the same).

Take the blade of resistant transgenic cucumber, extract DNA, with universal primer (1250-F: CGGCAACAGGATTCAATCTTA, 1250-R:CAAGCATTCTACTTCTATTGCAGC) PCR identification is carried out, there is purpose band Plant, be considered as positive plant, sowing, for testing in next step.Turn the result shows that obtaining the justice expression containing target gene 15 plants of gene strain, 18 plants of antisense expression transgenic line (Fig. 6 A, Fig. 6 B, Fig. 7).And then brighter to PCR band turn base Because of strain, extract RNA, and reverse transcription is cDNA, using gene-specific primer (ERF025-qS: TTCTCAACTTCCCCAACTCA, ERF025-qS:CGACAACAGCATTCCCTC), carry out quantitative fluorescent PCR.The result shows that The expression that target gene is detected in justice and antisense expression transgenic line, illustrates that the gene can normally turn in cucumber It records (Fig. 8).Therefore the relatively high 3 plants of overexpressions strain (3,4,13) of screening expression quantity and antisense expression strain (2,4,6) carry out F2 generation is bred, and is tested using F2 for single plant.

Embodiment 6:

Turn the identification of CsERF025 gene plant cucumber fruits curvature

F2 generation just express transgenic strain and antisense expression transgenic line bending fruit ratio are investigated.As a result table Bright, " Chang Chun Mi Ci " is overexpressedCsERF025Gene, curved melon rate have increased separately 30.30%, 23.26% and compared with the control 20.17%, however, antisense expression plant bending fruit ratio reduces 9.7%, 16.82% and 14.1%(Fig. 9 A compared with the control), And justice expression strain increases bending fruit angle (Fig. 9 B).The result shows that CsERF025 gene promotes the bending of cucumber fruits Degree, the cucumber fruits curvature that justice reaches become larger, while the quantity for being bent fruit increases；The cucumber fruits curvature of antisense expression Become smaller, while the quantity for being bent fruit is reduced.

<110>Northeast Agricultural University

<120>cucumber CsERF025 gene and its promote the straight developmental application of cucumber fruits

<160>2

<210>1

<211>513

<212>DNA

<400>1

atgatcacta caaaggaatc cgctgccggg gtggcaaatg ggtctccgag attcgtgagc 60

cacgtaagac taatcgaata tggctccgca cgtaagacta atcgaatatg gctcggcacc 120

taccctacac ccgaaatggc tgctgctgcc tacgacgtag ccgcactcgc actcaagggt 180

tgcaatgccg ttctcaactt ccccaactca gttgccttct acccggttcc tgcttccaca 240

tcccccaatg atatccgtat tgctgctgct gctgccgccg cgtccaaaaa ggttgatgat 300

caaggagaaa acagttacca taactctcac taccaatctc caccaaccaa tgagtttgtc 360

gatgaagaag cgctgttcgg aatgccaaat cttttacatg acatggctga gggaatgctg 420

ttgtcgcccc cacgaatgaa ctcgtcgccg tctcgacatg attactactc gtggaattca 480

agtggagatg gaaatctttg gagctaccac tag 513

<210>2

<211>170

<212>DNA

<400>1

mittkesaag vangsprfvs hvrlieygsa rktnriwlgt yptpemaaaa ydvaalalkg 60

cnavlnfpns vafypvpast spndiriaaa aaaaskkvdd qgensyhnsh yqspptnefv 120

deealfgmpn llhdmaegml lspprmnssp srhdyyswns sgdgnlwsyh 170

Claims

1. a kind of cucumber CsERF025 gene is promoting the straight developmental application of cucumber fruits, the cucumber CsERF025 gene Nucleotide sequence as shown in SEQ ID NO.1.

2. cucumber CsERF025 gene according to claim 1 is promoting the straight developmental application of cucumber fruits, special Sign is that the expression quantity of the cucumber CsERF025 gene is the bending straight fruit of fruit >, and the expression quantity for being bent fruit is Spine's > abdomen.