CN106496313B - Disease-resistance-related protein IbSWEET10 and its encoding gene and application - Google Patents
Disease-resistance-related protein IbSWEET10 and its encoding gene and application Download PDFInfo
- Publication number
- CN106496313B CN106496313B CN201610966649.8A CN201610966649A CN106496313B CN 106496313 B CN106496313 B CN 106496313B CN 201610966649 A CN201610966649 A CN 201610966649A CN 106496313 B CN106496313 B CN 106496313B
- Authority
- CN
- China
- Prior art keywords
- plant
- ibsweet10
- sequence
- sweet potato
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/22—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a Strep-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
- C07K2319/43—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses disease-resistance-related protein IbSWEET10 and its encoding gene and applications.1) or 2) or 3) disease-resistance-related protein IbSWEET10 provided by the invention is: 1) amino acid sequence is protein shown in sequence 2 in sequence table；2) fused protein that the N-terminal of protein shown in sequence 2 or/and C-terminal connection label obtain in sequence table；1) or 2) 3) protein relevant to disease resistance of plant for obtaining protein shown in by the substitution and/or deletion and/or addition of one or several amino acid residues.It is demonstrated experimentally that sweet potato can be enhanced to the resistance of dead arm by being overexpressed IbSWEET10 gene in sweet potato.Therefore, disease-resistance-related protein IbSWEET10 and its encoding gene have important theory significance and practical value in regulation disease resistance of plant.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to disease-resistance-related protein IbSWEET10 and its encoding gene with answer
With.
Background technique
Sweet potato (Ipomoea batatas (L.) Lam.) is a kind of important grain, feed and the raw material of industry with crop,
And it is used as a kind of new energy plant in today's world, status is particularly important.China is maximum sweet in the world
Potato producing country, 338.7 ten thousand hm of annual planting area2, the 42.2% of the total cultivated area in the world is accounted for, annual output accounts for Gross World Product
67.94%.China is currently under the period of rapid development, and the demand to the energy continues to increase, demand of the people to sweet potato
It is increasing, therefore breeding high-yield, high-quality, more anti-and tailored version new varieties become the main target of China's Sweet Potato Breeding.Sweet potato
It is the seventh-largest cereal crops in the world, but sweet potato pest and disease damage is worldwide generally existing, seriously threatens the production of various countries sweet potato,
Yield of sweet potato, quality and Storage sharp fall are caused, each sweet potato production country, the world compares always the master for paying attention to sweet potato
Want the prevention and treatment of pest and disease damage.
Stem rot of sweet potato, also known as sweet potato wilt disease, sweet potato blight dis-ease, fusarium wilt of sweet potato or sweet potato stem rot, are typical
Sickle-like bacteria conduit disease, is one of the important disease in south China potato area, and very harmful.Stem rot of sweet potato is by stem rot of sweet potato bacterium
Cause.Stem rot of sweet potato bacterium can survive for many years in the soil.The pathogenesis of stem rot of sweet potato bacterium are as follows: pass through rice shoot base portion or root
The wound in portion is bred in tracheal tissue or, invading rice shoot by conduit by carrying disease germs potato seed, causes illness plant that complete stool occurs
Property it is withered, dead, show overground part blade and turn yellow from bottom to top to fall off, cauline bundle browning color, last stem cracks, whole strain
It is withered.
Sweet potato is asexually propagated crop, has inter-species, the incompatible characteristic of intraspecific hybridization, which seriously limits sweet potato
The utilization of resources and parent in breeding freely assemble.Long-term breeding practice have shown that, conventional cross-breeding method is difficult to select excellent
Matter, high yield, anti-dead arm Sweetpotato.Therefore, it is using the Sweetpotato that technique for gene engineering cultivates anti-dead arm
A kind of feasible way.
Summary of the invention
The technical problem to be solved by the present invention is to how enhance plant to the resistance of stem rot of sweet potato.
To solve the above problems, present invention firstly provides a kind of disease-resistance-related proteins.
Disease-resistance-related protein provided by the present invention, entitled protein IbSWEET10 derive from sweet potato
(Ipomoeabatatas (L.) Lam.), for it is following 1) or 2) or 3):
1) amino acid sequence is protein shown in sequence 2 in sequence table；
2) fused protein that the N-terminal of protein shown in sequence 2 or/and C-terminal connection label obtain in sequence table；
Or 2) 3) 1) protein shown in by the substitution of one or several amino acid residues and/or missing and/or is added
The protein relevant to disease resistance of plant added.
Wherein, sequence 2 is made of 306 amino acid residues in sequence table.
In order to make protein in 1) convenient for purifying, can in sequence table the amino terminal of protein shown in sequence 2 or
Carboxyl terminal connects upper label as shown in Table 1.
The sequence of 1. label of table
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (usually 5) | RRRRR |
| Poly-His | 2-10 (usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
It is above-mentioned 3) in protein IbSWEET10, the substitutions of one or several amino acid residues and/or missing and/
Or it is added to substitution and/or deletion and/or addition no more than 10 amino acid residues.
It is above-mentioned 3) in protein IbSWEET10 can be artificial synthesized, can also first synthesize its encoding gene, then carry out biological table
It reaches.
It is above-mentioned 3) in protein IbSWEET10 encoding gene can by by sequence 1 in sequence table from 5 ' ends
The codon of one or several amino acid residues is lacked in DNA sequence dna shown in 122 to 1042, and/or carries out one or several
The missense mutation of a base-pair, and/or obtained in the coded sequence that its 5 ' end and/or 3 ' ends connect label shown in table 1.
The nucleic acid molecules of code for said proteins IbSWEET10 also belong to protection scope of the present invention.
The nucleic acid molecules of the coding protein IbSWEET10 can be for shown in following (a1) or (a2) or (a3) or (a4)
DNA molecular:
(a1) nucleotide sequence is DNA molecular shown in sequence 1 in sequence table；
(a2) nucleotide sequence is the DNA molecular shown in the 122nd to 1042 from 5 ' ends of sequence 1 in sequence table；
(a3) nucleotide sequence limited with (a1) or (a2) has 75% or 75% or more identity, and encodes the egg
The DNA molecular of white matter IbSWEET10；
(a4) nucleotide sequence hybridization limited under strict conditions with (a1) or (a2), and code for said proteins
The DNA molecular of IbSWEET10.
Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules can also
To be RNA, such as mRNA or hnRNA.
Wherein, sequence 1 is made of 1250 nucleotide in sequence table, the nucleotide coding sequence table of sequence 1 in sequence table
Amino acid sequence shown in middle sequence 2.
Those of ordinary skill in the art can easily adopt by known method, such as the side of directed evolution and point mutation
Method is mutated the nucleotide sequence of coding protein IbSWEET10 of the invention.Those have by manually modified
The nucleotide sequence 80% of isolated protein IbSWEET10 or the nucleotide of higher identity with the present invention, as long as
Coding protein IbSWEET10 and related to disease resistance of plant is derived from nucleotide sequence of the invention and to be equal to
Sequence of the invention.
Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair
The nucleotide sequence for the protein that amino acid sequence shown in sequence 2 forms in bright polynucleotide has 80% or higher,
Or 85% or higher or 90% or higher or 95% or higher identity nucleotide sequence.Identity can with the naked eye or meter
Calculation machine software is evaluated.Using computer software, the identity between two or more sequences can use percentage (%) table
Show, can be used to evaluate the identity between correlated series.
The expression cassettes of nucleic acid molecules containing code for said proteins IbSWEET10, recombinant vector, recombinant microorganism turn
Gene cell system also belongs to protection scope of the present invention.
The expression cassette can be expression cassette A；The expression cassette A includes promoter, code for said proteins IbSWEET10
Nucleic acid molecules and terminator.The promoter can be CaMV35S promoter, NOS promoter or OCS promoter.The terminator
It can be NOS terminator or OCS polyA terminator.
The sequence of the expression cassette A can be for shown in sequence 3 in sequence table.In the expression cassette A: in sequence table sequence 3 from
It is CaMV35S promoter, the 848th to 1768 core for code for said proteins IbSWEET10 that 5 ' ends, which play the 1st to 835,
Acid molecule, the 1785th to 2037 is NOS terminator.
The recombinant vector can for by the nucleic acid molecules of code for said proteins IbSWEET10 (i.e. in sequence table sequence 1 from
DNA molecular shown in 5 ' ends the 122nd to 1042) pass through the nucleic acid molecules containing code for said proteins IbSWEET10
Expression cassette insertion set out the recombinant plasmid that plasmid obtains.
The recombinant vector concretely recombinant plasmid pCB-IbSWEET10.The building of recombinant plasmid pCB-IbSWEET10
Process is as follows: (A) obtains carrier framework with restriction enzyme HindIII and EcoRI double digestion carrier pCAMBIA3301, uses
Restriction enzyme HindIII and EcoRI double digestion carrier pBI121 recycles the segment of about 3032bp, by the carrier framework
It is connected with the segment, obtains recombinant plasmid pCBGUS；(B) with sequence 1 in sequence table from 5 ' ends the 122nd to 1042 institute
Segment (recombination matter between restriction enzyme XbaI and SacI the identification sequence of the DNA molecular replacement recombinant plasmid pCBGUS shown
Grain pCBGUS is cut into a large fragment and a small fragment by restriction endonuclease XbaI and SacI, which is the small pieces
Section) obtained recombinant plasmid pCB-IbSWEET10, egg shown in sequence 2 in recombinant plasmid pCB-IbSWEET10 expressed sequence table
White matter IbSWEET10.The difference of the recombinant plasmid pCBGUS and recombinant plasmid pCB-IbSWEET10 is only that recombinant plasmid
(recombinant plasmid pCBGUS is restricted for DNA fragmentation between restriction endonuclease XbaI and SacI the identification sequence of pCBGUS
Endonuclease XbaI and SacI are cut into a large fragment and a small fragment, which is the small fragment) it replaces in sequence table
The DNA molecular shown in the 122nd to 1042 from 5 ' ends of sequence 1.
The recombinant microorganism can be obtained by the way that the recombinant vector is imported the microorganism that sets out.
The microorganism that sets out can be yeast, bacterium, algae or fungi.The bacterium can be gram-positive bacterium or leather
Gram-negative bacteria.The gramnegative bacterium can be Agrobacterium tumefaciems (Agrobacterium tumefaciens).It is described
Agrobacterium tumefaciems (Agrobacterium tumefaciens) concretely Agrobacterium tumefaciems EHA105.
The recombinant microorganism concretely EHA105/pCB-IbSWEET10.EHA105/pCB-IbSWEET10 is will to weigh
The recombinational agrobacterium that group plasmid pCB-IbSWEET10 conversion Agrobacterium tumefaciems EHA105 is obtained.
The transgenic plant cells system does not include propagation material.The genetically modified plants are interpreted as not only including by institute
The first generation genetically modified plants that IbSWEET10 genetic transformation recipient plant obtains are stated, also include its filial generation.Transgenosis is planted
Object can breed the gene, it is also possible to which the gene transfer is entered the other of same species by traditional breeding techniques in the species
Kind, particularly including in commercial variety.The genetically modified plants include seed, callus, intact plant and cell.
Following b1) or b2) also belong to protection scope of the present invention；
B1) the protein IbSWEET10, or, the nucleic acid molecules of code for said proteins IbSWEET10, or, containing compiling
Expression cassette, recombinant vector, recombinant microorganism or the transgenic cell line of the nucleic acid molecules of the code protein IbSWEET10,
Regulate and control the application in disease resistance of plant；
B2) the protein IbSWEET10, or, the nucleic acid molecules of code for said proteins IbSWEET10, or, containing compiling
Expression cassette, recombinant vector, recombinant microorganism or the transgenic cell line of the nucleic acid molecules of the code protein IbSWEET10,
Cultivate the application in the disease-resistant genetically modified plants sexually revised.
The b1) in, the regulation disease resistance of plant can be enhancing disease resistance of plant.
The b2) in, disease-resistant sexually revise can enhance for disease resistance.
In order to solve the above technical problems, the present invention also provides a kind of methods for cultivating genetically modified plants.
The method provided by the present invention for cultivating genetically modified plants, it may include by code for said proteins IbSWEET10's
The step of nucleic acid molecules import in recipient plant, obtain genetically modified plants；The genetically modified plants are compared with the recipient plant
Disease resistance enhancing.
In the method for above-mentioned cultivation genetically modified plants, the nucleic acid molecules of the coding protein IbSWEET10 can be as follows
(a1) or DNA molecular shown in (a2) or (a3) or (a4):
(a1) nucleotide sequence is DNA molecular shown in sequence 1 in sequence table；
(a2) nucleotide sequence is the DNA molecular shown in the 122nd to 1042 from 5 ' ends of sequence 1 in sequence table；
(a3) nucleotide sequence limited with (a1) or (a2) has 75% or 75% or more identity, and encodes the egg
The DNA molecular of white matter IbSWEET10；
(a4) nucleotide sequence hybridization limited under strict conditions with (a1) or (a2), and code for said proteins
The DNA molecular of IbSWEET10.
Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules can also
To be RNA, such as mRNA or hnRNA.
Wherein, sequence 1 is made of 1250 nucleotide in sequence table, the nucleotide coding sequence table of sequence 1 in sequence table
Amino acid sequence shown in middle sequence 2.
In order to solve the above technical problems, the present invention also provides a kind of plant breeding methods.
Plant breeding method provided by the present invention, it may include following steps: increase protein described in plant
The content or activity of IbSWEET10, to enhance the disease resistance of plant.
Any of the above-described disease resistance can be anti-dead arm.
Any of the above-described disease resistance can be the microbial disease of anti-stem rot of sweet potato.
Any of the above-described plant can be following c1) any one of to c5):
C1) dicotyledon；
C2) monocotyledon；
C3) Dioscoreaceae plant；
C4) sweet potato；
C5) sweet potato variety chestnut is fragrant.
It is demonstrated experimentally that plant can be enhanced using disease-resistance-related protein IbSWEET10 provided by the invention and its encoding gene
To the resistance of dead arm: compared with sweet potato variety chestnut perfume (or spice) wild type seedlings, sweet potato transgenic line L96 seedling, sweet potato turn base
It is significantly reduced because the dead arm disease grade of strain L99 seedling and sweet potato transgenic line L130 seedling is reduced with browning ratio；And it is sweet
The dead arm disease grade and browning ratio that potato kind chestnut perfume (or spice) wild type seedlings and sweet potato turn empty carrier positive seedling are without significance difference
It is different.Therefore, disease-resistance-related protein IbSWEET10 and its encoding gene have important theory significance in regulation disease resistance of plant
And practical value.
Detailed description of the invention
Fig. 1 is the PCR amplification result that sweet potato intends transgenic plant.
Fig. 2 is the qualification result of sweet potato transgenic line.
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.
Experimental method in following embodiments is unless otherwise specified conventional method.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
ND98 (it is recorded in following document: He et al., Plant Cell Tissue and Organ Culture,
2009,96:69-74.ND98 entitled LM1 in the publication) it is a sweet potato strain, the public can be from China Agricultural University sweet potato
Genetic breeding research room obtains, to repeat this experiment.
Chestnut perfume (Wang Yuping etc., Scientia Agricultura Sinica, 2003,36 (9): 1000-1005) is a sweet potato variety, Gong Zhongke
It is obtained from China Agricultural University's sweet potato genetic breeding research room, to repeat this experiment.
Cloning vector pMD19-T is precious bioengineering (Dalian) Products, catalog number 6013.Carrier
PCAMBIA3301 is Cambia Products.Carrier pBI121 is Clontech Products.Plant total RNA extraction reagent box
For TIANGEN Biotech's product, catalog number (Cat.No.) DP432.PrimeScriptTM 1st Strand cDNA
Synthesis Kit is the product of precious bioengineering (Dalian) Co., Ltd, catalog number 6110A.
Stem rot of sweet potato bacterium and PDA culture medium are recorded in following document: family merit, Yu Ping, Fang Yihong, Li Wei sweet potato
Dead arm bacterium measures .2007 November, Fujian Normal University's journal (natural section to the induction of resistance of sweet potato and the property of PR albumen
Learn version).
The acquisition of embodiment 1, IbSWEET10 gene
The step of acquisition of IbSWEET10 gene, is as follows:
1, the acquisition of template
The total serum IgE that ND98 young leaflet tablet is extracted with plant total RNA extraction reagent box, by total serum IgE PrimeScriptTM
1st Strand cDNA Synthesis Kit reverse transcription goes out the first chain cDNA.
2, est sequence is obtained from the SSH cDNA library constructed using Subtractive hybridization technology.The core of est sequence
Nucleotide sequence is as shown in sequence 4 in sequence table.
3, according to the nucleotide sequence of est sequence, primer 3GSP1 and 3GSP2 are designed and synthesized.
4, after completing step 3, for the cDNA obtained using step 1 as template, the 3GSP1 and 3GSP2 synthesized with step 3 is to draw
Object expands the 3 '-RACE segments for obtaining about 1100bp using RACE method, and 3 '-RACE segments and cloning vector pMD19-T are connected
It connects, obtains recombinant plasmid 2.Recombinant plasmid 2 is sequenced, the nucleotide sequence of 3 '-RACE segments is obtained.According to 3 '-RACE
The nucleotide sequence of segment designs and synthesizes primer 5GSP1 and 5GSP2.
5, after completing step 4, for the cDNA obtained using step 1 as template, the 5GSP1 and 5GSP2 synthesized with step 4 is to draw
Object expands the 5 '-RACE segments for obtaining about 200bp using RACE method, and 5 '-RACE segments and cloning vector pMD19-T are connected
It connects, obtains recombinant plasmid 3.Recombinant plasmid 3 is sequenced, the nucleotide sequence of 5 '-RACE segments is obtained.
6, after completing step 5, candidate IbSWEET10 gene is spliced using 6.0 software of DNAMAN.It is candidate according to splicing
IbSWEET10 gene order further design and synthesize the primer O-F and O-R of IbSWEET10 gene ORF.
7, after completing step 6, the cDNA obtained using step 1 is template, and the O-F and O-R synthesized using step 6 is primer, PCR
Amplification obtains the pcr amplification product of about 921bp and sequencing.
See Table 2 for details for the nucleotide sequence information of above-mentioned primer 3GSP1,3GSP2,5GSP1,5GSP2, O-F and O-R.
The result shows that sequence 1 is from 5 ' ends in the nucleotide sequence for the pcr amplification product that step 7 obtains such as sequence table
It is IbSWEET10 gene by unnamed gene shown in the sequence shown in 122nd to 1042, the albumen of coding is named as
IbSWEET10 albumen or protein IbSWEET10, amino acid sequence is as shown in sequence 2 in sequence table.
2. primer sequence information of table
| Primer | Sequence information 5'-3' |
| 3GSP1 | 5'-ATGGCTCTCACTGGTCATCAATT-3' |
| 3GSP2 | 5'-TCATCTCATTCATCGTCTTCCTTTC-3' |
| 5GSP1 | 5'-GTAGAATGTTGGCAGTGGAGAAAG-3' |
| 5GSP2 | 5'-AAAGCAAAAGCCAATTGATGACC-3' |
| O-F | 5'-ATGGCTCTCACTGGTCATCAA-3' |
| O-R | 5'-TTAAGCTCCCACAGCCTGAA-3' |
The application of embodiment 2, IbSWEET10 albumen in the dead arm resistance of enhancing sweet potato
One, the building of recombinant plasmid
1, double chain DNA molecule shown in sequence 1 in artificial synthesized sequence table.Using the double chain DNA molecule as template, with OS-
F-XbaI:GCTCTAGAATGGCTCTCACTGGTCATCAA (the identification sequence that underscore is restriction enzyme XbaI) and OS-
R-SacI:CGAGCTCTTAAGCTCCCACAGCCTGAA (the identification sequence that underscore is restriction enzyme SacI) is primer
PCR amplification is carried out, the double-stranded DNA point that N-terminal contains restriction enzyme XbaI and C-terminal contains restriction enzyme SacI is obtained
Son.
2, N-terminal obtained in step 1 is contained into restriction enzyme XbaI and C-terminal contains the double of restriction enzyme SacI
Ssdna molecule is connected to cloning vector pMD19-T, obtains recombinant plasmid pMD19-IbSWEET10.
3, after completing step 2, with restriction enzyme XbaI and SacI double digestion recombinant plasmid pMD19-IbSWEET10,
Recycle the segment 1 of about 1.0kb.
4, with restriction enzyme HindIII and EcoRI double digestion carrier pCAMBIA3301, the load of about 11256bp is recycled
Body skeleton 1.
5, with restriction enzyme HindIII and EcoRI double digestion carrier pBI121, recycling includes the segment of about 3032bp
2。
6, segment 2 is connect with carrier framework 1, obtains recombinant plasmid pCBGUS.
7, with restriction enzyme XbaI and SacI double digestion recombinant plasmid pCBGUS, the carrier bone of about 12000bp is recycled
Frame 2.
8, segment 1 and carrier framework 2 are connected, obtains recombinant plasmid pCB-IbSWEET10.
According to sequencing result, structure is carried out to recombinant plasmid pCB-IbSWEET10 and is described as follows: by recombinant plasmid pCBGUS
Restriction enzyme XbaI and SacI identification sequence between small fragment replace in sequence table sequence 1 the 122nd from 5 ' ends
To DNA molecular shown in 1042.IbSWEET10 egg shown in sequence 2 in recombinant plasmid pCB-IbSWEET10 expressed sequence table
It is white.
Recombinant plasmid pCB-IbSWEET10 has an expression cassette A, sequence in the nucleotide sequence of expression cassette A such as sequence table
Shown in column 3, wherein sequence 3 is CaMV35S promoter for the 1st to 835 from 5 ' ends in sequence table, and the 848th to 1768 is
The encoding gene of IbSWEET10 albumen, the 1785th to 2037 is NOS terminator.
Two, the regeneration of the acquisition of recombinational agrobacterium and sweet potato transgenic plant
1, recombinant plasmid pCB-IbSWEET10 is converted into Agrobacterium tumefaciems EHA105, obtains recombinational agrobacterium first, will recombinates
Agrobacterium first is named as EHA105/pCB-IbSWEET10.
2, the shoot apical meristem for being about the chestnut perfume of 0.5mm is stripped, embryonic callus induction solid medium is placed in
On (containing 2.0mg/L 2, the MS solid medium of 4-D and 3.0% sucrose), 27 ± 1 DEG C are cultivated 8 weeks, obtain embryo callus,
Then by embryo callus be placed in embryonic callus induction fluid nutrient medium (containing 2.0mg/L 2,4-D and 3.0% sucrose
MS fluid nutrient medium) in, brightness alternate culture 3d (actual conditions are as follows: 100r/min are vibrated on horizontal shaker；27℃；Brightness is handed over
For the period of culture are as follows: light application time 13h, interlunation 11h；Intensity of illumination is 500lx), obtaining diameter is 0.7-1.3mm
Embryogenic cell masses.
3, after completing step 2, EHA105/pCB-IbSWEET10 is converted by cells,primordial using the method for mediated by agriculture bacillus
Group is subsequently placed in and co-cultures on base (AS containing 30mg/L, 2.0mg/L 2, the MS solid medium of 4-D), 28 DEG C of dark culture 3d.
4, after completing step 3, Embryogenic cell masses are used into Cefotaxime Sodium containing 900mg/L (cefotaxime sodium, CS)
With 2.0mg/L 2, the MS fluid nutrient medium of 4-D is washed 2 times, be subsequently placed in Selective agar medium (containing 2.0mg/L 2,4-D,
The solidified MS media of 100mg/L CS and 0.5mg/L glufosinate-ammonium (phosphinothricin, PPT)) on, 27 ± 1 DEG C of dark trainings
It supports 10-12 weeks (needing to change a Selective agar medium every 2 weeks).
5, complete step 4 after, by Embryogenic cell masses be placed in somatic embryo inducement culture medium (containing 1.0mg/L ABA,
The MS solid medium of 100mg/L CS and 0.5mg/L PPT) on, 27 ± 1 DEG C of alternation of light and darkness cultures (light application time 13h, it is black
Dark time 11h；Intensity of illumination is 3000lx) 2-4 weeks, obtain resistant calli.
6, after completing step 5, resistant calli is placed on MS solid medium, 27 ± 1 DEG C of alternation of light and darkness culture (light
The period of dark alternate culture are as follows: light application time 13h, interlunation 11h；Intensity of illumination is 3000lx) 4-8 weeks, that is, obtain 150
Strain sweet potato intends transgenic plant, successively names L1-L150.
7, the sweet potato that extraction step 6 obtains respectively intends the genomic DNA of the young leaflet tablet of transgenic plant, and with the gene
Group DNA is template, with T35-F:5'-TTGATGTGATATCTCCACTGACG-3' and TS-R:5'-
GGTAGAGACCGATCTGGAGGA-3' is that primer carries out PCR amplification, obtains pcr amplification product；If contained in pcr amplification product
There is the band of about 700bp, then it is sweet potato transgenic positive plant that corresponding sweet potato, which intends transgenic plant,.It is replaced with isometric water
Sweet potato intends the genomic DNA of the young leaflet tablet of transgenic plant, PCR amplification is carried out, as negative control.With sweet potato variety chestnut
The genomic DNA of the young leaflet tablet of fragrant WT lines replaces the genomic DNA of the young leaflet tablet of the quasi- transgenic plant of sweet potato, into
Row PCR amplification, as control.The base of the young leaflet tablet of the quasi- transgenic plant of sweet potato is replaced with recombinant plasmid pCB-IbSWEET10
Because of a group DNA, PCR amplification is carried out, as positive control.
Part of test results is shown in that (M is DNA molecular Marker to Fig. 1, and W is negative control, and P is positive control, and WT is sweet potato product
The genomic DNA of the young leaflet tablet of kind chestnut perfume (or spice) WT lines, L4, L5, L6, L10, L14, L56, L63, L96, L99, L121
It is that sweet potato intends transgenic plant with L130).The result shows that L4, L5, L6, L10, L14, L56, L63, L96, L99, L121 and
L130 is sweet potato transgenic positive plant.
Numerous sweet potato transgenic positive plant identified and obtained is expanded using the method for vegetative propagation, is expanded by one plant of transgenic seedlings
Numerous obtained plant is as a strain.The strain of L96, L99 and L130 are named as sweet potato transgenic line L96, sweet potato turns
Gene strain L99 and sweet potato transgenic line L130.
Four, the acquisition and sweet potato that compare Agrobacterium tumefaciems turn the regeneration of empty carrier plant
Recombinant plasmid pCB-IbSWEET10 is replaced with recombinant plasmid pCBGUS, other same step 3 obtain recombinational agrobacterium
Second (being named as EHA105/pCBGUS) and sweet potato turn empty carrier positive plant.
Four, dead arm Resistance Identification
1, the identification of sweet potato transgenic line
Extracting sweet potato plant with plant total RNA extraction reagent box, (sweet potato variety chestnut perfume (or spice) WT lines (WT), sweet potato turn
Empty carrier positive plant (OCK), the plant of sweet potato transgenic line L96, the plant of sweet potato transgenic line L99 and sweet potato turn base
Because of the plant of strain L130) young leaflet tablet total serum IgE, by total serum IgE PrimeScriptTM 1stStrand cDNA
Synthesis Kit reverse transcription goes out the first chain cDNA, then using the cDNA as template, in Real_time quantitative detection sweet potato plant
The relative expression quantity of IbSWEET10 gene (using Ibactin gene as reference gene).Detect the primer of IbSWEET10 gene
For 5 '-TTTCTGTTCAAAAGTCCGATGC-3 ' and 5 '-CATTCCACGCTCTTGGTGC-3 '.Detection Ibactin gene draws
Object is 5 '-AGCAGCATGAAGATTAAGGTTGTAGCAC-3 ' and 5 '-TGGAAAATTAGAAGCACTTCCTGTGAAC-3 '.
Using the relative expression quantity of IbSWEET10 gene in sweet potato variety chestnut perfume (or spice) WT lines as 1, other sweet potatoes are planted
The relative expression quantity of IbSWEET10 gene is shown in that (WT is sweet potato variety chestnut perfume (or spice) WT lines to Fig. 2, and OCK is that sweet potato turns sky in strain
Carrier positive plant, L96 are the plant of sweet potato transgenic line L96, and L99 is the plant of sweet potato transgenic line L99, and L130 is
The plant of sweet potato transgenic line L130).The result shows that the plant of sweet potato transgenic line L96, sweet potato transgenic line L99
Plant and sweet potato transgenic line L130 plant in the relative expression quantity of IbSWEET10 gene be respectively sweet potato variety chestnut
2.99 times, 2.53 times and 3.48 times of the relative expression quantity of IbSWEET10 gene in fragrant WT lines.Sweet potato variety chestnut is fragrant
WT lines and sweet potato turn the relative expression quantity of IbSWEET10 gene in empty carrier positive plant without significant difference.
2, dead arm Resistance Identification
In triplicate, each strain plants 10 plants every time for experiment.Specific steps are as follows:
A, stem rot of sweet potato bacterium is inoculated in PDA culture medium, 28 DEG C of alternation of light and darkness culture (periods of alternation of light and darkness culture
Are as follows: light application time 13h, interlunation 11h；Intensity of illumination is 500lx) 3d, then 28 DEG C of dark culture 7d, obtain mycelia.
B, after completing step a, the mycelia is transferred to triangular flask, 100mL sterile distilled water, 100r/min oscillation is added
Then 30min uses double-layer sterile filtered through gauze, is counted under the microscope with blood counting chamber, obtaining concentration is 1.0 × 107A/
The spore suspension of mL.
C, by the almost the same sweet potato's seedlings of growing way, (sweet potato variety chestnut perfume (or spice) wild type seedlings (WT), sweet potato turn empty carrier
Positive seedling, sweet potato transgenic line L96 seedling, the seedling of sweet potato transgenic line L99 or sweet potato transgenic line L130
Seedling) clip, alignment be placed on 30min in spore suspension, be inserted into sterile sandy loam and normally cultivate.
After completing step c 9 days, the dead arm occurring degree and browning ratio (browning ratio=browning of sweet potato's seedlings are recorded
Stem length/stem overall length × 100%), and ((such as Fang Shumin sweet potato variety plants the research of dead arm resistance according to document
Object protects journal, 1988,15 (3): 185-190.) in dead arm disease scale standard carry out sick grade investigation.Dead arm disease grade
The criteria for classifying is specifically shown in Table 3.
Table 3
Part of test results is shown in Table 4.The result shows that compared with sweet potato variety chestnut perfume (or spice) wild type seedlings, sweet potato transgenosis
The dead arm disease grade and browning ratio of strain L96 seedling, sweet potato transgenic line L99 seedling and sweet potato transgenic line L130 seedling
Example significantly reduces；And sweet potato variety chestnut perfume (or spice) wild type seedlings and sweet potato turn the dead arm disease grade of empty carrier positive seedling and brown
Change ratio is without significant difference.As it can be seen that sweet potato can be enhanced to the resistance of dead arm by being overexpressed IbSWEET10 gene in sweet potato.
Table 4
<110>disease-resistance-related protein IbSWEET10 and its encoding gene and application
<120>China Agricultural University
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 1250
<212> DNA
<213>sweet potato Ipomoea batatas(L.) Lam.
<400> 1
gaaaattccg gagagtaaag atcctaagca gttttatatc tctctaaaca cagtagatat 60
atatacacac acacatatat atagagagag atttcttaca gttaactaag agaacaacac 120
tatggctctc actggtcatc aattggcttt tgcttttggt gttcttggaa acatcatctc 180
attcatcgtc ttcctttctc cactgccaac attctaccag atgtacaaga agaaatcaac 240
ggaaggatat caatcaatcc cctatgtggt tgcactgttc agtgcaatgc tttggatata 300
ctatgcattc gtgaaggcca acgactccac tcttctcatt actatcaact cctttggtat 360
ctttattgag accatttacg ttgtcttttt cctctgctac tcaaccaaga aaaccaggat 420
ccaaactttg aagtttcttg gtctgttcgt ggcggggggc ttcggtgcaa ttcttcttgt 480
cactcagttt ctgttcaaaa gtccgatgcg actccacgtg gttggatgga tcgccctcgt 540
gttctcggtg tgtgtgtttg ttgcgccatt gttcatagtg agacaagtga tccgcaccaa 600
gagcgtggaa tgcatgccag tactcctctc ggtcttcctc accgtaaatg ctgtcatgtg 660
gttcttctac ggcttgttct taaaagacat gaacattgct cttccaaatg ttctgggctt 720
catcttcggg atcctccaga tcggtctcta cctgaagtac aaagacgcga agaaagacgc 780
agtgaaggag caaaagcttc cagaagtgac aacactgcca aaaccagtca taatcttgga 840
agacaataac gacactaacg acaacaacaa caacaagcgc agcagcaagc ttcctgaact 900
caccgaggaa caaatcatcg acatcgtcaa actcggaacc ctcgtgtgct ccgagaaaat 960
ccagaagagc gccgccgccg ccgcttcacc gttcgacaag aacgccgcca ctgctcctaa 1020
gcttcaggct gtgggagctt aattcaatac aagattatcc attgatacag catatgcatg 1080
cgctatatat ataaatatat atatgtatgt ggtgaatttt gctttgggtg gtttaattta 1140
gtttttgcta tggcattact ttactttgta aacgtacgct aattggaatt tggtataatt 1200
aatgtttaat gcatgaaggt taatctaaaa aaaaaaaaaa aaaaaaaaaa 1250
<210> 2
<211> 306
<212> PRT
<213>sweet potato Ipomoea batatas(L.) Lam.
<400> 2
Met Ala Leu Thr Gly His Gln Leu Ala Phe Ala Phe Gly Val Leu Gly
1 5 10 15
Asn Ile Ile Ser Phe Ile Val Phe Leu Ser Pro Leu Pro Thr Phe Tyr
20 25 30
Gln Met Tyr Lys Lys Lys Ser Thr Glu Gly Tyr Gln Ser Ile Pro Tyr
35 40 45
Val Val Ala Leu Phe Ser Ala Met Leu Trp Ile Tyr Tyr Ala Phe Val
50 55 60
Lys Ala Asn Asp Ser Thr Leu Leu Ile Thr Ile Asn Ser Phe Gly Ile
65 70 75 80
Phe Ile Glu Thr Ile Tyr Val Val Phe Phe Leu Cys Tyr Ser Thr Lys
85 90 95
Lys Thr Arg Ile Gln Thr Leu Lys Phe Leu Gly Leu Phe Val Ala Gly
100 105 110
Gly Phe Gly Ala Ile Leu Leu Val Thr Gln Phe Leu Phe Lys Ser Pro
115 120 125
Met Arg Leu His Val Val Gly Trp Ile Ala Leu Val Phe Ser Val Cys
130 135 140
Val Phe Val Ala Pro Leu Phe Ile Val Arg Gln Val Ile Arg Thr Lys
145 150 155 160
Ser Val Glu Cys Met Pro Val Leu Leu Ser Val Phe Leu Thr Val Asn
165 170 175
Ala Val Met Trp Phe Phe Tyr Gly Leu Phe Leu Lys Asp Met Asn Ile
180 185 190
Ala Leu Pro Asn Val Leu Gly Phe Ile Phe Gly Ile Leu Gln Ile Gly
195 200 205
Leu Tyr Leu Lys Tyr Lys Asp Ala Lys Lys Asp Ala Val Lys Glu Gln
210 215 220
Lys Leu Pro Glu Val Thr Thr Leu Pro Lys Pro Val Ile Ile Leu Glu
225 230 235 240
Asp Asn Asn Asp Thr Asn Asp Asn Asn Asn Asn Lys Arg Ser Ser Lys
245 250 255
Leu Pro Glu Leu Thr Glu Glu Gln Ile Ile Asp Ile Val Lys Leu Gly
260 265 270
Thr Leu Val Cys Ser Glu Lys Ile Gln Lys Ser Ala Ala Ala Ala Ala
275 280 285
Ser Pro Phe Asp Lys Asn Ala Ala Thr Ala Pro Lys Leu Gln Ala Val
290 295 300
Gly Ala
305
<210> 3
<211> 2037
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 3
agattagcct tttcaatttc agaaagaatg ctaacccaca gatggttaga gaggcttacg 60
cagcaggtct catcaagacg atctacccga gcaataatct ccaggaaatc aaataccttc 120
ccaagaaggt taaagatgca gtcaaaagat tcaggactaa ctgcatcaag aacacagaga 180
aagatatatt tctcaagatc agaagtacta ttccagtatg gacgattcaa ggcttgcttc 240
acaaaccaag gcaagtaata gagattggag tctctaaaaa ggtagttccc actgaatcaa 300
aggccatgga gtcaaagatt caaatagagg acctaacaga actcgccgta aagactggcg 360
aacagttcat acagagtctc ttacgactca atgacaagaa gaaaatcttc gtcaacatgg 420
tggagcacga cacacttgtc tactccaaaa atatcaaaga tacagtctca gaagaccaaa 480
gggcaattga gacttttcaa caaagggtaa tatccggaaa cctcctcgga ttccattgcc 540
cagctatctg tcactttatt gtgaagatag tggaaaagga aggtggctcc tacaaatgcc 600
atcattgcga taaaggaaag gccatcgttg aagatgcctc tgccgacagt ggtcccaaag 660
atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc acgtcttcaa 720
agcaagtgga ttgatgtgat atctccactg acgtaaggga tgacgcacaa tcccactatc 780
cttcgcaaga cccttcctct atataaggaa gttcatttca tttggagaga acacggggga 840
ctctagaatg gctctcactg gtcatcaatt ggcttttgct tttggtgttc ttggaaacat 900
catctcattc atcgtcttcc tttctccact gccaacattc taccagatgt acaagaagaa 960
atcaacggaa ggatatcaat caatccccta tgtggttgca ctgttcagtg caatgctttg 1020
gatatactat gcattcgtga aggccaacga ctccactctt ctcattacta tcaactcctt 1080
tggtatcttt attgagacca tttacgttgt ctttttcctc tgctactcaa ccaagaaaac 1140
caggatccaa actttgaagt ttcttggtct gttcgtggcg gggggcttcg gtgcaattct 1200
tcttgtcact cagtttctgt tcaaaagtcc gatgcgactc cacgtggttg gatggatcgc 1260
cctcgtgttc tcggtgtgtg tgtttgttgc gccattgttc atagtgagac aagtgatccg 1320
caccaagagc gtggaatgca tgccagtact cctctcggtc ttcctcaccg taaatgctgt 1380
catgtggttc ttctacggct tgttcttaaa agacatgaac attgctcttc caaatgttct 1440
gggcttcatc ttcgggatcc tccagatcgg tctctacctg aagtacaaag acgcgaagaa 1500
agacgcagtg aaggagcaaa agcttccaga agtgacaaca ctgccaaaac cagtcataat 1560
cttggaagac aataacgaca ctaacgacaa caacaacaac aagcgcagca gcaagcttcc 1620
tgaactcacc gaggaacaaa tcatcgacat cgtcaaactc ggaaccctcg tgtgctccga 1680
gaaaatccag aagagcgccg ccgccgccgc ttcaccgttc gacaagaacg ccgccactgc 1740
tcctaagctt caggctgtgg gagcttaaga gctcgaattt ccccgatcgt tcaaacattt 1800
ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt atcatataat 1860
ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg ttatttatga 1920
gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata gaaaacaaaa 1980
tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta ctagatc 2037
<210> 4
<211> 96
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 4
atggctctca ctggtcatca attggctttt gcttttggtg ttcttggaaa catcatctca 60
ttcatcgtct tcctttctcc actgccaaca ttctac 96
Claims (12)
1. protein IbSWEET10, amino acid sequence is protein shown in sequence 2 in sequence table.
2. encoding the nucleic acid molecules of protein IbSWEET10 described in claim 1.
3. nucleic acid molecules as claimed in claim 2, it is characterised in that: the nucleic acid molecules are shown in following (a1) or (a2)
DNA molecular: (a1) nucleotide sequence is DNA molecular shown in sequence 1 in sequence table；
(a2) nucleotide sequence is the DNA molecular shown in the 122nd to 1042 from 5 ' ends of sequence 1 in sequence table.
4. expression cassette, recombinant vector or recombinant microorganism containing nucleic acid molecules described in Claims 2 or 3.
5.b1) or b2):
B1) protein IbSWEET10 described in claim 1, or, nucleic acid molecules described in Claims 2 or 3, or, containing having the right to want
Expression cassette, recombinant vector or the recombinant microorganism for seeking 2 or 3 nucleic acid molecules, the application in enhancing disease resistance of plant；It is described
Disease resistance is anti-dead arm；The plant is Dioscoreaceae plant；
B2) protein described in claim 1, or, nucleic acid molecules described in Claims 2 or 3, or, containing Claims 2 or 3 institute
The expression cassette, recombinant vector or recombinant microorganism for stating nucleic acid molecules, the application in the genetically modified plants for cultivating disease resistance enhancing；
The disease resistance is anti-dead arm；The plant is Dioscoreaceae plant.
6. application as claimed in claim 5, it is characterised in that: the Dioscoreaceae plant is sweet potato.
7. a kind of method for cultivating genetically modified plants, the nucleic acid point including protein IbSWEET10 described in claim 1 will be encoded
The step of son imports in recipient plant, obtains genetically modified plants；Genetically modified plants disease resistance compared with the recipient plant
Enhancing；The disease resistance is anti-dead arm；The plant is Dioscoreaceae plant.
8. the method for claim 7, it is characterised in that: the Dioscoreaceae plant is sweet potato.
9. the method for claim 7, it is characterised in that: the Dioscoreaceae plant is that sweet potato variety chestnut is fragrant.
10. a kind of plant breeding method includes the following steps: to increase protein IbSWEET10 described in claim 1 in plant
Content, to enhance the disease resistance of plant；The disease resistance is anti-dead arm；The plant is Dioscoreaceae plant.
11. method as claimed in claim 10, it is characterised in that: the Dioscoreaceae plant is sweet potato.
12. method as claimed in claim 10, it is characterised in that: the Dioscoreaceae plant is that sweet potato variety chestnut is fragrant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610966649.8A CN106496313B (en) | 2016-11-03 | 2016-11-03 | Disease-resistance-related protein IbSWEET10 and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610966649.8A CN106496313B (en) | 2016-11-03 | 2016-11-03 | Disease-resistance-related protein IbSWEET10 and its encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106496313A CN106496313A (en) | 2017-03-15 |
| CN106496313B true CN106496313B (en) | 2019-06-04 |
Family
ID=58321735
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610966649.8A Active CN106496313B (en) | 2016-11-03 | 2016-11-03 | Disease-resistance-related protein IbSWEET10 and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106496313B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111560056B (en) * | 2020-05-06 | 2022-04-19 | 中国农业科学院植物保护研究所 | Wheat stripe rust resistance related protein TaERF8 and coding gene and application thereof |
| CN115073573B (en) * | 2022-05-09 | 2023-04-25 | 中国农业大学 | Sweet potato stress resistance related protein IbNAC087, and coding gene and application thereof |
| CN115215931B (en) * | 2022-06-06 | 2023-05-16 | 中国农业大学 | Use of protein IbC H18 related to vine cutting disease and soft rot disease or substance for regulating and controlling expression of protein IbC H18 |
| CN116675751B (en) * | 2023-06-08 | 2024-01-26 | 山东农业大学 | Application of SWEET1g protein and encoding gene thereof in resisting potato viruses |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101775071A (en) * | 2009-11-09 | 2010-07-14 | 中国热带农业科学院橡胶研究所 | Protein for transferring saccharose and application of protein-coding gene thereof |
| CN101851629A (en) * | 2010-05-24 | 2010-10-06 | 中国科学院遗传与发育生物学研究所 | Method for improving crop output by converting sucrose transport protein gene OsSUT5Z of rice |
| CN102250227A (en) * | 2010-05-17 | 2011-11-23 | 中国科学院植物研究所 | Plant sucrose transport protein, and coding gene and application thereof |
-
2016
- 2016-11-03 CN CN201610966649.8A patent/CN106496313B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101775071A (en) * | 2009-11-09 | 2010-07-14 | 中国热带农业科学院橡胶研究所 | Protein for transferring saccharose and application of protein-coding gene thereof |
| CN102250227A (en) * | 2010-05-17 | 2011-11-23 | 中国科学院植物研究所 | Plant sucrose transport protein, and coding gene and application thereof |
| CN101851629A (en) * | 2010-05-24 | 2010-10-06 | 中国科学院遗传与发育生物学研究所 | Method for improving crop output by converting sucrose transport protein gene OsSUT5Z of rice |
Non-Patent Citations (1)
| Title |
|---|
| 植物中SWEET基因家族研究进展;刘畅;《植物生理学报》;20141231;第50卷(第9期);第1367-1373页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106496313A (en) | 2017-03-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106496313B (en) | Disease-resistance-related protein IbSWEET10 and its encoding gene and application | |
| CN104845979B (en) | Cabbage type rape SKIP gene families and its recombinant vector and application | |
| CN109306000A (en) | Resistance relevant protein IbBBX24 and its encoding gene and application | |
| CN110295185A (en) | A method of citrus is improved to canker resistance based on CsWAKL08 overexpression | |
| WO2023065966A1 (en) | Application of bfne gene in tomato plant type improvement and biological yield increase | |
| CN106480163B (en) | A method of joint apple callus cell culture and genetic transformation identify apple disease-resistant gene | |
| CN105916371A (en) | Increased protein expression in plants | |
| CN110295183A (en) | A method of citrus is improved to canker resistance based on CsPrx25 overexpression | |
| CN109111514A (en) | And the breeding method and its relevant biological material of the transgenic wheat of anti-banded sclerotial blight and root rot | |
| CN107459565A (en) | Application of the soybean drought resisting GAP-associated protein GAP in regulating and controlling soybean drought resistance | |
| CN110804090B (en) | Protein CkWRKY33 and coding gene and application thereof | |
| CN112812161B (en) | Application of protein IbMYC2 in regulation and control of plant drought resistance | |
| CN110358772A (en) | The OsEBP89 gene and preparation method of raising rice abiotic stress resistance and application | |
| CN111662366A (en) | Preparation method of early-flowering high-yield tomato material | |
| CN108640983A (en) | The application of FvCPC2 albumen and its encoding gene in the growth of regulation and control multiple eating bacterium mycelia and fruit body development | |
| CN107325161B (en) | Protein related to low-nitrogen stress and high-salt stress resistance as well as encoding gene and application thereof | |
| CN108048481A (en) | Application of the RLI1 albumen in adjusting and controlling rice leaf angle | |
| CN114621956B (en) | Drought-resistant lncRNA and application thereof | |
| CN110204600A (en) | BnSPL14 gene, albumen and its application in control cabbage type rape plant type | |
| CN105198977A (en) | Plant powdery mildew resistance-related protein Pm-2F as well as encoding gene and application thereof | |
| CN113564176B (en) | Wheat TaHAL3-7A gene and application thereof in regulating drought resistance of crops | |
| CN106349355B (en) | Resistance relevant protein IbCPK28 and its encoding gene and application | |
| CN109879945B (en) | Function and application of brassica napus pod dehiscence resistance gene BnIND | |
| CN106480069B (en) | Cucumber CsERF025 gene and its promote the straight developmental application of cucumber fruits | |
| CN106701783A (en) | Rice gene OsDF1 and application of disease control functions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |