CN106496313A - Disease-resistance-related protein IbSWEET10 and its encoding gene and application - Google Patents
Disease-resistance-related protein IbSWEET10 and its encoding gene and application Download PDFInfo
- Publication number
- CN106496313A CN106496313A CN201610966649.8A CN201610966649A CN106496313A CN 106496313 A CN106496313 A CN 106496313A CN 201610966649 A CN201610966649 A CN 201610966649A CN 106496313 A CN106496313 A CN 106496313A
- Authority
- CN
- China
- Prior art keywords
- protein
- ibsweet10
- plant
- sequence
- disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/22—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a Strep-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
- C07K2319/43—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
Abstract
The invention discloses disease-resistance-related protein IbSWEET10 and its encoding gene and application.1) or 2) or 3) the disease-resistance-related protein IbSWEET10 that the present invention is provided is for：1) aminoacid sequence is the protein in sequence table shown in sequence 2；2) fused protein that the N-terminal of the protein in sequence table shown in sequence 2 or/and C-terminal connection label are obtained；1) or 2) 3) protein shown in through the replacement of one or several amino acid residues and/or disappearance and/or is added the protein related to disease resistance of plant for obtaining.It is demonstrated experimentally that overexpression IbSWEET10 genes can strengthen resistance of the Rhizoma Dioscoreae esculentae to dead arm in Rhizoma Dioscoreae esculentae.Therefore, disease-resistance-related protein IbSWEET10 and its encoding gene have important theory significance and practical value in regulation and control disease resistance of plant.
Description
Technical field
The invention belongs to biological technical field, and in particular to disease-resistance-related protein IbSWEET10 and its encoding gene with should
With.
Background technology
Rhizoma Dioscoreae esculentae (Ipomoea batatas (L.) Lam.) is a kind of important grain, feedstuff and the raw material of industry with crop,
And in today's world as a kind of novel energy plant, its status is particularly important.China is the sweet of maximum in the world
Potato manufacturing country, 338.7 ten thousand hm of Annual planting area2, the 42.2% of the total cultivated area in the world is accounted for, annual production accounts for Gross World Product
67.94%.China is currently under the period for developing rapidly, and the demand of the energy is continued to increase, demand of the people to Rhizoma Dioscoreae esculentae
Increasing, therefore breeding high-yield, high-quality, multi-resistance and tailored version new varieties become the main target of China's Sweet Potato Breeding.Rhizoma Dioscoreae esculentae
It is the seventh-largest cereal crops in the world, but Rhizoma Dioscoreae esculentae pest and disease damage worldwide generally existing, various countries' Rhizoma Dioscoreae esculentae production is seriously threaten,
Yield of sweet potato, quality and Storage is caused significantly to decline, the heavier always master regarding Rhizoma Dioscoreae esculentae of each Rhizoma Dioscoreae esculentae production country of the world
Want the preventing and treating of pest and disease damage.
Stem rot of sweet potato, also known as Rhizoma Dioscoreae esculentae droop, Rhizoma Dioscoreae esculentae blight dis-ease, fusarium wilt of sweet potato or Rhizoma Dioscoreae esculentae stem rot, is typical
Fusarium spp. conduit disease, is one of the important disease in south China potato area, and very harmful.Stem rot of sweet potato is by stem rot of sweet potato bacterium
Cause.Stem rot of sweet potato bacterium can survive for many years in soil.The pathogenesis of stem rot of sweet potato bacterium are：By rice shoot base portion or root
The wound in portion, or, invading rice shoot by potato seed of carrying disease germs by conduit, breeds in tracheal tissue, causes ill plant that Herb occurs
Property withered, dead, show overground part blade and turn yellow from bottom to top to come off, cauline bundle becomes brown, last stem's cracking, whole strain
Withered.
Rhizoma Dioscoreae esculentae is asexually propagated crop, and with inter-species, the incompatible characteristic of intraspecific hybridization, the characteristic seriously limits Rhizoma Dioscoreae esculentae
The utilization of resources and parent in breeding is freely assembled.Long-term breeding practice have shown that, conventional cross-breeding method is difficult to select excellent
Matter, high yield, the Sweetpotato of anti-dead arm.Therefore, using the Sweetpotato of the anti-dead arm of technique for gene engineering cultivation it is
A kind of feasible way.
Content of the invention
The technical problem to be solved is the resistance for how strengthening plant to stem rot of sweet potato.
For solving the above problems, present invention firstly provides a kind of disease-resistance-related protein.
Disease-resistance-related protein provided by the present invention, entitled protein IbSWEET10, from Rhizoma Dioscoreae esculentae
(Ipomoeabatatas (L.) Lam.), be following 1) or 2) or 3)：
1) aminoacid sequence is the protein in sequence table shown in sequence 2；
2) fused protein that the N-terminal of the protein in sequence table shown in sequence 2 or/and C-terminal connection label are obtained；
1) or 2) 3) protein shown in through the replacement of one or several amino acid residues and/or disappearance and/or is added
Plus the protein related to disease resistance of plant for obtaining.
Wherein, in sequence table, sequence 2 is made up of 306 amino acid residues.
In order that 1) protein in is easy to purification, can in the amino terminal of the protein shown in sequence in sequence table 2 or
The upper label as shown in table 1 of carboxyl terminal connection.
The sequence of 1. label of table
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (usually 5) | RRRRR |
| Poly-His | 2-10 (usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
Above-mentioned 3) in protein IbSWEET10, the replacement of one or several amino acid residue and/or disappearance and/
Or it is added to replacement and/or disappearance and/or interpolation less than 10 amino acid residues.
Above-mentioned 3) in protein IbSWEET10 can synthetic, also can first synthesize its encoding gene, then carry out biological table
Reach.
Above-mentioned 3) in protein IbSWEET10 encoding gene can by by sequence in sequence table 1 from 5 ' ends
The codon of one or several amino acid residues is lacked in DNA sequence shown in 122 to 1042, and/or carries out one or several
The missense mutation of individual base pair, and/or hold the coded sequence for connecting the label shown in table 1 to obtain at its 5 ' end and/or 3 '.
The nucleic acid molecules of code for said proteins IbSWEET10 fall within protection scope of the present invention.
The nucleic acid molecules of the coded protein IbSWEET10 can be shown in following (a1) or (a2) or (a3) or (a4)
DNA molecular：
(a1) nucleotide sequence is the DNA molecular in sequence table shown in sequence 1；
(a2) nucleotide sequence is DNA molecular of the sequence 1 from 5 ' ends shown in the 122nd to 1042 in sequence table；
(a3) nucleotide sequence limited with (a1) or (a2) has 75% or more than 75% homogeneity, and encodes the egg
The DNA molecular of white matter IbSWEET10；
(a4) nucleotide sequence hybridization for limiting with (a1) or (a2) under strict conditions, and code for said proteins
The DNA molecular of IbSWEET10.
Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules also may be used
Being RNA, such as mRNA or hnRNA etc..
Wherein, in sequence table, sequence 1 is made up of 1250 nucleotide, the nucleotide coding sequence table of sequence 1 in sequence table
Aminoacid sequence shown in middle sequence 2.
Those of ordinary skill in the art can easily adopt known method, the side of such as orthogenesiss and point mutation
Method, is mutated to the nucleotide sequence of the coded protein IbSWEET10 of the present invention.Those have through manually modified
The nucleotide sequence 80% or the nucleotide of higher homogeneity of the protein IbSWEET10 isolated with the present invention, as long as
Coded protein IbSWEET10 and related to disease resistance of plant, is to be derived from the nucleotide sequence of the present invention and be equal to
The sequence of the present invention.
Term " homogeneity " used herein refers to the sequence similarity with native sequence nucleic acid." homogeneity " includes and this
The nucleotide sequence of the protein of the aminoacid sequence composition in bright polynucleotide shown in sequence 2 has 80% or higher,
Or 85% or higher, or 90% or higher, or the nucleotide sequence of 95% or higher homogeneity.Homogeneity with the naked eye or can be counted
Calculation machine software is evaluated.Using computer software, the homogeneity between two or more sequences can use percentage ratio (%) table
Show, which can be used to evaluate the homogeneity between correlated serieses.
The expression cassette of the nucleic acid molecules containing code for said proteins IbSWEET10, recombinant vector, recombinant microorganism turn
Gene cell system falls within protection scope of the present invention.
The expression cassette can be expression cassette A；The expression cassette A includes promoter, code for said proteins IbSWEET10
Nucleic acid molecules and terminator.The promoter can be CaMV35S promoteres, NOS promoteres or OCS promoteres.The terminator
Can be NOS terminator or OCS polyA terminators.
The sequence of the expression cassette A can be shown in sequence 3 in sequence table.In the expression cassette A：In sequence table sequence 3 from
5 ' ends play the 1st to 835 for CaMV35S promoteres, the 848th to 1768 core for code for said proteins IbSWEET10
Acid molecule, the 1785th to 2037 is NOS terminator.
The recombinant vector can be by the nucleic acid molecules of code for said proteins IbSWEET10 (i.e. in sequence table sequence 1 from
DNA molecular shown in 5 ' ends the 122nd to 1042) by the nucleic acid molecules containing code for said proteins IbSWEET10
Expression cassette insertion set out the recombiant plasmid that plasmid obtains.
The recombinant vector concretely recombiant plasmid pCB-IbSWEET10.The structure of recombiant plasmid pCB-IbSWEET10
Process is as follows：(A) carrier framework is obtained with restricted enzyme HindIII and EcoRI double digestion carrier pCAMBIA3301, use
Restricted enzyme HindIII and EcoRI double digestion carrier pBI121, reclaims the fragment of about 3032bp, by the carrier framework
Connect with the fragment, obtain recombiant plasmid pCBGUS；(B) with sequence in sequence table 1 from 5 ' ends the 122nd to 1042 institute
The DNA molecular for showing replaces fragment (the restructuring matter between the restricted enzyme XbaI and SacI recognition sequence of recombiant plasmid pCBGUS
Grain pCBGUS is cut into a large fragment and a small fragment by restriction endonuclease XbaI and SacI, and the DNA is the small pieces
Section) the recombiant plasmid pCB-IbSWEET10 that obtains, the egg in recombiant plasmid pCB-IbSWEET10 expressed sequence tables shown in sequence 2
White matter IbSWEET10.The difference of the recombiant plasmid pCBGUS and recombiant plasmid pCB-IbSWEET10 is only that recombiant plasmid
(recombiant plasmid pCBGUS is restricted for DNA fragmentation between restriction endonuclease XbaI of pCBGUS and SacI recognition sequences
Cobra venom endonuclease XbaI and SacI are cut into a large fragment and a small fragment, and the DNA is the small fragment) replace with sequence table
DNA molecular of the sequence 1 from 5 ' ends shown in the 122nd to 1042.
The recombinant microorganism can be obtained by the recombinant vector is imported microorganism of setting out.
The microorganism of setting out can be yeast, antibacterial, algae or funguses.The antibacterial can be gram-positive bacterium or leather
Gram-negative bacteria.The gram negative bacteria can be Agrobacterium tumefaciems (Agrobacterium tumefaciens).Described
Agrobacterium tumefaciems (Agrobacterium tumefaciens) concretely Agrobacterium tumefaciems EHA105.
The recombinant microorganism concretely EHA105/pCB-IbSWEET10.EHA105/pCB-IbSWEET10 is by weight
The recombinational agrobacterium that group plasmid pCB-IbSWEET10 conversion Agrobacterium tumefaciems EHA105 are obtained.
The transgenic plant cells system does not include propagating materialss.The transgenic plant is interpreted as not only including institute
The first generation transgenic plant that IbSWEET10 gene transformation recipient plants are obtained is stated, also includes its filial generation.For transgenic is planted
Thing, can breed the gene in the species, it is also possible to which the gene transfer is entered traditional breeding method other of same species
In kind, particularly including commercial variety.The transgenic plant includes seed, calluss, whole plant and cell.
Following b1) or b2) fall within protection scope of the present invention；
B1) the protein IbSWEET10, or, the nucleic acid molecules of code for said proteins IbSWEET10, or, containing volume
The expression cassette of the nucleic acid molecules of the code protein IbSWEET10, recombinant vector, recombinant microorganism or transgenic cell line,
Application in regulation and control disease resistance of plant；
B2) the protein IbSWEET10, or, the nucleic acid molecules of code for said proteins IbSWEET10, or, containing volume
The expression cassette of the nucleic acid molecules of the code protein IbSWEET10, recombinant vector, recombinant microorganism or transgenic cell line,
Cultivate the application in the disease-resistant transgenic plant for sexually revising.
The b1) in, the regulation and control disease resistance of plant can be to strengthen disease resistance of plant.
The b2) in, disease-resistant the sexually revising can strengthen for disease resistance.
For solving above-mentioned technical problem, present invention also offers a kind of method for cultivating transgenic plant.
The method for cultivating transgenic plant provided by the present invention, it may include by code for said proteins IbSWEET10
Nucleic acid molecules are imported in recipient plant, the step of obtain transgenic plant；The transgenic plant is compared with the recipient plant
Disease resistance strengthens.
In the method for above-mentioned cultivation transgenic plant, the nucleic acid molecules of the coded protein IbSWEET10 can be as follows
(a1) DNA molecular or shown in (a2) or (a3) or (a4)：
(a1) nucleotide sequence is the DNA molecular in sequence table shown in sequence 1；
(a2) nucleotide sequence is DNA molecular of the sequence 1 from 5 ' ends shown in the 122nd to 1042 in sequence table；
(a3) nucleotide sequence limited with (a1) or (a2) has 75% or more than 75% homogeneity, and encodes the egg
The DNA molecular of white matter IbSWEET10；
(a4) nucleotide sequence hybridization for limiting with (a1) or (a2) under strict conditions, and code for said proteins
The DNA molecular of IbSWEET10.
Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules also may be used
Being RNA, such as mRNA or hnRNA etc..
Wherein, in sequence table, sequence 1 is made up of 1250 nucleotide, the nucleotide coding sequence table of sequence 1 in sequence table
Aminoacid sequence shown in middle sequence 2.
For solving above-mentioned technical problem, present invention also offers a kind of plant breeding method.
Plant breeding method provided by the present invention, it may include following steps：Increase protein described in plant
The content or activity of IbSWEET10, so that strengthen the disease resistance of plant.
Any of the above-described disease resistance can be anti-dead arm.
Any of the above-described disease resistance can be the microbial disease of anti-stem rot of sweet potato.
Any of the above-described plant can be following c1) to c5) in any one：
C1) dicotyledon；
C2) monocotyledon；
C3) Dioscoreaceae plant；
C4) Rhizoma Dioscoreae esculentae；
C5) sweet potato variety Semen Castaneae is fragrant.
It is demonstrated experimentally that the disease-resistance-related protein IbSWEET10 provided using the present invention and its encoding gene can strengthen plant
Resistance to dead arm：Compared with sweet potato variety Semen Castaneae perfume wild type seedlings, Rhizoma Dioscoreae esculentae transgenic line L96 seedling, Rhizoma Dioscoreae esculentae turn base
Because the dead arm disease level of strain L99 seedling and Rhizoma Dioscoreae esculentae transgenic line L130 seedling reduces significantly reducing with browning ratio；And it is sweet
Potato kind Semen Castaneae perfume wild type seedlings and Rhizoma Dioscoreae esculentae turn the dead arm disease level and browning ratio of empty carrier positive seedling without significance difference
Different.Therefore, disease-resistance-related protein IbSWEET10 and its encoding gene have important theory significance in regulation and control disease resistance of plant
And practical value.
Description of the drawings
Fig. 1 is the PCR amplifications that Rhizoma Dioscoreae esculentae intends transfer-gen plant.
Qualification results of the Fig. 2 for Rhizoma Dioscoreae esculentae transgenic line.
Specific embodiment
The present invention is further described in detail with reference to specific embodiment, the embodiment for being given is only for explaining
The bright present invention, rather than in order to limit the scope of the present invention.
Experimental technique in following embodiments, if no special instructions, is conventional method.
In following embodiments, material used, reagent etc., if no special instructions, commercially obtain.
ND98 (is recorded in following document：He et al., Plant Cell Tissue and Organ Culture,
2009,96:69-74.ND98 entitled LM1 in the publication) it is a Rhizoma Dioscoreae esculentae strain, the public can be from China Agricultural University Rhizoma Dioscoreae esculentae
Genetic breeding research room obtains, to repeat this experiment.
Semen Castaneae perfume (Wang Yuping etc., Scientia Agricultura Sinica, 2003,36 (9)：It is 1000-1005) sweet potato variety, Gong Zhongke
Obtain from China Agricultural University's Rhizoma Dioscoreae esculentae genetic breeding research room, to repeat this experiment.
Cloning vehicle pMD19-T is precious biological engineering (Dalian) Products, and catalog number is 6013.Carrier
PCAMBIA3301 is Cambia Products.Carrier pBI121 is Clontech Products.Plant total RNA extraction reagent box
For TIANGEN Biotech's product, catalog number (Cat.No.) is DP432.PrimeScriptTM1st Strand cDNA
Products of the Synthesis Kit for precious biological engineering (Dalian) company limited, catalog number is 6110A.
Stem rot of sweet potato bacterium and PDA culture medium are recorded in following document：Family merit, Yu Ping, Fang Yihong, Li Wei. Rhizoma Dioscoreae esculentae
Property testing .2007 November of the dead arm bacterium to the induction of resistance and PR albumen of Rhizoma Dioscoreae esculentae, Fujian Normal University's journal (natural section
Learn version).
Embodiment 1, the acquisition of IbSWEET10 genes
The step of acquisition of IbSWEET10 genes, is as follows：
1st, the acquisition of template
The total serum IgE that ND98 young leaflet tablets are extracted with plant total RNA extraction reagent box, by total serum IgE PrimeScriptTM
1st Strand cDNA Synthesis Kit reverse transcriptions go out the first chain cDNA.
2nd, est sequence is obtained from the SSH cDNA library using Subtractive hybridization technique construction.The core of est sequence
In nucleotide sequence such as sequence table shown in sequence 4.
3rd, according to the nucleotide sequence of est sequence, primer 3GSP1 and 3GSP2 are designed and synthesized.
4th, after completing step 3, as template, the 3GSP1 and 3GSP2 with step 3 synthesis is as drawing for the cDNA obtained with step 1
Thing, expands the 3 '-RACE fragments for obtaining about 1100bp using RACE methods, and 3 '-RACE fragments and cloning vehicle pMD19-T are connected
Connect, obtain recombiant plasmid 2.Recombiant plasmid 2 is sequenced, the nucleotide sequence of 3 '-RACE fragments is obtained.According to 3 '-RACE
The nucleotide sequence of fragment, designs and synthesizes primer 5GSP1 and 5GSP2.
5th, after completing step 4, as template, the 5GSP1 and 5GSP2 with step 4 synthesis is as drawing for the cDNA obtained with step 1
Thing, expands the 5 '-RACE fragments for obtaining about 200bp using RACE methods, and 5 '-RACE fragments and cloning vehicle pMD19-T are connected
Connect, obtain recombiant plasmid 3.Recombiant plasmid 3 is sequenced, the nucleotide sequence of 5 '-RACE fragments is obtained.
6th, after completing step 5, using the IbSWEET10 genes of 6.0 softwares of DNAMAN splicing candidate.According to splicing candidate
IbSWEET10 gene orders further design and synthesize the primer O-F and O-R of IbSWEET10 gene ORF.
7th, after completing step 6, with step 1 obtain cDNA as template, with step 6 synthesis O-F and O-R as primer, PCR
Amplification obtains the pcr amplification product of about 921bp and is sequenced.
The nucleotide sequence information of above-mentioned primer 3GSP1,3GSP2,5GSP1,5GSP2, O-F and O-R refers to table 2.
As a result show, in the nucleotide sequence such as sequence table of the pcr amplification product that step 7 is obtained, sequence 1 is from 5 ' ends
Shown in 122nd to 1042, it is IbSWEET10 genes by the unnamed gene shown in the sequence, its albumen for encoding is named as
IbSWEET10 albumen or protein IbSWEET10, in aminoacid sequence such as sequence table shown in sequence 2.
2. primer sequence information of table
| Primer | Sequence information 5'-3' |
| 3GSP1 | 5'-ATGGCTCTCACTGGTCATCAATT-3' |
| 3GSP2 | 5'-TCATCTCATTCATCGTCTTCCTTTC-3' |
| 5GSP1 | 5'-GTAGAATGTTGGCAGTGGAGAAAG-3' |
| 5GSP2 | 5'-AAAGCAAAAGCCAATTGATGACC-3' |
| O-F | 5'-ATGGCTCTCACTGGTCATCAA-3' |
| O-R | 5'-TTAAGCTCCCACAGCCTGAA-3' |
The application of embodiment 2, IbSWEET10 albumen in the dead arm resistance for strengthening Rhizoma Dioscoreae esculentae
First, the structure of recombiant plasmid
1st, the double chain DNA molecule in artificial synthesized sequence table shown in sequence 1.With the double chain DNA molecule as template, with OS-
F-XbaI：GCTCTAGAATGGCTCTCACTGGTCATCAA (recognition sequence of the underscore for restricted enzyme XbaI) and OS-
R-SacI：CGAGCTCTTAAGCTCCCACAGCCTGAA (recognition sequence of the underscore for restricted enzyme SacI) is primer
Enter performing PCR amplification, obtain N-terminal and contain the double-stranded DNA point that restricted enzyme XbaI and C-terminal contain restricted enzyme SacI
Son.
2nd, the N-terminal obtained in step 1 is contained restricted enzyme XbaI and C-terminal contains the double of restricted enzyme SacI
Ssdna molecule is connected to cloning vehicle pMD19-T, obtains recombiant plasmid pMD19-IbSWEET10.
3rd, after completing step 2, with restricted enzyme XbaI and SacI double digestion recombiant plasmid pMD19-IbSWEET10,
Reclaim the fragment 1 of about 1.0kb.
4th, the load of about 11256bp, with restricted enzyme HindIII and EcoRI double digestion carrier pCAMBIA3301, is reclaimed
Body skeleton 1.
5th, with restricted enzyme HindIII and EcoRI double digestion carrier pBI121, the fragment comprising about 3032bp is reclaimed
2.
6th, fragment 2 is connected with carrier framework 1, obtains recombiant plasmid pCBGUS.
7th, the carrier bone of about 12000bp, with restricted enzyme XbaI and SacI double digestion recombiant plasmid pCBGUS, is reclaimed
Frame 2.
8th, fragment 1 and carrier framework 2 are connected, obtains recombiant plasmid pCB-IbSWEET10.
According to sequencing result, structure is carried out to recombiant plasmid pCB-IbSWEET10 and is described as follows：By recombiant plasmid pCBGUS
Restricted enzyme XbaI and SacI recognition sequence between small fragment replace with sequence table sequence 1 the 122nd from 5 ' ends
To the DNA molecular shown in 1042.IbSWEET10 eggs in recombiant plasmid pCB-IbSWEET10 expressed sequence tables shown in sequence 2
In vain.
Recombiant plasmid pCB-IbSWEET10 has an expression cassette A, sequence in the nucleotide sequence such as sequence table of expression cassette A
Shown in row 3, wherein in sequence table sequence 3 from 5 ' ends the 1st to 835 be CaMV35S promoteres, the 848th to 1768 is
The encoding gene of IbSWEET10 albumen, the 1785th to 2037 is NOS terminator.
2nd, the acquisition of recombinational agrobacterium and the regeneration of Rhizoma Dioscoreae esculentae transfer-gen plant
1st, recombiant plasmid pCB-IbSWEET10 is converted Agrobacterium tumefaciems EHA105, obtains recombinational agrobacterium first, will restructuring
Agrobacterium first is named as EHA105/pCB-IbSWEET10.
2nd, the shoot apical meristem of the Semen Castaneae perfume for being about 0.5mm is stripped, embryonic callus induction solid medium is placed in
On (the MS solid mediums containing 2.0mg/L 2,4-D and 3.0% sucrose), 27 ± 1 DEG C are cultivated 8 weeks, obtain embryo callus,
Then embryo callus are placed in embryonic callus induction fluid medium (containing 2.0mg/L 2,4-D and 3.0% sucrose
MS fluid mediums) in, on horizontal shaker, (actual conditions is vibration brightness alternate culture 3d：100r/min；27℃；Brightness is handed over
For the cycle that cultivates it is：Light application time is 13h, interlunation 11h；Intensity of illumination is 500lx), obtain a diameter of 0.7-1.3mm
Embryogenic cell masses.
3rd, after completing step 2, EHA105/pCB-IbSWEET10 is converted by cells,primordial using agriculture bacillus mediated method
Group, is subsequently placed in co-cultivation base (AS containing 30mg/L, 2.0mg/L 2, the MS solid mediums of 4-D), 28 DEG C of light culture 3d.
4th, after completing step 3, by Embryogenic cell masses cefotaxime sodium containing 900mg/L (cefotaxime sodium, CS)
With 2.0mg/L 2, the MS fluid mediums of 4-D wash 2 times, be subsequently placed in Selective agar medium (containing 2.0mg/L 2,4-D,
The solidified MS media of 100mg/L CS and 0.5mg/L glufosinate-ammoniums (phosphinothricin, PPT)) on, 27 ± 1 DEG C of dark trainings
Foster 10-12 weeks (Selective agar medium need to be changed per 2 weeks).
5th, after completing step 4, by Embryogenic cell masses be placed in somatic embryo inducement culture medium (containing 1.0mg/L ABA,
The MS solid mediums of 100mg/L CS and 0.5mg/L PPT) on, (light application time is 13h, black for 27 ± 1 DEG C of alternation of light and darkness cultures
Dark time 11h；Intensity of illumination is 3000lx) 2-4 weeks, obtain resistant calli.
6th, after completing step 5, resistant calli is placed on MS solid mediums, 27 ± 1 DEG C of alternation of light and darkness culture (light
The cycle of dark alternate culture is：Light application time is 13h, interlunation 11h；Intensity of illumination is 3000lx) 4-8 weeks, that is, obtain 150
Strain Rhizoma Dioscoreae esculentae intends transfer-gen plant, names L1-L150 successively.
7th, the Rhizoma Dioscoreae esculentae that extraction step 6 is obtained respectively intends the genomic DNA of the young leaflet tablet of transfer-gen plant, and with the gene
Group DNA is template, with T35-F：5'-TTGATGTGATATCTCCACTGACG-3' and TS-R：5'-
GGTAGAGACCGATCTGGAGGA-3' enters performing PCR amplification for primer, obtains pcr amplification product；If contained in pcr amplification product
There is the band of about 700bp, then corresponding Rhizoma Dioscoreae esculentae intends transfer-gen plant as Rhizoma Dioscoreae esculentae transgenic positive plant.Replaced with equal-volume water
Rhizoma Dioscoreae esculentae intends the genomic DNA of the young leaflet tablet of transfer-gen plant, enters performing PCR amplification, as negative control.Use sweet potato variety Semen Castaneae
The genomic DNA of the young leaflet tablet of fragrant WT lines replaces Rhizoma Dioscoreae esculentae to intend the genomic DNA of the young leaflet tablet of transfer-gen plant, enters
Performing PCR is expanded, used as control.Rhizoma Dioscoreae esculentae is replaced to intend the base of the young leaflet tablet of transfer-gen plant with recombiant plasmid pCB-IbSWEET10
Because of a group DNA, enter performing PCR amplification, as positive control.
Part of test results is shown in that (M is DNA molecular Marker to Fig. 1, and W is negative control, and P is positive control, and WT is Rhizoma Dioscoreae esculentae product
Plant the genomic DNA of the young leaflet tablet of Semen Castaneae perfume WT lines, L4, L5, L6, L10, L14, L56, L63, L96, L99, L121
Rhizoma Dioscoreae esculentae is with L130 and intends transfer-gen plant).As a result show, L4, L5, L6, L10, L14, L56, L63, L96, L99, L121 and
L130 is Rhizoma Dioscoreae esculentae transgenic positive plant.
The Rhizoma Dioscoreae esculentae transgenic positive plant obtained using the identification of vegetative method expanding propagation, is expanded by one plant of transgenic seedlings
Numerous plant for obtaining is used as a strain.The strain of L96, L99 and L130 is named as Rhizoma Dioscoreae esculentae transgenic line L96, Rhizoma Dioscoreae esculentae to turn
Gene strain L99 and Rhizoma Dioscoreae esculentae transgenic line L130.
4th, the acquisition of control Agrobacterium tumefaciems and Rhizoma Dioscoreae esculentae turn the regeneration of empty carrier plant
Replace recombiant plasmid pCB-IbSWEET10 with recombiant plasmid pCBGUS, other same step 3 obtain recombinational agrobacterium
Second (being named as EHA105/pCBGUS) and Rhizoma Dioscoreae esculentae turn empty carrier positive plant.
4th, dead arm Resistance Identification
1st, the identification of Rhizoma Dioscoreae esculentae transgenic line
Rhizoma Dioscoreae esculentae plant is extracted with plant total RNA extraction reagent box, and (sweet potato variety Semen Castaneae perfume WT lines (WT), Rhizoma Dioscoreae esculentae turn
Empty carrier positive plant (OCK), the plant of Rhizoma Dioscoreae esculentae transgenic line L96, the plant of Rhizoma Dioscoreae esculentae transgenic line L99 and Rhizoma Dioscoreae esculentae turn base
Plant because of strain L130) young leaflet tablet total serum IgE, by total serum IgE PrimeScriptTM1stStrand cDNA
Synthesis Kit reverse transcriptions go out the first chain cDNA, then with the cDNA as template, in Real_time quantitative detection Rhizoma Dioscoreae esculentae plant
The relative expression quantity (using Ibactin genes as reference gene) of IbSWEET10 genes.The primer of detection IbSWEET10 genes
For 5 '-TTTCTGTTCAAAAGTCCGATGC-3 ' and 5 '-CATTCCACGCTCTTGGTGC-3 '.Detect drawing for Ibactin genes
Thing is 5 '-AGCAGCATGAAGATTAAGGTTGTAGCAC-3 ' and 5 '-TGGAAAATTAGAAGCACTTCCTGTGAAC-3 '.
Using the relative expression quantity of IbSWEET10 genes in sweet potato variety Semen Castaneae perfume WT lines as 1, other Rhizoma Dioscoreaes esculentae are planted
In strain, the relative expression quantity of IbSWEET10 genes is shown in that (WT is sweet potato variety Semen Castaneae perfume WT lines to Fig. 2, and OCK is that Rhizoma Dioscoreae esculentae turns sky
Carrier positive plant, plant of the L96 for Rhizoma Dioscoreae esculentae transgenic line L96, plant of the L99 for Rhizoma Dioscoreae esculentae transgenic line L99, L130 is
The plant of Rhizoma Dioscoreae esculentae transgenic line L130).As a result show, the plant of Rhizoma Dioscoreae esculentae transgenic line L96, Rhizoma Dioscoreae esculentae transgenic line L99
Plant and Rhizoma Dioscoreae esculentae transgenic line L130 plant in IbSWEET10 genes relative expression quantity be respectively sweet potato variety Semen Castaneae
2.99 times, 2.53 times and 3.48 times of the relative expression quantity of IbSWEET10 genes in fragrant WT lines.Sweet potato variety Semen Castaneae is fragrant
WT lines and Rhizoma Dioscoreae esculentae turn the relative expression quantity of IbSWEET10 genes in empty carrier positive plant without significant difference.
2nd, dead arm Resistance Identification
In triplicate, each strain plants 10 plants every time for experiment.Concrete operation step is as follows：
A, stem rot of sweet potato bacterium is inoculated in PDA culture medium, 28 DEG C of alternation of light and darkness culture (cycles of alternation of light and darkness culture
For：Light application time is 13h, interlunation 11h；Intensity of illumination is 500lx) 3d, then 28 DEG C of light culture 7d, obtain mycelia.
B, complete step a after, the mycelia is transferred to triangular flask, adds 100mL sterile distilled waters, 100r/min to vibrate
30min, then uses double-layer sterile filtered through gauze, is counted with blood counting chamber under the microscope, obtains concentration for 1.0 × 107Individual/
The spore suspension of mL.
C, by basically identical for growing way sweet potato's seedlings, (sweet potato variety Semen Castaneae perfume wild type seedlings (WT), Rhizoma Dioscoreae esculentae turn empty carrier
Positive seedling, the seedling of Rhizoma Dioscoreae esculentae transgenic line L96, the seedling of Rhizoma Dioscoreae esculentae transgenic line L99 or Rhizoma Dioscoreae esculentae transgenic line L130
Seedling) clip, be placed in 30min in spore suspension after alignment, be inserted into normally cultivating in aseptic sandy loam.
After completing step c 9 days, dead arm occurring degree and browning ratio (the browning ratio=browning of sweet potato's seedlings are recorded
Cane length/cane total length × 100%), and according to document ((Fang Shumin etc. research of the sweet potato variety to dead arm resistance. plant
Thing protection journal, 1988,15 (3)：Dead arm disease scale standard in 185-190.) carries out disease level investigation.Dead arm disease level
The criteria for classifying is specifically shown in Table 3.
Table 3
Part of test results is shown in Table 4.As a result show, compared with sweet potato variety Semen Castaneae perfume wild type seedlings, Rhizoma Dioscoreae esculentae transgenic
The dead arm disease level of strain L96 seedling, Rhizoma Dioscoreae esculentae transgenic line L99 seedling and Rhizoma Dioscoreae esculentae transgenic line L130 seedling and browning ratio
Example is significantly reduced；And sweet potato variety Semen Castaneae perfume wild type seedlings and Rhizoma Dioscoreae esculentae turn the dead arm disease level and brown of empty carrier positive seedling
Change ratio is without significant difference.It can be seen that, in Rhizoma Dioscoreae esculentae, overexpression IbSWEET10 genes can strengthen resistance of the Rhizoma Dioscoreae esculentae to dead arm.
Table 4
<110>Disease-resistance-related protein IbSWEET10 and its encoding gene and application
<120>China Agricultural University
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 1250
<212> DNA
<213>Rhizoma Dioscoreae esculentae Ipomoea batatas（L.）Lam.
<400> 1
gaaaattccg gagagtaaag atcctaagca gttttatatc tctctaaaca cagtagatat 60
atatacacac acacatatat atagagagag atttcttaca gttaactaag agaacaacac 120
tatggctctc actggtcatc aattggcttt tgcttttggt gttcttggaa acatcatctc 180
attcatcgtc ttcctttctc cactgccaac attctaccag atgtacaaga agaaatcaac 240
ggaaggatat caatcaatcc cctatgtggt tgcactgttc agtgcaatgc tttggatata 300
ctatgcattc gtgaaggcca acgactccac tcttctcatt actatcaact cctttggtat 360
ctttattgag accatttacg ttgtcttttt cctctgctac tcaaccaaga aaaccaggat 420
ccaaactttg aagtttcttg gtctgttcgt ggcggggggc ttcggtgcaa ttcttcttgt 480
cactcagttt ctgttcaaaa gtccgatgcg actccacgtg gttggatgga tcgccctcgt 540
gttctcggtg tgtgtgtttg ttgcgccatt gttcatagtg agacaagtga tccgcaccaa 600
gagcgtggaa tgcatgccag tactcctctc ggtcttcctc accgtaaatg ctgtcatgtg 660
gttcttctac ggcttgttct taaaagacat gaacattgct cttccaaatg ttctgggctt 720
catcttcggg atcctccaga tcggtctcta cctgaagtac aaagacgcga agaaagacgc 780
agtgaaggag caaaagcttc cagaagtgac aacactgcca aaaccagtca taatcttgga 840
agacaataac gacactaacg acaacaacaa caacaagcgc agcagcaagc ttcctgaact 900
caccgaggaa caaatcatcg acatcgtcaa actcggaacc ctcgtgtgct ccgagaaaat 960
ccagaagagc gccgccgccg ccgcttcacc gttcgacaag aacgccgcca ctgctcctaa 1020
gcttcaggct gtgggagctt aattcaatac aagattatcc attgatacag catatgcatg 1080
cgctatatat ataaatatat atatgtatgt ggtgaatttt gctttgggtg gtttaattta 1140
gtttttgcta tggcattact ttactttgta aacgtacgct aattggaatt tggtataatt 1200
aatgtttaat gcatgaaggt taatctaaaa aaaaaaaaaa aaaaaaaaaa 1250
<210> 2
<211> 306
<212> PRT
<213>Rhizoma Dioscoreae esculentae Ipomoea batatas（L.）Lam.
<400> 2
Met Ala Leu Thr Gly His Gln Leu Ala Phe Ala Phe Gly Val Leu Gly
1 5 10 15
Asn Ile Ile Ser Phe Ile Val Phe Leu Ser Pro Leu Pro Thr Phe Tyr
20 25 30
Gln Met Tyr Lys Lys Lys Ser Thr Glu Gly Tyr Gln Ser Ile Pro Tyr
35 40 45
Val Val Ala Leu Phe Ser Ala Met Leu Trp Ile Tyr Tyr Ala Phe Val
50 55 60
Lys Ala Asn Asp Ser Thr Leu Leu Ile Thr Ile Asn Ser Phe Gly Ile
65 70 75 80
Phe Ile Glu Thr Ile Tyr Val Val Phe Phe Leu Cys Tyr Ser Thr Lys
85 90 95
Lys Thr Arg Ile Gln Thr Leu Lys Phe Leu Gly Leu Phe Val Ala Gly
100 105 110
Gly Phe Gly Ala Ile Leu Leu Val Thr Gln Phe Leu Phe Lys Ser Pro
115 120 125
Met Arg Leu His Val Val Gly Trp Ile Ala Leu Val Phe Ser Val Cys
130 135 140
Val Phe Val Ala Pro Leu Phe Ile Val Arg Gln Val Ile Arg Thr Lys
145 150 155 160
Ser Val Glu Cys Met Pro Val Leu Leu Ser Val Phe Leu Thr Val Asn
165 170 175
Ala Val Met Trp Phe Phe Tyr Gly Leu Phe Leu Lys Asp Met Asn Ile
180 185 190
Ala Leu Pro Asn Val Leu Gly Phe Ile Phe Gly Ile Leu Gln Ile Gly
195 200 205
Leu Tyr Leu Lys Tyr Lys Asp Ala Lys Lys Asp Ala Val Lys Glu Gln
210 215 220
Lys Leu Pro Glu Val Thr Thr Leu Pro Lys Pro Val Ile Ile Leu Glu
225 230 235 240
Asp Asn Asn Asp Thr Asn Asp Asn Asn Asn Asn Lys Arg Ser Ser Lys
245 250 255
Leu Pro Glu Leu Thr Glu Glu Gln Ile Ile Asp Ile Val Lys Leu Gly
260 265 270
Thr Leu Val Cys Ser Glu Lys Ile Gln Lys Ser Ala Ala Ala Ala Ala
275 280 285
Ser Pro Phe Asp Lys Asn Ala Ala Thr Ala Pro Lys Leu Gln Ala Val
290 295 300
Gly Ala
305
<210> 3
<211> 2037
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 3
agattagcct tttcaatttc agaaagaatg ctaacccaca gatggttaga gaggcttacg 60
cagcaggtct catcaagacg atctacccga gcaataatct ccaggaaatc aaataccttc 120
ccaagaaggt taaagatgca gtcaaaagat tcaggactaa ctgcatcaag aacacagaga 180
aagatatatt tctcaagatc agaagtacta ttccagtatg gacgattcaa ggcttgcttc 240
acaaaccaag gcaagtaata gagattggag tctctaaaaa ggtagttccc actgaatcaa 300
aggccatgga gtcaaagatt caaatagagg acctaacaga actcgccgta aagactggcg 360
aacagttcat acagagtctc ttacgactca atgacaagaa gaaaatcttc gtcaacatgg 420
tggagcacga cacacttgtc tactccaaaa atatcaaaga tacagtctca gaagaccaaa 480
gggcaattga gacttttcaa caaagggtaa tatccggaaa cctcctcgga ttccattgcc 540
cagctatctg tcactttatt gtgaagatag tggaaaagga aggtggctcc tacaaatgcc 600
atcattgcga taaaggaaag gccatcgttg aagatgcctc tgccgacagt ggtcccaaag 660
atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc acgtcttcaa 720
agcaagtgga ttgatgtgat atctccactg acgtaaggga tgacgcacaa tcccactatc 780
cttcgcaaga cccttcctct atataaggaa gttcatttca tttggagaga acacggggga 840
ctctagaatg gctctcactg gtcatcaatt ggcttttgct tttggtgttc ttggaaacat 900
catctcattc atcgtcttcc tttctccact gccaacattc taccagatgt acaagaagaa 960
atcaacggaa ggatatcaat caatccccta tgtggttgca ctgttcagtg caatgctttg 1020
gatatactat gcattcgtga aggccaacga ctccactctt ctcattacta tcaactcctt 1080
tggtatcttt attgagacca tttacgttgt ctttttcctc tgctactcaa ccaagaaaac 1140
caggatccaa actttgaagt ttcttggtct gttcgtggcg gggggcttcg gtgcaattct 1200
tcttgtcact cagtttctgt tcaaaagtcc gatgcgactc cacgtggttg gatggatcgc 1260
cctcgtgttc tcggtgtgtg tgtttgttgc gccattgttc atagtgagac aagtgatccg 1320
caccaagagc gtggaatgca tgccagtact cctctcggtc ttcctcaccg taaatgctgt 1380
catgtggttc ttctacggct tgttcttaaa agacatgaac attgctcttc caaatgttct 1440
gggcttcatc ttcgggatcc tccagatcgg tctctacctg aagtacaaag acgcgaagaa 1500
agacgcagtg aaggagcaaa agcttccaga agtgacaaca ctgccaaaac cagtcataat 1560
cttggaagac aataacgaca ctaacgacaa caacaacaac aagcgcagca gcaagcttcc 1620
tgaactcacc gaggaacaaa tcatcgacat cgtcaaactc ggaaccctcg tgtgctccga 1680
gaaaatccag aagagcgccg ccgccgccgc ttcaccgttc gacaagaacg ccgccactgc 1740
tcctaagctt caggctgtgg gagcttaaga gctcgaattt ccccgatcgt tcaaacattt 1800
ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt atcatataat 1860
ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg ttatttatga 1920
gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata gaaaacaaaa 1980
tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta ctagatc 2037
<210> 4
<211> 96
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 4
atggctctca ctggtcatca attggctttt gcttttggtg ttcttggaaa catcatctca 60
ttcatcgtct tcctttctcc actgccaaca ttctac 96
Claims (10)
1. protein IbSWEET10, be following 1) or 2) or 3)：
1) aminoacid sequence is the protein in sequence table shown in sequence 2；
2) fused protein that the N-terminal of the protein in sequence table shown in sequence 2 or/and C-terminal connection label are obtained；
1) or 2) 3) protein shown in through the replacement of one or several amino acid residues and/or disappearance and/or is added
The protein related to disease resistance of plant for arriving.
2. the nucleic acid molecules of protein IbSWEET10 described in claim 1 are encoded.
3. nucleic acid molecules as claimed in claim 2, it is characterised in that：The nucleic acid molecules are following (a1) or (a2) or (a3)
Or the DNA molecular shown in (a4)：
(a1) nucleotide sequence is the DNA molecular in sequence table shown in sequence 1；
(a2) nucleotide sequence is DNA molecular of the sequence 1 from 5 ' ends shown in the 122nd to 1042 in sequence table；
(a3) nucleotide sequence limited with (a1) or (a2) has 75% or more than 75% homogeneity, and encodes claim 1
The DNA molecular of the protein IbSWEET10；
(a4) nucleotide sequence hybridization for limiting with (a1) or (a2) under strict conditions, and encode albumen described in claim 1
The DNA molecular of matter IbSWEET10.
4. the expression cassette, recombinant vector, recombinant microorganism or transgenic cell line containing nucleic acid molecules described in Claims 2 or 3.
5.b1) or b2)：
B1) protein IbSWEET10 described in claim 1, or, nucleic acid molecules described in Claims 2 or 3, or, wanting containing having the right
The expression cassette of nucleic acid molecules, recombinant vector, recombinant microorganism or transgenic cell line described in 2 or 3 is asked, in regulation and control disease resistance of plant
In application；
B2) protein described in claim 1, or, nucleic acid molecules described in Claims 2 or 3, or, containing Claims 2 or 3 institute
Expression cassette, recombinant vector, recombinant microorganism or the transgenic cell line of nucleic acid molecules is stated, the disease-resistant transgenic for sexually revising is being cultivated
Application in plant.
6. a kind of method for cultivating transgenic plant, divides including encoding the nucleic acid of protein IbSWEET10 described in claim 1
Son is imported in recipient plant, the step of obtain transgenic plant；Transgenic plant disease resistance compared with the recipient plant
Strengthen.
7. a kind of plant breeding method, comprises the steps：Increase protein IbSWEET10 described in claim 1 in plant
Content or activity, so that strengthen the disease resistance of plant.
8. protein as claimed in claim 1, or, the application described in claim 5, or, the method described in claim 6 or 7,
It is characterized in that：The disease resistance is anti-dead arm.
9. protein as claimed in claim 1, or, the application described in claim 5, or, the method described in claim 6 or 7,
It is characterized in that：The disease resistance is the microbial disease of anti-stem rot of sweet potato.
10. protein as claimed in claim 1, or, the application described in claim 5, or, the side described in claim 6 or 7
Method, it is characterised in that：The plant is following c1) to c5) in any one：
C1) dicotyledon；
C2) monocotyledon；
C3) Dioscoreaceae plant；
C4) Rhizoma Dioscoreae esculentae；
C5) sweet potato variety Semen Castaneae is fragrant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610966649.8A CN106496313B (en) | 2016-11-03 | 2016-11-03 | Disease-resistance-related protein IbSWEET10 and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610966649.8A CN106496313B (en) | 2016-11-03 | 2016-11-03 | Disease-resistance-related protein IbSWEET10 and its encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106496313A true CN106496313A (en) | 2017-03-15 |
| CN106496313B CN106496313B (en) | 2019-06-04 |
Family
ID=58321735
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610966649.8A Active CN106496313B (en) | 2016-11-03 | 2016-11-03 | Disease-resistance-related protein IbSWEET10 and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106496313B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111560056A (en) * | 2020-05-06 | 2020-08-21 | 中国农业科学院植物保护研究所 | Wheat stripe rust resistance related protein TaERF8 and coding gene and application thereof |
| CN115073573A (en) * | 2022-05-09 | 2022-09-20 | 中国农业大学 | Sweet potato stress-resistance-related protein IbNAC087 and coding gene and application thereof |
| CN115215931A (en) * | 2022-06-06 | 2022-10-21 | 中国农业大学 | Application of protein IbC H18 related to anti-winking disease and soft rot disease or substance for regulating expression of protein IbC H18 |
| CN116675751A (en) * | 2023-06-08 | 2023-09-01 | 山东农业大学 | Application of SWEET1g protein and encoding gene thereof in resisting potato viruses |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101775071A (en) * | 2009-11-09 | 2010-07-14 | 中国热带农业科学院橡胶研究所 | Protein for transferring saccharose and application of protein-coding gene thereof |
| CN101851629A (en) * | 2010-05-24 | 2010-10-06 | 中国科学院遗传与发育生物学研究所 | Method for improving crop output by converting sucrose transport protein gene OsSUT5Z of rice |
| CN102250227A (en) * | 2010-05-17 | 2011-11-23 | 中国科学院植物研究所 | Plant sucrose transport protein, and coding gene and application thereof |
-
2016
- 2016-11-03 CN CN201610966649.8A patent/CN106496313B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101775071A (en) * | 2009-11-09 | 2010-07-14 | 中国热带农业科学院橡胶研究所 | Protein for transferring saccharose and application of protein-coding gene thereof |
| CN102250227A (en) * | 2010-05-17 | 2011-11-23 | 中国科学院植物研究所 | Plant sucrose transport protein, and coding gene and application thereof |
| CN101851629A (en) * | 2010-05-24 | 2010-10-06 | 中国科学院遗传与发育生物学研究所 | Method for improving crop output by converting sucrose transport protein gene OsSUT5Z of rice |
Non-Patent Citations (1)
| Title |
|---|
| 刘畅: "植物中SWEET基因家族研究进展", 《植物生理学报》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111560056A (en) * | 2020-05-06 | 2020-08-21 | 中国农业科学院植物保护研究所 | Wheat stripe rust resistance related protein TaERF8 and coding gene and application thereof |
| CN111560056B (en) * | 2020-05-06 | 2022-04-19 | 中国农业科学院植物保护研究所 | Wheat stripe rust resistance related protein TaERF8 and coding gene and application thereof |
| CN115073573A (en) * | 2022-05-09 | 2022-09-20 | 中国农业大学 | Sweet potato stress-resistance-related protein IbNAC087 and coding gene and application thereof |
| CN115073573B (en) * | 2022-05-09 | 2023-04-25 | 中国农业大学 | Sweet potato stress resistance related protein IbNAC087, and coding gene and application thereof |
| CN115215931A (en) * | 2022-06-06 | 2022-10-21 | 中国农业大学 | Application of protein IbC H18 related to anti-winking disease and soft rot disease or substance for regulating expression of protein IbC H18 |
| CN115215931B (en) * | 2022-06-06 | 2023-05-16 | 中国农业大学 | Use of protein IbC H18 related to vine cutting disease and soft rot disease or substance for regulating and controlling expression of protein IbC H18 |
| CN116675751A (en) * | 2023-06-08 | 2023-09-01 | 山东农业大学 | Application of SWEET1g protein and encoding gene thereof in resisting potato viruses |
| CN116675751B (en) * | 2023-06-08 | 2024-01-26 | 山东农业大学 | Application of SWEET1g protein and encoding gene thereof in resisting potato viruses |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106496313B (en) | 2019-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2009075860A2 (en) | Transgenic plants with enhanced agronomic traits | |
| CN109306000A (en) | Resistance relevant protein IbBBX24 and its encoding gene and application | |
| CN110295185A (en) | A method of citrus is improved to canker resistance based on CsWAKL08 overexpression | |
| CN104845979B (en) | Cabbage type rape SKIP gene families and its recombinant vector and application | |
| CN106496313B (en) | Disease-resistance-related protein IbSWEET10 and its encoding gene and application | |
| CN105420248A (en) | Anthocyanin controlling gene PyMYB10.2 and application thereof | |
| CN109111514A (en) | And the breeding method and its relevant biological material of the transgenic wheat of anti-banded sclerotial blight and root rot | |
| CN110295183A (en) | A method of citrus is improved to canker resistance based on CsPrx25 overexpression | |
| CN106480163B (en) | A method of joint apple callus cell culture and genetic transformation identify apple disease-resistant gene | |
| WO2023065966A1 (en) | Application of bfne gene in tomato plant type improvement and biological yield increase | |
| CN110283824A (en) | A method of using CsXTH04 gene silencing to improve citrus to canker resistance | |
| CN107459565A (en) | Application of the soybean drought resisting GAP-associated protein GAP in regulating and controlling soybean drought resistance | |
| CN105624188A (en) | Application of SPL18 gene in enhancing plant yield | |
| CN110804090B (en) | Protein CkWRKY33 and coding gene and application thereof | |
| CN109477091A (en) | Construct and carrier for the conversion of gene implants | |
| CN105111295B (en) | The breeding method and its relevant biological material for turning WMYB-R DNA triticums of anti-root rot and banded sclerotial blight | |
| CN112812161A (en) | Application of protein IbMYC2 in regulation and control of plant drought resistance | |
| CN107299103A (en) | Thick boisiana IpASR genes and its encoding proteins and application | |
| CN106349355B (en) | Resistance relevant protein IbCPK28 and its encoding gene and application | |
| CN107266543B (en) | Stress-resistance associated protein IbRAP2-12, and coding gene and application thereof | |
| CN111662366A (en) | Preparation method of early-flowering high-yield tomato material | |
| CN105198977A (en) | Plant powdery mildew resistance-related protein Pm-2F as well as encoding gene and application thereof | |
| CN102732553B (en) | Improve the gene engineering method and material of plant products | |
| CN112724213B (en) | Sweet potato anthocyanin synthesis and stress resistance related protein IbMYB4, and coding gene and application thereof | |
| CN109879945B (en) | Function and application of brassica napus pod dehiscence resistance gene BnIND |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |