CN107266543B

CN107266543B - Stress-resistance associated protein IbRAP2-12, and coding gene and application thereof

Info

Publication number: CN107266543B
Application number: CN201710675135.1A
Authority: CN
Inventors: 何绍贞; 刘庆昌; 翟红; 李燕; 赵宁
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2017-08-09
Filing date: 2017-08-09
Publication date: 2020-03-31
Anticipated expiration: 2037-08-09
Also published as: CN107266543A

Abstract

The invention discloses an anti-stress related protein IbRAP2-12, and a coding gene and application thereof. The anti-stress related protein IbRAP2-12 provided by the invention is 1) or 2) or 3): 1) the amino acid sequence is protein shown as a sequence 2 in a sequence table; 2) a fusion protein obtained by connecting labels to the N end or/and the C end of the protein shown in the sequence 2 in the sequence table; 3) the protein related to the plant stress resistance is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein shown in 1) or 2). Experiments prove that the salt resistance and the drought resistance of the sweet potatoes can be enhanced by over-expressing the IbRAP2-12 gene in Arabidopsis. Therefore, the stress resistance related protein IbRAP2-12 and the coding gene thereof have important theoretical significance and practical value in regulating and controlling the stress resistance of plants.

Description

Stress-resistance associated protein IbRAP2-12, and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an anti-stress related protein IbRAP2-12, and a coding gene and application thereof.

Background

Sweet potato is an important crop of grain, feed, industrial raw material and new energy source. Sweet potatoes are widely planted in more than 100 countries or regions in the world, and the total yield of the sweet potatoes is ranked seventh in world grain production and ranked fourth in China. China is the biggest sweet potato producing country in the world, and the annual planting area is 338.7 kilohm²Accounting for 42.2% of the total planting area in the world, and the annual yield accounting for 67.94% of the total yield in the world. At present, our country is in a rapid development period, people increasingly demand sweet potatoes, and breeding of high-yield, high-quality, multi-resistance and special new species becomes a main target of sweet potato breeding in our country.

The sweet potato has good adaptability and strong stress resistance, is mainly planted in marginal land in the future, and has important limiting factors for enlarging the sweet potato planting area and improving the yield and quality of the sweet potato due to salt drought stress. According to incomplete statistics, 8 hundred million hectares of salinized land exist in the world, about 20 percent of agricultural land for irrigation is affected by salinization, and China is one of the countries with the most distributed saline-alkali soil in the world. With the increase of the population of the world and the reduction of the arable land area, the grain production safety is seriously threatened, and the challenge for China with smaller per capita arable land area is more serious.

Disclosure of Invention

The invention aims to solve the technical problem of how to enhance the stress resistance of plants.

In order to solve the problems, the invention firstly provides a stress resistance related protein.

The stress-resistance related protein provided by the invention is named as protein IbRAP2-12, is derived from sweet potatoes (Ipomoeabatatas (L.) Lam.), and is 1) or 2) or 3) as follows:

1) the amino acid sequence is protein shown as a sequence 2 in a sequence table;

2) a fusion protein obtained by connecting labels to the N end or/and the C end of the protein shown in the sequence 2 in the sequence table;

3) the protein related to the plant stress resistance is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein shown in 1) or 2).

Wherein, the sequence 2 in the sequence table is composed of 366 amino acid residues.

In order to facilitate the purification of the protein in 1), the amino terminal or the carboxyl terminal of the protein shown in the sequence 2 in the sequence table can be connected with a label shown in the table 1.

TABLE 1 sequence of tags

The protein IbRAP2-12 of 3), wherein the substitution and/or deletion and/or addition of one or more amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

The protein IbRAP2-12 in the above 3) can be synthesized artificially, or can be obtained by synthesizing the coding gene and then performing biological expression.

The gene encoding the protein IbRAP2-12 in 3) above can be obtained by deleting one or several codons of amino acid residues from the DNA sequence shown in 272 th to 1372 th positions from the 5' end of the sequence 1 in the sequence table, and/or by carrying out missense mutation of one or several base pairs, and/or by connecting the coding sequence of the tag shown in Table 1 to the 5' end and/or 3' end thereof.

Nucleic acid molecules encoding the protein IbRAP2-12 also fall within the scope of the present invention.

The nucleic acid molecule for encoding the protein IbRAP2-12 can be a DNA molecule shown as the following (a1) or (a2) or (a3) or (a 4):

(a1) the coding region is a DNA molecule shown in 272 th to 1372 th positions from the 5' end of a sequence 1 in a sequence table;

(a2) the nucleotide sequence is a DNA molecule shown as a sequence 1 in a sequence table;

(a3) a DNA molecule which has 75% or more 75% identity with the nucleotide sequence defined in (a1) or (a2) and encodes the protein IbRAP 2-12;

(a4) a DNA molecule which hybridizes with the nucleotide sequence defined in (a1) or (a2) under strict conditions and encodes the protein IbRAP 2-12.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

Wherein, the sequence 1 in the sequence table is composed of 1767 nucleotides, and the nucleotide shown from 272 th to 1372 th positions of the 5' tail end of the sequence 1 in the sequence table codes an amino acid sequence shown in the sequence 2 in the sequence table.

The nucleotide sequence encoding the protein IbRAP2-12 of the present invention can be readily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which have been artificially modified to have 80% or more identity to the nucleotide sequence of the isolated protein IbRAP2-12 of the present invention are derived from the nucleotide sequence of the present invention and are identical to the sequence of the present invention as long as they encode the protein IbRAP2-12 and are related to plant stress resistance.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 80% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein consisting of the amino acid sequence shown in sequence No. 2 of the sequence Listing of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

Also within the scope of the present invention are expression cassettes, recombinant vectors, recombinant microorganisms or transgenic cell lines containing a nucleic acid molecule encoding said protein IbRAP 2-12.

The expression cassette can be expression cassette a; the expression cassette A comprises a promoter, a nucleic acid molecule encoding the protein IbRAP2-12 and a terminator. The promoter may be a CaMV35S promoter, a NOS promoter or an OCS promoter. The terminator may be a NOS terminator or an OCS polyA terminator.

The sequence of the expression cassette A can be shown as a sequence 3 in a sequence table. In the expression cassette a: in the sequence table, the 1st to 835 th positions of the sequence 3 from the 5' end are CaMV35S promoters, the 848 th to 1948 th positions are coding genes of IbRAP2-12 protein, and the 1965 th to 2217 th positions are NOS terminators.

The recombinant vector can be a recombinant plasmid obtained by inserting a nucleic acid molecule (namely a DNA molecule shown from 272 th to 1372 th positions of the 5' tail end of a sequence 1 in a sequence table) for coding the protein IbRAP2-12 into a starting plasmid through an expression cassette containing the nucleic acid molecule for coding the protein IbRAP 2-12.

The recombinant vector can be specifically a recombinant plasmid pCB-IbRAP 2-12. The recombinant plasmid pCB-IbRAP2-12 was constructed as follows: (A) carrying out double digestion on the vector pCAMBIA3301 by using restriction enzymes HindIII and EcoRI to obtain a vector skeleton, carrying out double digestion on the vector pBI121 by using the restriction enzymes HindIII and EcoRI to recover a fragment of about 3032bp, and connecting the vector skeleton and the fragment to obtain a recombinant plasmid pCBGUS; (B) the recombinant plasmid pCB-IbRAP2-12 obtained by replacing a fragment between recognition sequences of restriction enzymes BamHI and SacI of the recombinant plasmid pCBGUS (the recombinant plasmid pCBGUS is cut into a large fragment and a small fragment by the restriction enzymes XbaI and SacI, and the DNA is the small fragment) with a DNA molecule shown in the 272 th to 1372 th positions from the 5' end of the sequence 1 in the sequence table, and the recombinant plasmid pCB-IbRAP2-12 expresses a protein IbRAP2-12 shown in the sequence 2 in the sequence table. The difference between the recombinant plasmid pCBGUS and the recombinant plasmid pCB-IbRAP2-12 is only that the DNA fragment between the recognition sequences of the restriction endonucleases BamHI and SacI of the recombinant plasmid pCBGUS (the recombinant plasmid pCBGUS is cut into a large fragment and a small fragment by the restriction endonucleases BamHI and SacI, and the DNA is the small fragment) is replaced by the DNA molecule shown in the sequence 1 from the 272 th to 1372 th positions from the 5' end in the sequence table.

The recombinant microorganism can be obtained by introducing the recombinant vector into the starting microorganism.

The starting microorganism may be a yeast, bacterium, algae or fungus. The bacteria may be gram positive or gram negative bacteria. The gram-negative bacterium may be Agrobacterium tumefaciens (Agrobacterium tumefaciens). The Agrobacterium tumefaciens (Agrobacterium tumefaciens) may specifically be Agrobacterium tumefaciens GV 3101.

The recombinant microorganism can be GV3101/pCB-IbRAP 2-12. GV3101/pCB-IbRAP2-12 is a recombinant Agrobacterium obtained by transforming Agrobacterium tumefaciens GV3101 with recombinant plasmid pCB-IbRAP 2-12.

None of the transgenic plant cell lines includes propagation material. The transgenic plant is understood to comprise not only the first generation transgenic plant obtained by transforming the recipient plant with the ibarap 2-12 gene, but also the progeny thereof. For transgenic plants, the gene can be propagated in the species, and can also be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, whole plants and cells.

The following b1) or b2) also belong to the protection scope of the invention;

b1) the use of the protein IbRAP2-12, or a nucleic acid molecule encoding the protein IbRAP2-12, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the nucleic acid molecule encoding the protein IbRAP2-12 for regulating plant stress resistance;

b2) the protein IbRAP2-12, or the nucleic acid molecule coding the protein IbRAP2-12, or the expression cassette, the recombinant vector, the recombinant microorganism or the transgenic cell line containing the nucleic acid molecule coding the protein IbRAP2-12, can be applied to the cultivation of transgenic plants with changed stress resistance.

In the b1), the regulation of plant stress resistance may be plant stress resistance enhancement.

In the b2), the stress resistance change may be stress resistance enhancement.

In order to solve the technical problems, the invention also provides a method for cultivating the transgenic plant.

The method for cultivating the transgenic plant provided by the invention can comprise the steps of introducing a substance for improving the expression and/or activity of the protein IbRAP2-12 into a receptor plant to obtain a transgenic plant; the transgenic plant has increased stress resistance as compared to the recipient plant.

In the above method, said "introducing into a recipient plant a substance that increases the expression and/or activity of said protein IbRAP 2-12" may be effected by introducing into a recipient plant a nucleic acid molecule encoding said protein IbRAP 2-12.

In the above method, the nucleic acid molecule encoding the protein IbRAP2-12 can be a DNA molecule represented by the following (a1) or (a2) or (a3) or (a 4):

In the above method, said "introducing into a recipient plant a nucleic acid molecule encoding the protein IbRAP 2-12" may be effected by introducing into a recipient plant a recombinant vector a; the recombinant vector A can be a recombinant plasmid obtained by inserting a nucleic acid molecule coding the protein IbRAP2-12 into an expression vector or a cloning vector.

The recombinant vector A can be specifically the recombinant plasmid pCB-IbRAP 2-12.

In order to solve the technical problems, the invention also provides a plant breeding method.

The plant breeding method provided by the invention can comprise the following steps: increasing the content and/or activity of said protein IbRAP2-12 in the plant, thereby enhancing the stress resistance of the plant.

In the above plant breeding method, the "increasing the content and/or activity of the protein IbRAP2-12 in a plant" can be achieved by a method known in the art, such as multiple copies, alteration of promoters, regulatory factors, transgenes, etc., to increase the content and/or activity of the protein IbRAP2-12 in a plant.

Any of the above stress resistance may be salt resistance and/or drought resistance.

Any of the plants described above may be any of the following c1) to c 7): c1) a dicotyledonous plant; c2) a monocot plant; c3) a plant of the family Dioscoreaceae; c4) sweet potato; c5) a cruciferous plant; c6) arabidopsis thaliana; c7) wild type Arabidopsis thaliana Columbia.

Experiments prove that the stress resistance of plants can be enhanced by utilizing the stress resistance related protein IbRAP2-12 and the coding gene thereof provided by the invention: t at high salt stress and drought stress, compared to wild type Arabidopsis thaliana₃The generation homozygous IbRAP2-12 gene transfer Arabidopsis has the advantages of obviously increased germination rate, root length, fresh weight and survival rate. Therefore, the stress resistance related protein IbRAP2-12 and the coding gene thereof have important theoretical significance and practical value in regulating and controlling the stress resistance of plants.

Drawings

FIG. 1 shows the results of the experiment in step five of example 2.

FIG. 2 shows the results of the experiment 1 in step six of example 2.

FIG. 3 shows the results of the experiment 2 in step six of example 2.

FIG. 4 shows the results of step six, step 3 of example 2.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention.

The experimental procedures in the following examples are conventional unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

ND98 (described in He et al, Plant Cell Tissue and organic Culture, 2009, 96:69-74.ND98 in this document is named LM1) is a sweet potato line, publicly available from the sweet potato genetic breeding research laboratory of the university of agriculture in China, to repeat the experiment.

The cloning vector pMD19-T is a product of Takara Bio-engineering (Dalian) Inc. under the catalog number 6013. The vector pCAMBIA3301 is a product of Cambia corporation. The vector pBI121 is a product of Clontech. The plant total RNA extraction kit is a product of Tiangen Biochemical technology (Beijing) Co., Ltd, and the catalog number is DP 432. PrimeScript^TM1st Strand cDNASynthesis Kit is a product of Baozhijie engineering, Inc. (Dalian) under catalog number 6110A. QuantScriptRT Kit is a product of Tiangen Biotechnology (Beijing) Co., Ltd.

Wild type arabidopsis thaliana Columbia is described in the following documents: kim H, Hyun Y, Park J, Park M, KimM, Kim H, Lee M, Moon J, Lee I, Kim J.A genetic link between column responses and time throughput FVE in Arabidopsis thaliana. Nature genetics.2004,36: 167-. The wild type Arabidopsis thaliana Columbia is hereinafter abbreviated as wild type Arabidopsis thaliana or WT.

The parameters of the light-dark alternate culture in the following examples are: the illumination time is 16h, and the dark time is 8 h; the intensity of the illumination is 31000-35000 Lux.

Hoagland nutrient solution: 0.95g Ca (NO)₃)₂、0.61g KNO₃、0.49g MgSO₄·7H₂O、0.12gKH₂PO₄、0.0367g EDTA-FeNa、0.002g MnCl₂·4H₂O、0.00024g CuSO₄·5H₂O、0.00029gZnSO₄·7H₂O、0.00186H₃BO₃And 0.000035g H₂MoO₄·4H₂Dissolving O in distilled water, adding distilled water to a constant volume of 1L, and adjusting the pH value to 6.0.

Example 1 obtaining of IbRAP2-12 Gene

The steps for obtaining the IbRAP2-12 gene are as follows:

1. obtaining a template

Extracting total RNA of ND98 young leaf with plant total RNA extraction kit, and using PrimeScript to extract the total RNA^TM1st Strand cDNA Synthesis Kit reverse transcription of first Strand cDNA.

2. Obtaining a nucleotide sequence shown as a sequence 4 in a sequence table from a transcriptome database.

3. Based on the nucleotide sequence obtained in step 3, primers 3GSP1 and 3GSP2 were designed and synthesized.

4. After step 3 is completed, the cDNA obtained in step 1 is used as a template, 3GSP1 and 3GSP2 synthesized in step 3 are used as primers, a3 '-RACE fragment of about 700bp is obtained by amplification through a RACE method, and the 3' -RACE fragment is connected with a cloning vector pMD19-T to obtain a recombinant plasmid 2. The recombinant plasmid 2 was sequenced to obtain the nucleotide sequence of the 3' -RACE fragment. Then, based on the nucleotide sequence, primers 5GSP1 and 5GSP2 were designed and synthesized.

5. After step 4, the cDNA obtained in step 1 is used as a template, 5GSP1 and 5GSP2 synthesized in step 4 are used as primers, a 5 '-RACE fragment of about 850bp is obtained by amplification through a RACE method, and the 5' -RACE fragment is connected with a cloning vector pMD19-T to obtain a recombinant plasmid 3. The recombinant plasmid 3 was sequenced to obtain the nucleotide sequence of the 5' -RACE fragment.

6. After completing step 5, the candidate IbRAP2-12 gene was spliced using DNAMAN 6.0 software. Primers O-F and O-R of the ORF of IbRAP2-12 gene are further designed and synthesized according to the splicing candidate IbRAP2-12 gene sequence.

7. Total RNA of young leaves of ND98 was extracted using a plant total RNA extraction Kit, and first strand cDNA was reverse transcribed from the total RNA using QuantScriptRT Kit. And (3) taking the cDNA as a template and the O-F and O-R synthesized in the step 6 as primers, carrying out PCR amplification to obtain a PCR amplification product of about 1755bp, and sequencing.

The nucleotide sequence information of the above primers 3GSP1, 3GSP2, 5GSP1, 5GSP2, O-F and O-R is detailed in Table 2.

The result shows that the nucleotide sequence of the PCR amplification product obtained in the step 7 is shown as the 1st to 1755 th sites from the 5' end of the sequence 1 in the sequence table. The gene shown from 272 th to 1372 th positions of the 5' end of the sequence 1 in the sequence table is named as IbRAP2-12 gene, the coded protein is named as IbRAP2-12 protein or protein IbRAP2-12, and the amino acid sequence is shown as the sequence 2 in the sequence table.

TABLE 2 primer sequence information

Primer name	Sequence information 5'-3'
		3GSP1	5'-CGGAGATATGGGTTCCAAATCATAT-3'
3GSP2	5'-GGAAGCAATTTGCTCGACTATTCTG-3'
		5GSP1	5'-ATATAGCCATTCGGTTTTGTCAAAG-3'
5GSP2	5'-AGTCATTAGCAGACAAGTCAGGGAC-3'
		O-F	5'-ATCGCTGGCCCTAATACAAAA-3'
O-R	5'-GCCAACCCCACTTGCAATTT-3'

Example 2 obtaining of IbRAP2-12 Gene-transfected Arabidopsis thaliana and characterization of stress resistance

Construction of recombinant plasmid

1. Shown as a sequence 1 in an artificially synthesized sequence tableThe double-stranded DNA molecule of (1). Using the double-stranded DNA molecule as a template, and using OS-F-BamHI: 5' -CGGGATCCATGTGCGGCGGAGCTATC-3' (recognition sequence for the restriction enzyme BamHI is underlined) and OS-R-SacI: cGAGCTCTTAGAAGACGTCCCCTGTAAAAGA (recognition sequence of restriction enzyme SacI is underlined) as primers, and a double-stranded DNA molecule containing restriction enzyme BamHI at the N-terminus and SacI at the C-terminus was obtained.

2. And (2) connecting the double-stranded DNA molecule with the restriction enzyme BamHI at the N end and the restriction enzyme SacI at the C end obtained in the step 1 to a cloning vector pMD19-T to obtain a recombinant plasmid pMD19-IbRAP 2-12.

3. After completion of step 2, the recombinant plasmid pMD19-IbRAP2-12 was double-digested with the restriction enzymes BamHI and SacI, and fragment 1 of about 1.1kb was recovered.

4. The vector pCAMBIA3301 was double-digested with restriction enzymes HindIII and EcoRI, and the vector backbone 1 of about 11256bp was recovered.

5. The vector pBI121 was double digested with the restriction enzymes HindIII and EcoRI, and the fragment 2 comprising about 3032bp was recovered.

6. And connecting the fragment 2 with a vector framework 1 to obtain the recombinant plasmid pCBGUS.

7. The recombinant plasmid pCBGUS was double digested with the restriction enzymes BamHI and SacI, and about 12000bp of vector backbone 2 was recovered.

8. And connecting the fragment 1 with a vector framework 2 to obtain a recombinant plasmid pCB-IbRAP 2-12.

According to the sequencing results, the recombinant plasmid pCB-IbRAP2-12 was structurally described as follows: a small fragment between recognition sequences of restriction enzymes BamHI and SacI of the recombinant plasmid pCBGUS is replaced by a DNA molecule shown in 272 th to 1372 th sites from 5' end of a sequence 1 in a sequence table. The recombinant plasmid pCB-IbRAP2-12 expresses IbRAP2-12 protein shown in a sequence 2 in a sequence table.

The recombinant plasmid pCB-IbRAP2-12 has an expression cassette A, the nucleotide sequence of the expression cassette A is shown as a sequence 3 in a sequence table, wherein the 1st to 835 th sites of the sequence 3 in the sequence table from the 5' end are CaMV35S promoters, the 848 th to 1948 th sites are coding genes of IbRAP2-12 proteins, and the 1965 th to 2217 th sites are NOS terminators.

II, obtaining agrobacterium

1. The recombinant plasmid pCB-IbRAP2-12 is introduced into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium, which is named as GV3101/pCB-IbRAP 2-12.

2. The recombinant plasmid pCBGUS is introduced into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium, which is named as GV 3101/pCBGUS.

Thirdly, obtaining of Arabidopsis thaliana which is transformed with IbRAP2-12 gene

1. Transferring GV3101/pCB-IbRAP2-12 prepared in step two to wild type Arabidopsis thaliana by Arabidopsis thaliana inflorescence floral dip transformation (Clough, S.J., andBent, A.F.. Floraldip: amplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.plant J. (1998)16, 735-743), obtaining T₁Seeds of Arabidopsis thaliana which is transformed with IbRAP2-12 gene are generated.

2. Will T₁Seeds of Arabidopsis thaliana which imitates IbRAP2-12 gene transfer are planted on 1/2MS culture medium containing 12.5mg/L glufosinate-ammonium, and cultured for 7-10 days at 22 ℃, and the Arabidopsis thaliana (resistant seedling) which can normally grow is T₁The IbRAP2-12 gene positive vaccine is simulated. T is₁The seeds received by the positive seedlings simulating IbRAP2-12 gene transfer are T₂Seeds of Arabidopsis thaliana which is transformed with IbRAP2-12 gene are generated.

3. The T of different strains screened in the step 2₂Seeds of Arabidopsis thaliana which is transformed with IbRAP2-12 gene were sown in 1/2MS medium containing 12.5mg/L phosphinothricin for screening, if the ratio of the number of Arabidopsis thaliana (resistant seedlings) which can grow normally to the number of Arabidopsis thaliana (non-resistant seedlings) which cannot grow normally in a certain strain is 3: 1, the strain is a strain in which the IbRAP2-12 gene is inserted into one copy, and the seeds received by the resistant seedlings in the strain are T₃Seeds of Arabidopsis thaliana which is transformed with IbRAP2-12 gene are generated.

4. The T screened out in the step 3₃Seeds of Arabidopsis thaliana which imitates IbRAP2-12 gene transfer are sown on 1/2MS culture medium containing 12.5mg/L phosphinothricin again for screening, and the seeds which are all resistant seedlings are T₃The generation is homozygous to transfer IbRAP2-12 gene Arabidopsis thaliana. 8T to be screened₃Generation pure simulation transformation of IbRAP2-12 gene Arabidopsis thalianaThe strains are named L3, L5, L8, L12, L14, L17, L21 and L25 in sequence.

Fourthly, obtaining of empty vector Arabidopsis thaliana

Replacing GV3101/pCB-IbRAP2-12 with GV3101/pCBGUS according to the method of step three above, and obtaining T₃The plant of the generation homozygous empty vector transfer arabidopsis is called empty vector transfer arabidopsis for short.

Fifthly, expression quantity analysis and screening of over-expression strain

The arabidopsis seeds to be detected are wild type arabidopsis seeds, empty vector arabidopsis seeds, seeds of L3, seeds of L5, seeds of L8, seeds of L12, seeds of L14, seeds of L17, seeds of L21 and seeds of L25.

(1) And (3) sowing 5 arabidopsis thaliana seeds to be detected on 1/2MS culture medium, and alternately culturing for 8 days at 22 ℃ in light and dark to obtain the arabidopsis thaliana seedlings to be detected.

(2) After the step (1) is completed, extracting total RNA of each arabidopsis seedling to be detected, inverting the total RNA by using reverse transcriptase to obtain cDNA, carrying out real-time quantitative analysis on the expression quantity of IbRAP2-12 gene in the cDNA, and identifying primers of the IbRAP2-12 gene as 5'-GGAGATATGGGTTCCAAATCATATT-3' and 5'-AAACTGAGCTTCATCGGCTTCTA-3'. The internal reference is an actin gene, and primers for identifying the actin gene are 5'-GCACCCTGTTCTTCTTACCGA-3' and 5'-AGTAAGGTCACGTCCAGCAAGG-3'.

The results of some of the experiments are shown in FIG. 1. The results show that the IbRAP2-12 gene is an arabidopsis thaliana foreign gene and is hardly expressed in wild arabidopsis thaliana, but the IbRAP2-12 gene is expressed in 8T genes₃The lines of transgenic Arabidopsis with IbRAP2-12 gene have different expression levels. Thus, 8T₃All the lines of generation-homozygous IbRAP2-12 gene-simulated Arabidopsis thaliana are T₃A line of transgenic IbRAP2-12 gene Arabidopsis thaliana with homozygous generation.

Three strains (namely L8, L14 and L17) with the highest expression level of the IbRAP2-12 gene are selected for subsequent experiments.

Sixthly, identifying stress resistance

The arabidopsis seeds to be detected are wild type arabidopsis seeds, empty vector arabidopsis seeds, L8 seeds, L14 seeds or L17 seeds.

1. Identification of germination rate of transgenic plants

Taking 25 Arabidopsis seeds to be tested, disinfecting, sowing the seeds on 1/2MS culture medium containing 100mM NaCl or 1/2MS culture medium containing 300mM mannitol, and then counting the germination rate with the 1st, 2 nd, 3 rd, 4 th and 5 th days after sowing. Germination rate is the number of germinated seeds/25 × 100%.

The results of part of the experiment are shown in FIG. 2 (the left panel is 1/2MS medium containing 100mM NaCl, the right panel is 1/2MS medium containing 300mM mannitol). The results show that T is under stressed culture conditions compared to wild type Arabidopsis seeds₃The germination rate of the generation homozygous transgenic IbRAP2-12 gene Arabidopsis seeds (L8, L14 or L17) is obviously improved, and the germination rate of the transgenic empty vector Arabidopsis seeds has no obvious difference.

2. Salt-tolerant drought-resistant in-vitro identification of transgenic plants

(1) Taking an arabidopsis thaliana seed to be detected, disinfecting, sowing the arabidopsis thaliana seed on an 1/2MS culture medium, and alternately culturing in light and dark at 22 ℃ until cotyledons are completely unfolded to obtain an arabidopsis thaliana seedling to be detected.

(2) After the step (1) is completed, selecting the arabidopsis thaliana seedlings to be tested with consistent growth vigor, transferring the arabidopsis thaliana seedlings to a culture medium (1/2MS culture medium, 1/2MS culture medium containing 100mM NaCl or 1/2MS culture medium containing 300mM mannitol), and then culturing the arabidopsis thaliana seedlings in an upright state for 7 days in a light-dark alternating mode at the temperature of 22 ℃. The growth state of Arabidopsis plants was observed, the root length (mm) of individual plants was measured and averaged, and the fresh weight (mg) of individual plants was determined and averaged.

The results of part of the experiment are shown in FIG. 3(A on 1/2MS medium, B on 1/2MS medium with 100mM NaCl, C on 1/2MS medium with 300mM mannitol). The results show that under normal growth conditions (i.e., on 1/2MS medium), wild type Arabidopsis, empty vector Arabidopsis, and T₃The generation homozygous IbRAP2-12 gene Arabidopsis thaliana (L8, L14 or L17) has no significant difference in growth vigor (such as growth state, root length and fresh weight). Under high salt stress (i.e., on 1/2MS medium with 100mM NaCl) and drought stress (i.e., on 1/2MS medium with 300mM mannitol), T₃The growth state of the generation homozygous IbRAP2-12 gene Arabidopsis thaliana (L8, L14 or L17) is obviously better than that of the wild Arabidopsis thaliana, and the root thereofThe length and the fresh weight are both obviously superior to those of wild arabidopsis; the growth vigor (such as growth state, root length and fresh weight) of the wild type arabidopsis thaliana and the empty vector arabidopsis thaliana has no obvious difference.

3. Salt-tolerant drought-resistant potted plant identification of transgenic plants

(1) Taking 30 arabidopsis thaliana seeds to be detected, disinfecting, sowing the seeds on 1/2MS culture medium, culturing for 7d in light and dark at 22 ℃, then transplanting the seeds to a nutrition pot with the length of 7cm, culturing for 31d in light and dark at 22 ℃ (the Hoagland nutrient solution is applied every 2 days during the culture period; the Hoagland nutrient solution is placed outside a pot planted with arabidopsis thaliana every time, and after the nutrient soil in the pot is saturated and absorbed, the residual solution outside the pot is discarded), thus obtaining the normally processed arabidopsis thaliana plant to be detected.

(2) Taking 30 arabidopsis thaliana seeds to be tested, disinfecting, sowing the seeds on 1/2MS culture medium, culturing for 7 days in light and dark alternately at 22 ℃, then transplanting the seeds to a nutrition pot of 7cm, and culturing for 10 days in light and dark alternately at 22 ℃; and then, starting to apply high-salt stress to the Hoagland nutrient solution containing 200mM NaCl (once every 2 days; the Hoagland nutrient solution containing 200mM NaCl is placed outside a pot planted with arabidopsis thaliana every time, and after nutrient soil in the pot is saturated and absorbed, the residual solution outside the pot is discarded), and carrying out high-salt stress for 21 days to obtain the arabidopsis thaliana plant to be tested with high-salt stress.

(3) Taking 30 arabidopsis thaliana seeds to be tested, disinfecting, sowing the seeds on 1/2MS culture medium, culturing for 7 days in light and dark alternately at 22 ℃, then transplanting the seeds to a nutrition pot of 7cm, and culturing for 10 days in light and dark alternately at 22 ℃; then starting to carry out drought stress by stopping watering for 21 d; and then normally watering, and carrying out rehydration treatment for 3d to obtain the arabidopsis thaliana plant to be tested for drought stress.

And observing the growth states of the normally processed arabidopsis thaliana plant to be detected, the high-salt stressed arabidopsis thaliana plant to be detected and the drought stressed arabidopsis thaliana plant to be detected, and counting the survival rate. Survival rate is the number of surviving arabidopsis seedlings/30 × 100%.

The results of some experiments are shown in FIG. 4(A is the growth status of individual Arabidopsis plants and B is the survival statistics). The results show that, under normal conditions, wild type Arabidopsis thaliana and T₃Generation homozygous transgenic IbRAP2-12 gene Arabidopsis thaliana plant growthThe states are not significantly different; after high salt stress for 21d, leaves of wild type Arabidopsis were almost all dead by chlorosis, and T was₃The leaf part of the generation homozygous IbRAP2-12 gene transfer Arabidopsis is kept green; after drought stress for 21d and rehydration for 3d, wild arabidopsis almost loses growth vigor, and T is₃The generation homozygous IbRAP2-12 gene-transferred Arabidopsis thaliana can recover the water absorption capacity and keep healthy growth; t at high salt stress and drought stress, compared to wild type Arabidopsis thaliana₃The survival rate of the transgenic IbRAP2-12 Arabidopsis thaliana with homozygous generation is obviously improved. Under the growth conditions, the growth state and the survival rate of the wild arabidopsis thaliana and the empty vector arabidopsis thaliana have no significant difference.

The results show that the overexpression of the IbRAP2-12 gene can obviously improve the salt tolerance and drought resistance of transgenic Arabidopsis plants.

<110> stress-resistance-associated protein IbRAP2-12, and coding gene and application thereof

<120> university of agriculture in China

<160>4

<170>PatentIn version 3.5

<210>1

<211>1767

<212>DNA

<213> Ipomoea batatas (L.) Lam.

<400>1

atcgctggcc ctaatacaaa agtgttgcaa tgtaaagtaa aattgtaatt aagcgtataa 60

aacgagggtc aatttggtaa actacaccga ctcatcccgt cccgagattc cggcgatatc 120

tcattttctc cgcttatcag cttcagcaac ctggctttat aaaacccccc aaaagctttt 180

ttcacaagaa aaaaagaaaa attctctttt gatgttttcc aacaaaaatc tctgcgaaaa 240

tcctcattga ttccgaacaa gaaagctagc catgtgcggc ggagctatca tctccgattt 300

caagccgccg agccgatcgt cgcggcgcct caccgccgac ctgctgtggg ggcgcgctga 360

tctgagcggc gccaagaaga acagcaactc ttccggcagc cactactcca agcccttgcg 420

atctgagctc gttgtcctcg acgatgactt cgaggctgat tttcaggact tcaaggatca 480

ctcctatggc caggtcgatg ctaagccctt tgctttctcc gcttcgcatc gccctgggtt 540

ttcttctggc cccgattcag attcaagcaa ggatgctgac aattcctcca agaggaagag 600

gaagaaccag taccggggga tcaggcagcg tccttgggga aaatgggctg ctgagatccg 660

tgatccaagg aaaggtgttc gtgtctggct tggaacgttt gacactgctg aagaagcagc 720

gagggcttat gatattgagg ctcggaggat taggggaaag aaagctaagg tgaatttccc 780

tgatgatgct ccactcacgg tgcagaagaa cacagctaag gtgaatcctc agaaagctgt 840

ccctgacttg tctgctaatg acttcggcta ctatgaccct tccaactttt ttgaggagaa 900

gcctttgaca aaaccgaatg gctatatagc tatgtgccct gctcccggag atatgggttc 960

caaatcatat ttgccctctg atgctgctaa cctttacttc agctccgagg aaggaagcaa 1020

tttgctcgac tattctgatt tcgggtgggc agaccgaagt tcccggagtc ctgaaatatc 1080

atctgttctg tcagctgccc tagaagccga tgaagctcag tttgaggagg aaaccaaccc 1140

tcaaaagaaa ctgaagtcta gttccgacaa cctgctggca agcaatggaa acactgtcga 1200

aaagctgtct gaagagctct cggcttttga agcacagatg aagttcttcg atatcccata 1260

tctcgaagga aactgcagtg caccaacctt caatgcctat gcgactcagg acggtgccat 1320

gaacctgtgg tgcttcgacg acatcccttc ttttacaggg gacgtcttct aagccagcca 1380

gccctcctcc cgtgcccgtc tctttgtaaa taaagctttt atatgagtat ggtttgatgc 1440

cggaacactt gtaattgctc atcatcacat cactgtaaaa gcttggatga ctgggttccg 1500

tgtttaaccc gccctcgtgg tgcccgtgtt cttctaggtt cgactgtggt taagagcaac 1560

attgtgaatt tgggatcaat agccactgtt gccggacttt aaaccgctgt ctttaaatat 1620

gatgtgtatg gataatgaat ctgaaacctt gaacattttt atatgttgtt ttgttgtttg 1680

taatgttttt atattttgct gctttcttcc atgatatagt tttgatgaat aattaaaatt 1740

gcaagtgggg ttggcaaaaa aaaaaaa 1767

<210>2

<211>366

<212>PRT

<213> Ipomoea batatas (L.) Lam.

<400>2

Met Cys Gly Gly Ala Ile Ile Ser Asp Phe Lys Pro Pro Ser Arg Ser

1 5 10 15

Ser Arg Arg Leu Thr Ala Asp Leu Leu Trp Gly Arg Ala Asp Leu Ser

20 25 30

Gly Ala Lys Lys Asn Ser Asn Ser Ser Gly Ser His Tyr Ser LysPro

35 40 45

Leu Arg Ser Glu Leu Val Val Leu Asp Asp Asp Phe Glu Ala Asp Phe

50 55 60

Gln Asp Phe Lys Asp His Ser Tyr Gly Gln Val Asp Ala Lys Pro Phe

65 70 75 80

Ala Phe Ser Ala Ser His Arg Pro Gly Phe Ser Ser Gly Pro Asp Ser

85 90 95

Asp Ser Ser Lys Asp Ala Asp Asn Ser Ser Lys Arg Lys Arg Lys Asn

100 105 110

Gln Tyr Arg Gly Ile Arg Gln Arg Pro Trp Gly Lys Trp Ala Ala Glu

115 120 125

Ile Arg Asp Pro Arg Lys Gly Val Arg Val Trp Leu Gly Thr Phe Asp

130 135 140

Thr Ala Glu Glu Ala Ala Arg Ala Tyr Asp Ile Glu Ala Arg Arg Ile

145 150 155 160

Arg Gly Lys Lys Ala Lys Val Asn Phe Pro Asp Asp Ala Pro Leu Thr

165 170 175

Val Gln Lys Asn Thr Ala Lys Val Asn Pro Gln Lys Ala Val Pro Asp

180 185 190

Leu Ser Ala Asn Asp Phe Gly Tyr Tyr Asp Pro Ser Asn Phe Phe Glu

195 200 205

Glu Lys Pro Leu Thr Lys Pro Asn Gly Tyr Ile Ala Met Cys Pro Ala

210 215 220

Pro Gly Asp Met Gly Ser Lys Ser Tyr Leu Pro Ser Asp Ala Ala Asn

225 230 235 240

Leu Tyr Phe Ser Ser Glu Glu Gly Ser Asn Leu Leu Asp Tyr Ser Asp

245 250 255

Phe Gly Trp Ala Asp Arg Ser Ser Arg Ser Pro Glu Ile Ser Ser Val

260 265 270

Leu Ser Ala Ala Leu Glu Ala Asp Glu Ala Gln Phe Glu Glu Glu Thr

275 280 285

Asn Pro Gln Lys Lys Leu Lys Ser Ser Ser Asp Asn Leu Leu Ala Ser

290 295 300

Asn Gly Asn Thr Val Glu Lys Leu Ser Glu Glu Leu Ser Ala Phe Glu

305 310 315 320

Ala Gln Met Lys Phe Phe Asp Ile Pro Tyr Leu Glu Gly Asn Cys Ser

325 330 335

Ala Pro Thr Phe Asn Ala Tyr Ala Thr Gln Asp Gly Ala Met Asn Leu

340 345 350

Trp Cys Phe Asp Asp Ile Pro Ser Phe Thr Gly Asp Val Phe

355 360 365

<210>3

<211>2217

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>3

agattagcct tttcaatttc agaaagaatg ctaacccaca gatggttaga gaggcttacg 60

cagcaggtct catcaagacg atctacccga gcaataatct ccaggaaatc aaataccttc 120

ccaagaaggt taaagatgca gtcaaaagat tcaggactaa ctgcatcaag aacacagaga 180

aagatatatt tctcaagatc agaagtacta ttccagtatg gacgattcaa ggcttgcttc 240

acaaaccaag gcaagtaata gagattggag tctctaaaaa ggtagttccc actgaatcaa 300

aggccatgga gtcaaagatt caaatagagg acctaacaga actcgccgta aagactggcg 360

aacagttcat acagagtctc ttacgactca atgacaagaa gaaaatcttc gtcaacatgg 420

tggagcacga cacacttgtc tactccaaaa atatcaaaga tacagtctca gaagaccaaa 480

gggcaattga gacttttcaa caaagggtaa tatccggaaa cctcctcgga ttccattgcc 540

cagctatctg tcactttatt gtgaagatag tggaaaagga aggtggctcc tacaaatgcc 600

atcattgcga taaaggaaag gccatcgttg aagatgcctc tgccgacagt ggtcccaaag 660

atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc acgtcttcaa 720

agcaagtgga ttgatgtgat atctccactg acgtaaggga tgacgcacaa tcccactatc 780

cttcgcaaga cccttcctct atataaggaa gttcatttca tttggagaga acacggggga 840

ctctagaatg tgcggcggag ctatcatctc cgatttcaag ccgccgagcc gatcgtcgcg 900

gcgcctcacc gccgacctgc tgtgggggcg cgctgatctg agcggcgcca agaagaacag 960

caactcttcc ggcagccact actccaagcc cttgcgatct gagctcgttg tcctcgacga 1020

tgacttcgag gctgattttc aggacttcaa ggatcactcc tatggccagg tcgatgctaa 1080

gccctttgct ttctccgctt cgcatcgccc tgggttttct tctggccccg attcagattc 1140

aagcaaggat gctgacaatt cctccaagag gaagaggaag aaccagtacc gggggatcag 1200

gcagcgtcct tggggaaaat gggctgctga gatccgtgat ccaaggaaag gtgttcgtgt 1260

ctggcttgga acgtttgaca ctgctgaaga agcagcgagg gcttatgata ttgaggctcg 1320

gaggattagg ggaaagaaag ctaaggtgaa tttccctgat gatgctccac tcacggtgca 1380

gaagaacaca gctaaggtga atcctcagaa agctgtccct gacttgtctg ctaatgactt 1440

cggctactat gacccttcca acttttttga ggagaagcct ttgacaaaac cgaatggcta 1500

tatagctatg tgccctgctc ccggagatat gggttccaaa tcatatttgc cctctgatgc 1560

tgctaacctt tacttcagct ccgaggaagg aagcaatttg ctcgactatt ctgatttcgg 1620

gtgggcagac cgaagttccc ggagtcctga aatatcatct gttctgtcag ctgccctaga 1680

agccgatgaa gctcagtttg aggaggaaac caaccctcaa aagaaactga agtctagttc 1740

cgacaacctg ctggcaagca atggaaacac tgtcgaaaag ctgtctgaag agctctcggc 1800

ttttgaagca cagatgaagt tcttcgatat cccatatctc gaaggaaact gcagtgcacc 1860

aaccttcaat gcctatgcga ctcaggacgg tgccatgaac ctgtggtgct tcgacgacat 1920

cccttctttt acaggggacg tcttctaaga gctcgaattt ccccgatcgt tcaaacattt 1980

ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt atcatataat 2040

ttctgttgaa ttacgttaag catgtaataa ttaacatgta atgcatgacg ttatttatga 2100

gatgggtttt tatgattaga gtcccgcaat tatacattta atacgcgata gaaaacaaaa 2160

tatagcgcgc aaactaggat aaattatcgc gcgcggtgtc atctatgtta ctagatc 2217

<210>4

<211>944

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>4

ggagaaaatt ctcttttgat gttttccaac aaaaatctct gcgaaaatcc tcattgattc 60

cgaacaagaa agctagccat gtgcggcgga gctatcatct ccgatttcaa gccgccgagc 120

cgatcgtcgc ggcgcctcac cgccgacctg ctgtgggggc gcgctgatct gagcggcgcc 180

aagaagaaca gcaactcttc cggcagccac tactccaagc ccttgcgatc tgagctcgtt 240

gtcctcgacg atgacttcga ggctgatttt caggacttca aggatcactc ctatggccag 300

gtcgatgcta agccctttgc tttctccgct tcgcatcgcc ctgggttttc ttctggcccc 360

gactcagatt caagcaagga tgctgacaat tcctccaaga ggaagaggaa gaaccagtac 420

cgggggatca ggcagcgtcc ttggggaaaa tgggctgctg agatccgtga tccaaggaaa 480

ggtgttcgtg tctggcttgg aacatttgac actgctgaag aagcggctat ggcttatgat 540

attgaggctc ggaggattag gggaaagaag gctaaggtga atttccctgatgatgctcca 600

ctcacggtgc agaagaacac agctaaggtg aatcctcaga aagctgtccc tgacttgtct 660

gctaatgact tcggctacta tgacccttcc aacttttttg aggagaagcc tttgacaaaa 720

ccgaatggct atatagctat gtgccctgct cccggagata tgggttccaa atcatatttg 780

ccctctgatg ctgctaacct ttacttcagc tccgaggaag gaagcaattt gctcgactat 840

tctgatttcg ggtgggcaga ccgaagttcc cggagtcctg aaatatcatc tgttctgtct 900

gctgccctag aagccgatga agctcagttt gcggaggaaa ccaa 944

Claims

1. Protein IbRAP2-12, as follows 1) or 2):

2) and (b) fusion protein obtained by connecting labels to the N end or/and the C end of the protein shown in the sequence 2 in the sequence table.

2. A nucleic acid molecule encoding the protein ibarap 2-12 of claim 1.

3. The nucleic acid molecule of claim 2, wherein: the nucleic acid molecule is a DNA molecule shown as (a1) or (a 2):

(a2) the nucleotide sequence is a DNA molecule shown as a sequence 1 in a sequence table.

4. An expression cassette, recombinant vector, recombinant microorganism comprising the nucleic acid molecule of claim 2 or 3.

5, b1) or b 2):

b1) use of the protein ibarap 2-12 of claim 1, or the nucleic acid molecule of claim 2 or 3, or an expression cassette, a recombinant vector, a recombinant microorganism comprising the nucleic acid molecule of claim 2 or 3, for modulating stress resistance in a plant;

b2) use of a protein according to claim 1, or a nucleic acid molecule according to claim 2 or 3, or an expression cassette, a recombinant vector, a recombinant microorganism comprising a nucleic acid molecule according to claim 2 or 3, for the production of transgenic plants with altered stress resistance;

the stress resistance is salt resistance and/or drought resistance.

6. The use of claim 5, wherein: the plant is sweet potato or arabidopsis thaliana.

7. A method for producing a stress-resistant transgenic plant, comprising the step of introducing into a recipient plant a substance that increases the expression and/or activity of the protein ibarap 2-12 of claim 1, to obtain a transgenic plant; increased stress resistance of the transgenic plant compared to the recipient plant; the stress resistance is salt resistance and/or drought resistance.

8. The method of claim 7, wherein: the plant is sweet potato or arabidopsis thaliana.

9. A method of plant breeding comprising the steps of: increasing the content and/or activity of the protein IbRAP2-12 of claim 1 in a plant, thereby enhancing stress resistance of the plant; the stress resistance is salt resistance and/or drought resistance.

10. The method of claim 9, wherein: the plant is sweet potato or arabidopsis thaliana.