CN104450736A - Cucumber AG-like gene CsMADS24 overexpression carrier and application thereof - Google Patents

Abstract

The invention discloses a cucumber AG-like gene CsMADS24 overexpression carrier and application thereof to flower organ modification, and belongs to the technical field of biology. The carrier is a plant expression carrier containing double 35S promoters and a cucumber gene CsMADS24. A CsMADS24 transgenic plant obtained by overexpressing the CsMADS24 in Arabidopsis thaliana is in a flowering state at the early development stage of flowers; and at the later development stage of the flowers, only few relatively thin and long flowers can be formed, the petals and the stamens of most of the flowers cannot normally develop, and only sepals and carpel develop. The result shows that CsMADS24 play an important control role on the aspect of flower organ development. A novel flower organ variant material obtained by virtue of the gene CsMADS24 can be applied to breeding of crops and ornamental plants and has certain agricultural and ornamental values.

Description

Cucumber AG-like gene C sMADS24 gene overexpression carrier and application thereof

Technical field

The invention belongs to plant genetic engineering field, be specifically related to a kind of cucumber AG-like gene C sMADS24 over-express vector and application thereof.

Background technology

The normal development of flower is that plant is rely the basis of procreation, is also that agriculture production obtains product, improves critical period of output.Identify by molecular biology method the gene controlling flower development also to pass through to change its phraseology, purposively can change flower pattern, the novel material producing variation can be used for the Breeding Application of farm crop and ornamental plant.Along with to the research of flower development associated problem going deep into progressively, find that the growth of floral organ controlled by a class MADS-box homeotic gene.MADS-box gene family is gained the name in the initial of four members identifying out at first: the MCM1 gene of yeast, the AGAMOUS gene of Arabidopis thaliana, the DEFICIENS gene of Common Snapdragon and the SRF gene of people.

At present, regulate and control flower development MADS-box gene from a series of species separating clone out, these species comprise Arabidopis thaliana, Common Snapdragon, tobacco, paddy rice, corn, lily, butterfly orchid etc.Research shows, the growth of dicotyledonous thaliana flower organ can be summarized as the ABCDE model of flower development.This model is thought, floral organ is A, B, C, D and E five result of genoid co expression, and this five genoid is all MADS-box gene substantially.C functional gene wherein and D functional gene are also called AG-like gene, belong to AG subfamily.In the genome of model plant Arabidopis thaliana, have 4 gene: AGAMOUS(AG), SHATTERPROOF1(SHP1), SHP2 and SEEDSTICK (STK) belong to this family.These four genes have the sequence identity of height, and show phraseology different but overlapped separately.AG wherein as C functional gene the decision of third round stamen, the growth of fourth round gynoecium carpel and merismatic decisive on work.In the mutant ag of AG gene, the stamen of third round can change similar petal-like structure into, and extra little Hua can be changed in the carpel place of fourth round.STK plays a decisive role in the growth of ovule as D genoid.Two gene SHP1 and SHP2 in addition have C and D two kinds of functions concurrently, namely all work in the growth of carpel and ovule.

In the species such as Arabidopis thaliana, by changing the phraseology of AG-like gene, the new flower pattern of design is needed to become possibility by people.Utilize transgenic technology to suppress the expression of Arabidopis thaliana AG gene, its stamen is replaced by petal, and carpel is alternative by new spending, and forms double flower, for the double flower creating ornamental value higher illustrates fine prospect.Be connected with 35S promoter by petunia homeotic gene FBP2, construction of expression vector PBP2 imports tobacco, causes tobacco stamen produces petal.After the floral organ of London plane is determined gene PaAG (C genoid) transformation of tobacco, the form of petal there occurs wide variation.Cucumber is as important vegetable crop, and the research regulated and controled about MADS-box gene pairs flower development is also relatively less.The correlation function completed as studying cucumber gene from molecular level of Cucumber germplasm order-checking in 2009 provides possibility.Found by genome-wide screening, only CsMADS24 can belong to AG-like family, in view of the vital role of AG-like gene in flower development, is worth further investigation.The present invention has cloned 1 plays important regulating and controlling effect CsMADS24 gene at petal and stamen development from cucumber, proposes the genetically engineered modification method utilizing this gene to carry out plant flower organ transformation.

Summary of the invention

The object of the present invention is to provide a kind of cucumber CsMADS24 gene flower specific expression carrier and and application in floral organ modification, this carrier contains cucumber AG-like gene C sMADS24, and the upstream of gene is connected with two 35S promoter.

Above-mentioned plant expression vector of the present invention is PHB-CsMADS24, is built form by following method:

(1) according to CuGI(http: //cucumber.genomics.org.cn/page/cucumber/index.jsp) sequence (Csa017355) of the upper cucumber CsMADS24 announced, design two ends primer: CsMADS24-F:5 '-aaaaCTGCAGATGAGTTGTTATGAGGAAG-3 ' (containing PstI site) CsMADS24-R:5 '-aaaaTCTAGATTACACAAGTTGAAGAGAG-3 ' (containing XbaI site).With cDNA first chain of cucumber bud for template carries out pcr amplification, obtain CsMADS24 total length.

(2) reclaim the cDNA total length of CsMADS24, be connected on pMD18 carrier, adopt alkaline lysis method of extracting plasmid DNA, cut by PCR detection and enzyme and detect acquisition recombinant plasmid pMD18-CsMADS24.

(3) use PstI and XbaI enzyme cutting pMD18-CsMADS24, reclaim CsMADS24 fragment, use PstI and XbaI enzyme cutting PHB simultaneously, connect after reclaiming, transformed competence colibacillus cell, obtain plant expression vector PHB-CsMADS24.

Another object of the present invention is the genetically engineered application of open cucumber CsMADS24 in floral organ modification, after this channel genes Arabidopis thaliana, the CsMADS24 transfer-gen plant obtained is open shape at Floral development in early days, in Floral development late period, except minority can form more elongated spending, petal and the stamen of major part flower can not normal developments, only see sepal and the carpel of growth.This gene can be used as goal gene and imports other plant, changes the flower pattern of plant, to carry out the improvement of plant variety.

Accompanying drawing explanation

Fig. 1 is the electrophoresis schematic diagram in the present invention after the amplification of CsMADS24 total length;

Fig. 2 is PstI and the XbaI double digestion electrophoresis detection figure of expression vector PHB-CsMADS24 of the present invention;

Fig. 3 is the PCR qualification figure of transfer-gen plant;

Fig. 4 is the expression analysis of the transgenic Arabidopsis plants of overexpression CsMADS24, and wherein WT is wild-type; 1-3 is transfer-gen plant strain;

Fig. 5 is the transgenic arabidopsis phenotype analytical of overexpression CsMADS24, and wherein (A) and (C) is wild-type; (B) and (D) be transfer-gen plant.

Embodiment

Below in conjunction with the drawings and specific embodiments, the invention will be further described, and these embodiments only for illustrating the present invention, and do not form any restriction to scope of the present invention.

Reagent involved in embodiment is mainly divided into molecular biology experiment reagent, various restriction enzyme, Taq archaeal dna polymerase, ThermoScript II, RNA enzyme inhibitors, dNTP etc. are Japanese precious biotechnology company limited (Dalian) product, plasmid extraction kit is purchased from Sangon Biotech (Shanghai) Co., Ltd., TRIzoL Reagent RNA extracts reagent purchased from invitrogen company, high-fidelity enzyme KOD-Plus is purchased from TOYOBO company, DNase I is purchased from TIANGEN Biotech (Beijing) Co., Ltd., DNA extraction kit is purchased from TIANGEN Biotech (Beijing) Co., Ltd..All the other reagent are domestic analytical pure; Instrument is molecular biology and genetic engineering laboratories common instrument.All primer sequences all synthesize in Sangon Biotech (Shanghai) Co., Ltd..In the embodiment of the present invention, method therefor is ordinary method if no special instructions.

embodiment 1: expression vectorpHB-CsMADS24 structure

(1) design of primers: according to CuGI(http: //cucumber.genomics.org.cn/page/cucumber/index.jsp) sequence (Csa017355) of the upper cucumber CsMADS24 announced, design two ends primer:

CsMADS24-F:5 '-aaaaCTGCAGATGAGTTGTTATGAGGAAG-3 ' (containing PstI site)

CsMADS24-R:5 '-aaaaTCTAGATTACACAAGTTGAAGAGAG-3 ' (containing XbaI site).

(2) extraction of cucumber bud total serum IgE

Cucumber variety used is North-China Type cucumber.Get the bud 1mg of length about 0.7 mm, freeze in liquefied ammonia after drawing materials at once, adopt TRIzol(Invitrogen, USA) reagent method extraction total serum IgE: after adding 1.5 ml Trizol, room temperature places 5 min, makes its abundant cracking.Centrifugal 5 min of 12,000rpm, abandon precipitation.Add 200 ul chloroforms, after vibration mixing, room temperature places 15 min.4 DEG C of 12,000g centrifugal 15 min.Draw upper strata aqueous phase, in another centrifuge tube.Add 0.5ml Virahol, mixing, room temperature places 30 min.4 DEG C of 12,000g centrifugal 10 min, abandons supernatant.By 1ml 75% washing with alcohol 2 precipitations.4 DEG C of 8,000g centrifugal 5 min, abandons supernatant.Room temperature dries 10 min.Use 50uL H ₂o(Rnase free) dissolve RNA.

(3) synthesis of cucumber bud total cDNA first chain

For with Oligo (dT) after cucumber bud RNA processes with DNase I ₁₈reverse transcription for primer: get RNA 15 uL, adds Oligo (dT) ₁₈1uL, mixing, 70 DEG C of insulations 5min, immediately ice-water baths, slightly centrifugal, add 10 × M-MLV Buffer 2 uL, dNTP (10mM) 1 uL, RNasin (40U/uL) 1 uL, M-MLV (200U/uL) 1uL successively, cumulative volume 20 uL, mixing, 42 DEG C of insulation 60min, 95 DEG C of 10min deactivation M-MLV enzymic activitys ,-20 DEG C of preservations.

(4) amplification of CsMADS24 gene

Design Auele Specific Primer: CsMADS24-F:5 '-aaaaCTGCAGATGAGTTGTTATGAGGAAG-3 ' (containing PstI site) CsMADS24-R:5 '-aaaaTCTAGATTACACAAGTTGAAGAGAG-3 ' (containing XbaI site), with the first chain product for template, carry out pcr amplification with long segment, high-fidelity enzyme KOD-Plus, PCR reaction conditions is: 94 DEG C of 5 min; 94 DEG C of 30 s; 56 DEG C of 30 s; 68 DEG C of 1.0 min, 40 circulations; 68 DEG C of 5 min.PCR product 1.5% agarose carries out electrophoresis detection, and amplified fragments size is about 765bp, with expection (Fig. 1) in the same size.

(5) glue of CsMADS24 fragment reclaims

After 1.5% agarose gel electrophoresis is carried out to PCR primer, cut object fragment, use glue to reclaim test kit, according to test kit specification sheets, object fragment is reclaimed.

(6) CsMADS24 fragment tailing

Get the eppendorf pipe of 1.5 ml sterilizings, add the PCR primer 14 μ l of recovery, 10 × Taq DNA polymerase buffer liquid 2 μ l, 10mM dNTP 2 μ l, Taq archaeal dna polymerase 2 μ l successively; 72 DEG C of process 45 min; First add 0.18 mL sterilized water, then add 20 μ l 3M sodium-acetates, mixing, finally adds the dehydrated alcohol of 2 times of volumes ,-20 DEG C of precipitations 2hr, 12,000rpm, 4 DEG C of centrifugal 10min.Abandon supernatant, 75% washing with alcohol precipitates 2 times.Add 20 μ L sterilized water dissolution precipitations after DNA dries, the DNA of dissolving is placed in-20 DEG C and saves backup.

(7) the T/A Cloning and sequencing of CsMADS24 fragment

Recovery fragment is connected on pMD18 carrier, its concrete steps are: add respectively in 1.5 ml centrifuge tubes: cDNA 5 μ l, pMD18 carrier 0.5 μ l of CsMADS24 fragment, 10 × T4 DNA ligase damping fluid 1 μ l, T4 DNA ligase 1 μ l, add sterilized water to 10 μ l, seal with sealed membrane; Be placed in 16 DEG C and connect 4-6h.100 μ l competence enterobacteria E.coli DH5 α are added in linked system and mixes; Mixed solution ice bath 30 min, after 42 DEG C of thermal stimulus 90 s, ice bath 5 min; Add 800 μ l LB liquid nutrient mediums, 37 DEG C, 200 rpm shaking tables cultivate 45min thalline is recovered; After cultivation terminates, conventional 3,000 rpm is centrifugal, and 2 min collect thalline; Super clean bench sucks supernatant, during residue about 0.1 ml, uses liquid-transfering gun mixing, access on the LB solid plate with Amp resistance, be coated with evenly with aseptic triangle rod; 37 DEG C of incubated overnight; Picking colony is inoculated in the LB liquid nutrient medium with Amp resistance and cultivates 12h, collects thalline, adopts plasmid extraction test kit to extract plasmid.The recombinant plasmid pMD18-CsMADS24 detecting and obtain is cut by enzyme, concrete grammar is: add respectively in the centrifuge tube of 0.5 ml: plasmid DNA (50ng/ μ l) 2 μ l, PstI 0.5 μ l, XbaI 0.5 μ l, 10 × buffer(M) 2 μ l, use sterilized water to supply 20 μ l; 37 DEG C of reaction 4h; Then enzyme is cut correct recombinant plasmid pMD18-CsMADS24 and carry out the exactness that sequence verification inserts gene.

(8) structure of expression vector PHB-CsMADS24

Use PstI and XbaI to carry out double digestion to plasmid pMD18-CsMADS24 and PHB carrier, obtaining 5 ' end band respectively has PstI and 3 ' end band to have CsMADS24 fragment and the PHB carrier of XbaI, carries out glue recovery respectively after electrophoresis, and 16 DEG C connect 4-6h; 100 μ l competence enterobacteria E.coli DH5 α are added in 6 μ l linked systems and mixes; Mixed solution ice bath 30min, after 42 DEG C of thermal stimulus 90s, ice bath 5 min; Add 800 μ l LB liquid nutrient mediums, 37 DEG C, 200 rpm shaking tables cultivate 45min thalline is recovered; After cultivation terminates, conventional 3,000 rpm is centrifugal, and 1 min collects thalline; Super clean bench sucks supernatant, during residue about 0.1 ml, uses liquid-transfering gun mixing, access on the LB solid plate with Kan resistance, be coated with evenly with aseptic triangle rod; 37 DEG C of incubated overnight; Picking colony is inoculated in the substratum of LB liquid+Kan, 37 DEG C, 180rpm cultivates after 12h, extracts plasmid.The recombinant plasmid PHB-CsMADS24 detecting and obtain is cut by enzyme, concrete grammar is: add respectively in the centrifuge tube of 0.5 ml: plasmid DNA (50ng/ μ l) 2 μ l, PstI 0.5 μ l, XbaI 0.5 μ l, 10 × buffer(M) 2 μ l, use sterilized water to supply 20 μ l; 37 DEG C of reaction 4h; Through 1.5% agarose gel electrophoresis detect find, recombinant plasmid PHB-CsMADS24 can enzyme cut out expection size (765bp) fragment (Fig. 2).Enzyme is cut correct recombinant plasmid to deliver to Sangon Biotech's order-checking and carry out sequence verification (its nucleotide sequence is as shown in SEQ ID NO1), finally obtain expression vector PHB-CsMADS24.

Embodiment 2:PHB-CsMADS24 turns Agrobacterium GV3101

(1) Agrobacterium competent cell preparation

The mono-colony inoculation of picking Agrobacterium GV3101 is in 5ml YEB substratum, and 28 DEG C are shaken training and spend the night, and be inoculated in 50 ml YEB substratum in the ratio of 1:100 and spread cultivation, about 6-7h to OD600=0.4-0.6 is cultivated in 28 DEG C of continuation.Bacterium liquid is placed in 30min on ice; 5,000 rpm, 4 DEG C of centrifugal 5min, abandon supernatant, are suspended from by thalline in 10 ml 0.15 M NaCl; 5,000 rpm, 4 DEG C of centrifugal 5min, abandon supernatant, thalline 1 ml 20 mM CaCl ₂, 4 DEG C) suspend gently, often pipe 200 μ l packing, or add the sterile glycerol that final concentration is 20% ,-70 DEG C of preservations.

(2) conversion of Agrobacterium and qualification

10 μ l plasmid DNA added in 200 μ l Agrobacterium competence, mixing, ice bath 30min, liquid nitrogen freezing 3-5min, 37 DEG C of water-bath 5min, add 1ml YEB substratum, and 28 DEG C are shaken training 3-4h.1,0000rpm, the centrifugal 30s of room temperature, abandons supernatant, adds the resuspended thalline of 200 μ l YEB substratum, is applied on YEB substratum, cultivates 2 days for 28 DEG C; Alkaline lysis method of extracting Agrobacterium plasmid DNA, digestion verification.Plasmid transformation of E. coli (DH5 α) again again, after incubated overnight, picking list bacterium colony liquid culture, extracts plasmid DNA, then cuts qualification with enzyme.

embodiment 3: containpHB-CsMADS24 agrobacterium GV3101 arabidopsis thaliana transformation

(1) plantation of Arabidopis thaliana

1.) Arabidopis thaliana used is columbiawildtype Arabidopsis thaliana, for Agricultural University Of Jiangxi's crop physiology and ecology and genetic breeding key lab preserve.By rear 4 degree of vernalization 72 h of seed plantation gathered in the crops then, vernalization 24 h after next year seed plantation.Then proceed in relative humidity 80% in artificial culture room, constant temperature 20-24 DEG C, intensity of illumination 80-200 μm ol/M2/S, periodicity of illumination is 8 h Hei An ﹑ 16 h illumination cultivation.Soil used is 3 parts of vermiculites, and 1 part of perlite and 2 parts of black earth mix.

2. Nutrition Soil plastic tub is installed, in pallet, add nutritive medium, after Nutrition Soil water suction humidity, start dibbling.

3. the seed of Arabidopis thaliana is placed on the paper of tiling, with toothpick by the Seed Points of Arabidopis thaliana on soil.Build with preservative film, light culture two days, takes preservative film off after four days and normally cultivates.

4. can water one time of nutrition liquid again when soil is slightly dry, water later.To transform, when bolting 2 is to 3cm, wiping out poppyhead sequence, watering again once with nutritive medium.

5. the collection of seed: after Arabidopis thaliana fully matured, stops watering being cut by Arabidopis thaliana after plant to be planted drying to be placed on a clean glossy paper and collects seed, go totally as far as possible, be convenient to screen by foreign material.

(2) conversion of Arabidopis thaliana and the screening of transformant

1. preparing Agrobacterium bacterium liquid 10 ml having transformed corresponding plasmid, transforming evening before that day, proceeding to large bottle overnight incubation, within second day, take out agrobacterium liquid OD600 when using and work as between 1.2 to 1.6.Room temperature 5, centrifugal 10 min of 000 rpm.Abandon supernatant, Agrobacterium precipitation is suspended in the osmotic medium of respective volume, makes OD600 about 0.8.

2. first the fruit pod that plant has grown and open flower shears are fallen, then agrobacterium suspension is directly sprayed to whole plant, be mainly sprayed on inflorescence.Cover transparent plastic closure to keep humidity, move into thermostatic chamber lucifuge and cultivate, within second day, can uncap, normal illumination is cultivated.

3. spray once after one week, sowing, corresponding resistance 1/2 MS flat board screens transformant again.

4. the screening of transformant: seed disinfection, first uses 70% alcohol immersion 10 min, will make seed suspension every now and then when above-mentioned process, and change 70% ethanol.Finally with aseptic washing four times.

5. the seed Top agar(0.1% aqueous agar solution after process) be uniformly coated on corresponding resistance solid screening and culturing primary surface, the most multiple 1500 of the plate of every block 150 mm diameter.

6. 4 DEG C of vernalization 2 to 3 days, moves into 22 DEG C of thermostatic chambers and cultivates.Be transplanted to screening after the transformant obtained grows to suitable size in soil.

embodiment 4: the qualification of transfer-gen plant and analysis

(1) extraction of Arabidopis thaliana DNA

The appropriate Arabidopsis leaf through screening is put into the centrifuge tube of 1.5 ml, add the SDS extraction buffer of 400 μ l, grind to form pulpous state with blue spillikin, add equal-volume phenol: chloroform: primary isoamyl alcohol (25:24:1), fiercely shakes up, 12,000 rpm, centrifugal 10 min.Get supernatant in new centrifuge tube, add the dehydrated alcohol of 2 times of volumes and the 3M sodium-acetate (PH5.2) of 0.1 times of volume, violent mixing makes DNA agglomerating, puts into-20 DEG C of precipitation more than 2hr.12,000 rpm subsequently, centrifugal 10 min.Abandon supernatant, precipitation with 70% washing with alcohol once after room temperature dry, add appropriate TE or ultrapure water dissolving.

(2) qualification of transgenic Arabidopsis plants

Be template with the DNA of extracting, use primer CsMADS24-F1:CTGCAGCGTCTTCTCCTCCCG TGGTC and CsMADS24-R1:TCTAGATCTGTCTCGGCTATCTTTGC to carry out pcr amplification CsMADS24 fragment, the 25 μ l systems of PCR are: PCR damping fluid (10 ×) 2.5 μ l, Taq 0.5 μ l, cDNA template 2 μ l, 10mM dNTP 0.5 μ l, 10 μMs of each 1 μ l of CsMADS24-F1 and CsMADS24-R1 primer, use sterilized waters supply 25 μ l.Reaction conditions is: 94 DEG C of 5min, 35 circulations, 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, and 72 DEG C extend 60s, 72 DEG C of reaction 10min.Detected result as shown in Figure 3.The total serum IgE of extracting positive plant bud, synthesizes cDNA first chain after reverse transcription, with CsMADS24-F1 and CsMADS24-R1 primer for primer carries out RT-PCR analysis, reaction system and program the same.Internal reference is CsACTIN gene, primer sequence is: CsACTIN-F:GACATTCAATGTGCCTGCTATG, the 25 μ l systems of CsACTIN-R:CATACCGATGAGAGATGGCTG, PCR are: PCR damping fluid (10 ×) 2.5 μ l, Taq 0.5 μ l, cDNA template 2 μ l, 10mM dNTP 0.5 μ l, 10 μMs of CsACTIN-F primer 1 μ l, 10 μMs of CsACTIN-R primer 1 μ l, use sterilized waters supply 25 μ l.Reaction conditions is: 94 DEG C of 5min, 26 circulations, 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, and 72 DEG C extend 60s, 72 DEG C of reaction 10min.Detected result as shown in Figure 4.

(3) transgenic Arabidopsis plants phenotype analytical

By the result of PCR and RT-PCR, the sun plant obtained is observed, the CsMADS24 transfer-gen plant obtained is open shape at Floral development in early days, in Floral development late period, except minority can form more elongated spending, petal and the stamen of major part flower can not normal developments, only see sepal and the carpel (Fig. 5) of growth.

SEQ ID NO：1

〈210〉：1

〈211〉:765

〈212〉：DNA

< 213 >: cucumber (Cucumis sativus L.)

〈400〉: 1

ATGAGTTGTT ATGAGGAAGA AGATGAAGAA TCAGGAGTAG TAGGATTAAG AAGATCATCA 60

TCATCATCAA GAACAGGAAG AGGAAAGATT GAAATAAAGA GAATTGAAAA TACAACAAAT 120

CGTCAAGTTA CTTTCTGTAA ACGAAGAAAT GGTTTGCTTA AGAAAGCTTA TGAACTCTCT 180

GTCCTTTGTG ATGCTGAGGT TGCTCTTATC GTCTTCTCCT CCCGTGGTCG TCTCTATGAA 240

TACGCTAACA ACAGTGTTAG GGCTACGATT TCGAGGTACA AAAAGGCATA TTCGGATCCC 300

TCCACCGCCA TGACCGTTTC AGAAGCCAAT ACTCAGTTCT ACCAGCAAGA ATCTGCCAAA 360

TTACGAGCTC AAATCGGAAA TTTGCAAAAC CTAAACAGGC ATTTGTTGGG GGAATCCATC 420

AGTTCGTTAT CAGTTAAAGA TTTGAAAAGC CTAGAGGTGA AATTGGAGAA AGGAATTAGC 480

CGAATTCGAT CCAGAAAGAA TGAGCTTCTG TTTTCGGAGA TTGAATACAT GCAAAAAAGG 540

GAAATTGAAC TGCACACTAA CAACCAGCTG ATACGTGCAA AGATAGCCGA GACAGAGAGA 600

AGCCAACAAA ACACAAATGC AAGTAATAAC AATGGAATAG CAACAAGAAG AGGAGAGGAA 660

GGATCAATGG GTACAAATTT AGAGGACAAC AATCATCATC AATATGACTC AACAAACTAC 720

TTTGATCCCC ATCATAATCA CCCTATCTCT CTTCAACTTG TGTAA 765

Claims (4)

1. cucumber CsMADS24 gene, is characterized in that, its nucleotides sequence is classified as shown in SEQ ID NO1.

2. a cucumber CsMADS24 gene flower specific expression carrier, it is characterized in that, plant expression vector is PHB-CsMADS24, and it contains cucumber AG-like gene C sMADS24, and the upstream of gene is connected with two 35S promoter.

3. a cucumber CsMADS24 gene flower specific expression carrier, is characterized in that, is built form by following method:

According to the CsMADS24 sequences Design two ends primer that accession number on CuGI is Csa017355, wherein CsMADS24-F primer introduces PstI site, CsMADS24-R primer introduces XbaI site: CsMADS24-F:5 '-aaaaCTGCAGATGAGTTGTTATGAGGAAG-3 ', CsMADS24-R:5 '-aaaaTCTAGATTACACAAGTTGAAGAGAG-3 ', with cDNA first chain of cucumber bud for template carries out pcr amplification, obtain CsMADS24 total length;

Reclaim the cDNA total length of CsMADS24, be connected on pMD18 carrier, adopt alkaline lysis method of extracting plasmid DNA, cut by PCR detection and enzyme and detect acquisition recombinant plasmid pMD18-CsMADS24;

(3) use PstI and XbaI enzyme cutting pMD18-CsMADS24, reclaim CsMADS24 fragment, use PstI and XbaI enzyme cutting PHB simultaneously, connect after reclaiming, transformed competence colibacillus cell, obtain plant expression vector PHB-CsMADS24.

4. cucumber CsMADS24 gene spends the application of specific expression carrier as claimed in claim 3, it is characterized in that, the plant expression vector PHB-CsMADS24 of acquisition is proceeded to Agrobacterium GV3101, be transferred to again in Arabidopis thaliana, the seed of results plant after ripe, obtain resistance seedling by hygromycin selection after drying, then obtain transfer-gen plant after being detected by PCR qualification and RT-PCR.