CN105820220B - The application of resistance relevant protein and its encoding gene in regulation plant alkali resistance - Google Patents
The application of resistance relevant protein and its encoding gene in regulation plant alkali resistance Download PDFInfo
- Publication number
- CN105820220B CN105820220B CN201510003844.6A CN201510003844A CN105820220B CN 105820220 B CN105820220 B CN 105820220B CN 201510003844 A CN201510003844 A CN 201510003844A CN 105820220 B CN105820220 B CN 105820220B
- Authority
- CN
- China
- Prior art keywords
- sequence
- resistance
- rak1
- plant
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses the application of resistance relevant protein and its encoding gene in regulation plant alkali resistance.Resistance relevant protein provided by the present invention is following protein a) or b) or c) or d): a) amino acid sequence is the protein of the 93-774 amino acids of sequence 1 in sequence table；B) protein with the resistance relevant protein function for obtaining the 93-774 amino acids of sequence 1 in sequence table by the substitution and/or deletion and/or addition of one or several amino acid residues；C) amino acid sequence is the protein of sequence 1 in sequence table；D) protein with same protein function for obtaining the amino acid sequence of sequence 1 in sequence table by the substitution and/or deletion and/or addition of one or several amino acid residues.It is demonstrated experimentally that the plant that resistance relevant protein and its encoding gene of the invention can be used to be applied to cultivate alkali resistance.
Description
Technical field
The present invention relates to resistance relevant proteins in field of biotechnology and its encoding gene in regulation plant alkali resistance
Using.
Background technique
Alkaline stress is an important factor for influencing crop yield in China's agricultural production.Report that there are salinization of soil in current China
Soil reach 1,500,000,000 mu, and there are a large amount of soils to degenerate because farming is not good to be not suitable for the saline and alkaline of plant growth every year
It is significant to the grain security in China to improve plant alkali resistance for ground.
For plant, pH environment can impact the growth and development of plant roots；Alkaline stress can significantly affect plant
Photosynthesis rate, light respiration and nutrient absorption etc., such as arabidopsis will cause the reduction of Fv/Fm value under alkaline environment.Cell
The mutually coordinated interior environment to stablize plant cell between interior each organelle, to guarantee that intracellular reaction is normally carried out.Equally
Intracellular physiological activity also will affect the environment pH of root system.
Summary of the invention
The technical problem to be solved by the present invention is to how improve the resistance of plant.
In order to solve the above technical problems, the answering in regulation stress resistance of plant present invention firstly provides resistance relevant protein
With.
Resistance relevant protein provided by the present invention is in the application in regulation stress resistance of plant, the degeneration-resistant related egg
White, entitled RAK1 is following protein a) or b) or c) or d):
A) amino acid sequence is the protein of the 93-774 amino acids of sequence 1 in sequence table；
B) by the 93-774 amino acids of sequence 1 in sequence table by one or several amino acid residues substitution and/
Or the protein with the resistance relevant protein function that deletion and/or addition obtains；
C) amino acid sequence is the protein of sequence 1 in sequence table；
D) amino acid sequence of sequence 1 in sequence table is passed through to the substitution and/or missing of one or several amino acid residues
And/or the protein with same protein function that addition obtains.
In order to make protein in a) convenient for purifying, can in sequence table the amino terminal of protein shown in sequence 1 or
Carboxyl terminal connects upper label as shown in Table 1.
The sequence of table 1, label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (usually 5) | RRRRR |
| Poly-His | 2-10 (usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
It is above-mentioned b) in RAK1 can be artificial synthesized, can also first synthesize its encoding gene, then carry out biological expression and obtain.It is above-mentioned
B) encoding gene of the RAK1 in can be by will be in DNA sequence dna shown in 277-2325 nucleotide of sequence 2 in sequence table
The codon of one or several amino acid residues is lacked, and/or carries out the missense mutation of one or several base-pairs, and/or
The coded sequence that its 5 ' end and/or 3 ' ends connect label shown in table 1 obtains.
It is above-mentioned d) in protein can be artificial synthesized, can also first synthesize its encoding gene, then carry out biological expression and obtain.On
The encoding gene for stating the protein in d) can be by will lack one or several ammonia in DNA sequence dna shown in sequence 2 in sequence table
The codon of base acid residue, and/or the missense mutation of one or several base-pairs is carried out, and/or connect at its 5 ' end and/or 3 ' ends
The coded sequence of label shown in upper table 1 obtains.
Wherein, sequence 2 is made of 2325 nucleotide, amino acid sequence shown in coded sequence 1.The 277- of sequence 2
RAK1 albumen shown in the 93-774 amino acids of 2325 nucleotide coding sequences 1；1-276 nucleotide of sequence 2
MYC label shown in the 1-92 amino acids of coded sequence 1.
In order to solve the above technical problems, the present invention also provides biomaterials relevant to the RAK1 in regulation Genes For Plant Tolerance
Application in inverse property.
Biomaterial relevant to the RAK1 provided by the present invention is described in the application in regulation stress resistance of plant
Biomaterial relevant to the RAK1 is following C1) any one of to C20):
C1 the nucleic acid molecules of the RAK1) are encoded；
C2) contain C1) expression cassettes of the nucleic acid molecules；
C3) contain C1) recombinant vectors of the nucleic acid molecules；
C4) contain C2) recombinant vector of the expression cassette；
C5) contain C1) recombinant microorganisms of the nucleic acid molecules；
C6) contain C2) recombinant microorganism of the expression cassette；
C7) contain C3) recombinant microorganism of the recombinant vector；
C8) contain C4) recombinant microorganism of the recombinant vector；
C9) contain C1) the transgenic plant cells systems of the nucleic acid molecules；
C10) contain C2) the transgenic plant cells system of the expression cassette；
C11) contain C3) the transgenic plant cells system of the recombinant vector；
C12) contain C4) the transgenic plant cells system of the recombinant vector；
C13) contain C1) Transgenic plant tissues of the nucleic acid molecules；
C14) contain C2) Transgenic plant tissue of the expression cassette；
C15) contain C3) Transgenic plant tissue of the recombinant vector；
C16) contain C4) Transgenic plant tissue of the recombinant vector；
C17) contain C1) the genetically modified plants organs of the nucleic acid molecules；
C18) contain C2) the genetically modified plants organ of the expression cassette；
C19) contain C3) the genetically modified plants organ of the recombinant vector；
C20) contain C4) the genetically modified plants organ of the recombinant vector.
Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules can also
To be RNA, such as mRNA or hnRNA.
In above-mentioned application, C1) nucleic acid molecules be it is following 1) or 2) or 3) or 4) or 5) or 6) shown in gene:
1) nucleotide sequence is the cDNA molecule or DNA molecular of 277-2325 nucleotide of sequence 2 in sequence table；
2) there is 75% or 75% or more identity with the nucleotide sequence 1) limited, and encodes cDNA points of the RAK1
Son or genomic DNA molecule；
3) nucleotide sequence hybridization with 1) restriction, and the cDNA molecule or gene of the coding RAK1 under strict conditions
Group DNA molecular；
4) nucleotide sequence is the cDNA molecule or DNA molecular of sequence 2 in sequence table；
5) there is 75% or 75% or more identity with the nucleotide sequence 4) limited, and encoding amino acid sequence is sequence
The cDNA molecule or genomic DNA molecule of 1 protein；
6) under strict conditions with 4) limit nucleotide sequence hybridization, and encoding amino acid sequence be sequence 1 albumen
The cDNA molecule or genomic DNA molecule of matter.
Those of ordinary skill in the art can easily adopt by known method, such as the side of directed evolution and point mutation
Method is mutated the nucleotide sequence of coding RAK1 of the invention.Those have and separate with the present invention by manually modified
The nucleotide sequence 75% of obtained RAK1 or the nucleotide of higher identity, as long as encoding RAK1 and having the function of RAK1,
It is derived from nucleotide sequence of the invention and to be equal to sequence of the invention.
Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair
The nucleotide sequence of the protein of the composition of amino acid sequence shown in the 93-774 amino acids of bright coded sequence 1 has
The nucleotide sequence of 75% or higher or 85% or higher or 90% or higher or 95% or higher identity.Identity can
With with the naked eye or computer software is evaluated.Using computer software, the identity between two or more sequences can be used
Percentage (%) indicates, can be used to evaluate the identity between correlated series.
In above-mentioned application, the stringent condition is to hybridize at 68 DEG C in 2 × SSC, the solution of 0.1%SDS and wash film
2 times, each 5min, but in 0.5 × SSC, the solution of 0.1%SDS, hybridize at 68 DEG C and washes film 2 times, each 15min.
Above-mentioned 75% or 75% or more identity can be 80%, 85%, 90% or 95% or more identity.
In above-mentioned application, C2) described in the nucleic acid molecules containing coding RAK1 expression cassette (RAK1 expression casette), be
The DNA that RAK1 is expressed in host cell is referred to, which may include not only the promoter for starting RAK1 genetic transcription, may be used also
Terminator including terminating RAK1 genetic transcription.Further, the expression cassette may also include enhancer sequence.It can be used for the present invention
Promoter include but is not limited to: constitutive promoter, tissue, organ and the special promoter and inducible promoter of development.
The example of promoter includes but is not limited to: the constitutive promoter 35S: the wound-induced from tomato of cauliflower mosaic virus
Type promoter, leucine aminopeptidase (" LAP ", Chao et al. (1999) Plant Physiol 120:979-992)；From cigarette
Chemical inducible promoter of grass, pathogenesis correlation 1 (PR1) is (by salicylic acid and BTH (diazosulfide -7- carbothioic acid S-
Methyl esters) induction)；(available methyl jasmonate lures for tomato protease inhibitors II promoter (PIN2) or LAP promoter
It leads)；Heat-shock promoters (United States Patent (USP) 5,187,267)；Tetracycline inducible promoter (United States Patent (USP) 5,057,422)；Kind
Sub- specificity promoter, such as Millet Seed specificity promoter pF128 (CN101063139B (Chinese patent
200710099169.7)), the special promoter of seed storage protein matter (for example, phaseolin, napin, oleosin and big
The promoter (Beachy et al. (1985) EMBO is J.4:3047-3053) of beans beta conglycin).They can be used alone
Or it is used in combination with other plant promoters.All references cited herein is cited in full text.Suitable tanscription termination
Son includes but is not limited to: Agrobacterium nopaline syntase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S are terminated
Son, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator (see, e.g.: Odell
Et al. (I985)Nature 313:810；Rosenberg et al. (1987) Gene, 56:125；Guerineau et al. (1991)
Mol.Gen.Genet,262:141；Proudfoot(1991)Cell,64:671；Sanfacon et al. Genes Dev., 5:
141；Mogen et al. (1990) Plant Cell, 2:1261；Munroe et al. (1990) Gene, 91:151；Ballad et al.
(1989)Nucleic Acids Res.17:7891；Joshi et al. (1987) Nucleic Acid Res., 15:9627).
The recombinant vector of the RAK1 expression casette can be contained with existing expression vector establishment.The plant expression carries
Body includes double base agrobacterium vector and the carrier etc. that can be used for plant micropellet bombardment.As pAHC25, pBin438,
PCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or
PCAMBIA1391-Xb (CAMBIA company) etc..The plant expression vector also may include 3 ' end non-translational regions of foreign gene
Domain, i.e., comprising polyadenylation signals and any other DNA fragmentation for participating in mRNA processing or gene expression.The polyadenylic acid letter
Number bootable polyadenylic acid is added to 3 ' ends of mRNA precursor, as Agrobacterium crown gall nodule induces (Ti) plasmid gene (such as nopaline
Synthase gene Nos), plant gene (such as soybean storage protein genes) 3 ' end transcription non-translational region all have similar functions.
When using gene constructed plant expression vector of the invention, enhancer, including translational enhancer or transcriptional enhancer also can be used,
These enhancer regions can be ATG initiation codon or neighboring region initiation codon etc., but must read with coded sequence
Frame is identical, to guarantee the correct translation of entire sequence.The source of the translation control signal and initiation codon be it is extensive,
Can be it is natural, be also possible to synthesis.Translation initiation region can come from transcription initiation region or structural gene.In order to just
In transgenic plant cells or plant are identified and screened, plant expression vector used can be processed, it can as being added
The coding expressed in plant can produce the enzyme of color change or gene (gus gene, luciferase genes of luminophor
Deng), the marker gene of antibiotic (if assigned the nptII gene to kanamycins and associated antibiotic resistance, assigns to herbicide
The bar gene of phosphinothricin resistance assigns the hph gene to antibiotic hygromycin resistance, and assigns to methotrexate resistance
Dhfr gene is assigned to the EPSPS gene of glyphosate) or (such as anti-herbicide base such as anti-chemical reagent marker gene
Cause), provide metabolism mannose ability mannose-6-phosphate isomerase gene.It, can not from the security consideration of genetically modified plants
Add any selected marker, transformed plant is directly screened with adverse circumstance.
In above-mentioned application, the carrier can be plasmid, sticking grain, bacteriophage or viral vectors.
In above-mentioned application, the microorganism can be yeast, bacterium, algae or fungi, such as Agrobacterium.
In above-mentioned application, the transgenic plant cells system, Transgenic plant tissue and genetically modified plants organ are not wrapped
Include propagation material.
In an embodiment of the invention, the encoding gene (i.e. DNA molecular shown in sequence 2) of RAK1 is by containing
The recombinant vector of the expression cassette of the encoding gene of RAK1 imports in Agrobacterium GV3101.The recombinant vector is shown in sequence 2
DNA molecular replacement pCAMBIA1307 BamHI and SalI recognition site between the obtained recombinant vector of segment
PCAMBIA1307-RAK1, the pCAMBIA1307-RAK1 express amino acid sequence are the protein of sequence 1.
In above-mentioned application, the plant can be monocotyledon or dicotyledon.The dicotyledon is concretely
Crucifer.The crucifer can be arabidopsis.
In order to solve the above technical problems, the present invention also provides a kind of methods for cultivating resistance genetically modified plants.
A kind of method for cultivating resistance genetically modified plants provided by the present invention, including into recipient plant described in importing
The encoding gene of RAK1 obtains the step of resistance is higher than the resistance genetically modified plants of the recipient plant.
In an embodiment of the present invention, the encoding gene (i.e. DNA molecular shown in sequence 2) of the RAK1 is by containing
The RAK1 gene recombinant vectors of RAK1 expression casette import in purpose plant.
In the above method, wherein the RAK1 gene can be modified first as follows, then import in receptor seed plant, to reach
To better expression effect:
1) it modifies and optimizes according to actual needs, so that gene efficient expression；For example, can be according to recipient plant institute partially
The codon of love, it is inclined to meet plant while keeping the amino acid sequence of RAK1 gene of the present invention to change its codon
Love property；In optimization process, it is desirable that certain G/C content is kept in the coded sequence after optimization, to be best implemented in plant
The high level expression of quiding gene, wherein G/C content can be 35%, be more than 45%, more than 50% or more than about 60%；
2) gene order of neighbouring initial methionine is modified, so that translation effectively starting；For example, using in plant
The effective sequence known is modified；
3) it is connect with the promoter of various plants expression, in favor of its expression in plant；The promoter may include
Composing type, induction type, timing adjusting, growth adjustment, Chemical Regulation, tissue are preferably and tissue-specific promoter；Promoter
Selection will need with expression time and space and be changed, and also depend on target kind；Such as the specificity of tissue or organ
Promoter is expressed, receptor as needed is depending on what period of development；Although demonstrating many from dicotyledon
Promoter can act in monocotyledon, and vice versa, but it is desirable to select dicot promoters are used for
Expression in dicotyledon, monocotyledonous promoter is for the expression in monocotyledon；
4) it is connect with suitable transcription terminator, can also be improved the expression efficiency of gene of the present invention；Such as from
The tml of CaMV, from the E9 of rbcS；Any known available terminator to work in plant can be with the present invention
Gene is attached；
5) enhancer sequence is introduced, such as intron sequences (such as from Adhl and bronzel) and viral leader sequence
(such as from TMV, MCMV and AMV).
In one embodiment of the invention, RAK1 gene recombinant vectors are specially to use DNA molecular shown in sequence 2
The recombinant vector pCAMBIA1307-RAK1 that the segment between BamHI the and SalI recognition site of pCAMBIA1307 obtains is replaced,
PCAMBIA1307-RAK1 express amino acid sequence is the protein of sequence 1.
The RAK1 gene recombinant vectors can be by using Ti-plasmids, plant virus carrying agent, and directly delivered DNA is micro-
Injection, the standard biologics technical method such as electroporation import plant cell (Weissbach, 1998, Method for Plant
Molecular Biology VIII,Academy Press,New York,pp.411-463；Geiserson and Corey,
1998,Plant Molecular Biology(2nd Edition).)。
In the above method, the coded sequence of the encoding gene of the RAK1 can be sequence 2 in sequence table.
In the above method, the plant can be monocotyledon or dicotyledon.The dicotyledon is concretely
Crucifer.The crucifer can be arabidopsis.
In the above method, the genetically modified plants be interpreted as not only comprising the genetic transformation purpose plant is obtained the
Generation genetically modified plants also include its filial generation.For genetically modified plants, the gene can be bred in the species, it is also possible to often
The gene transfer is entered other kinds of same species by rule breeding technique, particularly including in commercial variety.The transgenosis is planted
Object includes seed, callus, intact plant and cell.
In order to solve the above technical problems, the present invention also provides the biomaterials relevant to the RAK1.
In order to solve the above technical problems, the present invention also provides the resistance relevant proteins.
In the present invention, the resistance can be alkali resistance.The pH of the alkalinity can be greater than 6.3.The pH can be 6.3-
8.2.The pH concretely 8.2.
It is demonstrated experimentally that the alkali resistance of plant can be improved in resistance relevant protein and its encoding gene of the invention: in pH value
For on 8.2 MS culture medium, the fresh weight of OE-1 is 2.21 times of rak1, and difference reaches extremely significant level；The fresh weight of OE-1 is
1.07 times of Col-0；The fresh weight of OE-2 is 2.40 times of rak1, and difference reaches extremely significant level；The fresh weight of OE-2 is Col-0's
1.16 times, difference reaches the level of signifiance.On the MS culture medium that pH value is 8.2,1.69 times of a length of rak1- of the main root of OE-1,
Difference reaches the level of signifiance；1.24 times of a length of Col-0 of the main root of OE-1, difference reaches the level of signifiance；The main root of OE-2 is a length of
1.85 times of rak1, difference reaches the level of signifiance；1.36 times of a length of Col-0 of the main root of OE-2, difference reaches the level of signifiance.It is real
Verify bright, the alkali resistance of plant can be improved in albumen RAK1 of RAK1 gene or its coding, can be used to be applied to cultivate alkaline-resisting
The plant of property.
Detailed description of the invention
Fig. 1 is the expression that semiquantitive PCR detects RAK1 gene in rak1 mutant.Wherein, A is semiquantitive PCR inspection
Survey the expression of RAK1 gene；B is that the method for immuning hybridization detects the expression of RAK1 albumen in rak1 mutant.
Fig. 2 is upgrowth situation, fresh weight and the main root length and the expression of RAK1 albumen of Col-0, OE-1, OE-2, rak1.Its
In, A is the upgrowth situation of Col-0, OE-1, OE-2, rak1 on MS culture medium that pH value is 4.8；B is the MS training that pH value is 5.8
Support the upgrowth situation of Col-0, OE-1, OE-2, rak1 on base；C is Col-0, OE-1 on MS culture medium that pH value is 8.2, OE-2,
The upgrowth situation of rak1；D is the fresh weight of Col-0, OE-1, OE-2, rak1 on MS culture medium that pH value is 4.8,5.8 and 8.2；E
The main root of Col-0, OE-1, OE-2, rak1 are long on the MS culture medium for being 4.8,5.8 and 8.2 for pH value；F be Col-0, OE-1,
The expression of RAK1 albumen in OE-2, rak1.
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.
Experimental method in following embodiments is unless otherwise specified conventional method.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
PCAMBIA1307 carrier in following embodiments is Biovector product, article No. Biovector-168625.
Wildtype Arabidopsis thaliana Col-0 in following embodiments is SALK Institute product.
The preparation of embodiment 1, resistance relevant protein RAK1 gene
DNA molecular (i.e. resistance relevant protein RAK1 shown in 277-2325 nucleotide of sequence 2 in composition sequence table
Gene).Wherein 277-2325 nucleotide coding amino acid sequences of sequence 2 are 93-774 of sequence 1 in sequence table
RAK1 albumen (i.e. resistance relevant protein RAK1) shown in amino acid；The of 1-276 nucleotide coding sequences 1 of sequence 2
MYC label shown in 1-92 amino acids.
Embodiment 2, RAK1 gene improve the alkali resistance of plant
1, the identification of the mutant of RAK1 gene
From the mutant Salk_057147 of ABRC (Ohio State University) purchase RAK1 gene, named
For rak1.It is (anti-with primer pair ATGGAGTCAATCCACTGCAATAGT (forward primer) and TCATCTGTCGGATAATACTGAGT
To primer) semiquantitive PCR (Fig. 1) is carried out to Col-0 and RAK1 respectively, the primer of internal reference ACTIN, ACTIN are
GGTCGTACTACTGGTATTGTGCT and TGACAATTTCACGCTCAGCT.The result shows that the table without RAK1 gene in rak1
It reaches.
The total protein for extracting wildtype Arabidopsis thaliana Col-0 and rak1, respectively obtains Col-0 total protein and rak1 total protein.
By the method for immuning hybridization, the polypeptide shown in 534-683 amino acids residue of the NIBS antibody center using sequence 1 is immune
The RAK1 specific antibody that rat obtains respectively detects Col-0 total protein and rak1 total protein, using TUBULIN as internal reference,
The antibody of TUBULIN is TUBULIN specific antibody (BIOCW Products).As a result as shown in figure 1 in B and Fig. 2 shown in F, as a result table
It is bright, the expression without RAK1 albumen in rak1.
2, turn the preparation of RAK1 gene arabidopsis
DNA between pCAMBIA1307 carrier B amHI and SalI recognition site is replaced with to the degeneration-resistant related egg of embodiment 1
White RAK1 gene (i.e. DNA molecular shown in sequence 2 in sequence table), other sequences are constant, obtain recombinant vector
PCAMBIA1307-RAK1, pCAMBIA1307-RAK1 express amino acid sequence are the protein of sequence 1 in sequence table.
Recombinant vector pCAMBIA1307-RAK1 is imported in Agrobacterium GV3101, recombinational agrobacterium is obtained.According to document
(Harry Klee, Robert Horsch, Stephen Rogers, Zhang Yi, exist in the Plant Transformation of mediated by agriculture bacillus and its future
Application in phytobiology, bioengineering progress, 05 phase in 1988) in method, by the recombinational agrobacterium to rak1 into
Row conversion, and T0 is obtained for the plant for turning RAK1 gene using hygromycin selection.The T0 is cultivated for the plant for turning RAK1 gene, and
T3 is obtained for the plant OE-1 and OE-2 for turning RAK1 gene.
The total protein for extracting OE-1 and OE-2 respectively, obtains OE-1 total protein and OE-2 total protein.With the Col-0 of step 1
Total protein and rak1 total protein are control, total to OE-1 respectively with the RAK1 specific antibody of step 1 by the method for immuning hybridization
Albumen and OE-2 total protein are detected, and using TUBULIN as internal reference, the antibody of TUBULIN is TUBULIN specific antibody (BIOCW
Products).As a result as shown in F in Fig. 2.The result shows that expressing albumen in OE-1 and OE-2 (containing MYC label, i.e., in figure
MYC-RAK1)。
3, the alkali resistance of OE-1 and OE-2 increases
Being transferred to pH value respectively after the OE-160 strain of step 2 is grown 6 days on common MS culture medium is respectively 4.8,5.8
With (20 plants of the MS culture medium of every kind of pH) on 8.2 MS culture medium, then in illumination box (intensity of illumination specifically: 80 μ
mol photons m-2s-1) middle culture 10 days, respectively obtain the OE-1 of the OE-1 and pH 8.2 of OE-1, pH 5.8 of pH 4.8.
According to the method described above, OE-1 is replaced with into wildtype Arabidopsis thaliana Col-0, OE-2 and rak1 respectively, other steps are equal
It is constant, respectively obtain OE-2, pH's 5.8 of Col-0, pH 4.8 of Col-0, pH 8.2 of Col-0, pH 5.8 of pH 4.8
The rak1 of rak1, pH 8.2 of rak1, pH 5.8 of OE-2, pH 4.8 of OE-2, pH 8.2.
Observe Col-0, pH's 5.8 of OE-1, pH 4.8 of OE-1, pH8.2 of OE-1, pH 5.8 of above-mentioned pH 4.8
Rak1, pH 5.8 of OE-2, pH 4.8 of OE-2, pH 8.2 of OE-2, pH 5.8 of Col-0, pH 4.8 of Col-0, pH8.2
Rak1, pH 8.2 RAK1 phenotype (A, B and C in Fig. 2), the results showed that, pH value be 4.8 and 5.8 MS culture medium on
The basic indifference of upgrowth situation between various arabidopsis；The growth conditions of OE-1 and OE-2 on the MS culture medium that pH value is 8.2
Significantly better than rak1 and Col-0, illustrate the resistance of reverse that arabidopsis can be improved to alkaline ph values in RAK1 gene.
Measure Col-0, pH 5.8 of Col-0, pH 8.2 of OE-1, pH 5.8 of OE-1, pH 8.2 of above-mentioned pH 5.8
OE-2, pH 8.2 OE-2, pH 5.8 rak1, pH 8.2 rak1 fresh weight and main root it is long (D and E and table 2 in Fig. 2).
Table 2, the fresh weight of transgenic arabidopsis and mutant and main root are long
The results show that the fresh weight and main root of various arabidopsis are long without significance difference on the MS culture medium that pH value is 5.8
It is different.On the MS culture medium that pH value is 8.2, the fresh weight and main root of OE-1 and OE-2 are long without equal significant difference.It is 8.2 in pH value
On MS culture medium, the fresh weight of OE-1 is 2.21 times of rak1, and difference reaches the level of signifiance；The fresh weight of OE-1 is the 1.07 of Col-0
Times；The fresh weight of OE-2 is 2.40 times of rak1, and difference reaches extremely significant level；The fresh weight of OE-2 is 1.16 times of Col-0, difference
Reach the level of signifiance.On the MS culture medium that pH value is 8.2,1.69 times of a length of rak1 of the main root of OE-1, difference reaches significant
It is horizontal；1.24 times of a length of Col-0 of the main root of OE-1, difference reaches the level of signifiance；1.85 times of a length of rak1 of the main root of OE-2,
Difference reaches the level of signifiance；1.36 times of a length of Col-0 of the main root of OE-2, difference reaches the level of signifiance.The result shows that RAK1 base
The alkali resistance of plant can be improved in albumen RAK1 of cause or its coding.
On the MS culture medium that pH value is 8.2, the fresh weight of rak1 is 0.48 times of Col-0, and difference reaches the level of signifiance；
0.73 times of a length of Col-0 of the main root of rak1, difference reaches the level of signifiance.The result shows that after RAK1 gene mutation plant it is resistance to
Alkalinity decline.
Claims (7)
1. application of the resistance relevant protein in regulation stress resistance of plant；The resistance relevant protein is following albumen a) or b)
Matter:
A) amino acid sequence is the protein of the 93-774 amino acids of sequence 1 in sequence table；
B) amino acid sequence is the protein of sequence 1 in sequence table；
The resistance is alkali resistance.
2. application of the biomaterial relevant to resistance relevant protein described in claim 1 in regulation stress resistance of plant；
The biomaterial relevant to resistance relevant protein described in claim 1 is following C1) any one of to C8):
C1 the nucleic acid molecules of resistance relevant protein described in claim 1) are encoded；
C2) contain C1) expression cassettes of the nucleic acid molecules；
C3) contain C1) recombinant vectors of the nucleic acid molecules；
C4) contain C2) recombinant vector of the expression cassette；
C5) contain C1) recombinant microorganisms of the nucleic acid molecules；
C6) contain C2) recombinant microorganism of the expression cassette；
C7) contain C3) recombinant microorganism of the recombinant vector；
C8) contain C4) recombinant microorganism of the recombinant vector；
The resistance is alkali resistance.
3. application according to claim 2, it is characterised in that: C1) nucleic acid molecules be it is following 1) or 2) shown in base
Cause:
1) nucleotide sequence is the cDNA molecule or DNA molecular of 277-2325 nucleotide of sequence 2 in sequence table；
4) nucleotide sequence is the cDNA molecule or DNA molecular of sequence 2 in sequence table.
4. application according to claim 1 or 2 or 3, it is characterised in that: the plant is monocotyledon or dicotyledonous plant
Object.
5. a kind of method for cultivating resistance genetically modified plants, including degeneration-resistant phase described in claim 1 is imported into recipient plant
The encoding gene for closing albumen obtains the step of resistance is higher than the resistance genetically modified plants of the recipient plant；The resistance
For alkali resistance.
6. according to the method described in claim 5, it is characterized by: the encoding gene of resistance relevant protein described in claim 1
Coded sequence be sequence 2 in sequence table DNA molecular.
7. method according to claim 5 or 6, it is characterised in that: the plant is monocotyledon or dicotyledon.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510003844.6A CN105820220B (en) | 2015-01-06 | 2015-01-06 | The application of resistance relevant protein and its encoding gene in regulation plant alkali resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510003844.6A CN105820220B (en) | 2015-01-06 | 2015-01-06 | The application of resistance relevant protein and its encoding gene in regulation plant alkali resistance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105820220A CN105820220A (en) | 2016-08-03 |
| CN105820220B true CN105820220B (en) | 2019-04-30 |
Family
ID=56513622
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510003844.6A Active CN105820220B (en) | 2015-01-06 | 2015-01-06 | The application of resistance relevant protein and its encoding gene in regulation plant alkali resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105820220B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107936099B (en) * | 2017-11-17 | 2020-04-14 | 中国科学院植物研究所 | LHAP1 protein and application of encoding gene thereof in regulation and control of plant photosynthesis |
| CN110746498B (en) * | 2018-07-04 | 2021-07-27 | 中国农业科学院作物科学研究所 | Application of plant stress tolerance-related protein TaANTL7A.2 in regulation and control of plant stress tolerance |
| CN112724219B (en) * | 2021-02-01 | 2022-09-06 | 内蒙古大学 | Transgenic salt-tolerant poplar with overexpression Siberian nitraria high-affinity potassium ion transporter gene |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004035798A2 (en) * | 2002-10-18 | 2004-04-29 | Cropdesign N.V. | Identification of e2f target genes and uses thereof |
| CN104004077A (en) * | 2014-06-04 | 2014-08-27 | 东北农业大学 | Plant adverse resistance related protein as well as encoding gene GsMSRB2 and application thereof |
-
2015
- 2015-01-06 CN CN201510003844.6A patent/CN105820220B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004035798A2 (en) * | 2002-10-18 | 2004-04-29 | Cropdesign N.V. | Identification of e2f target genes and uses thereof |
| CN104004077A (en) * | 2014-06-04 | 2014-08-27 | 东北农业大学 | Plant adverse resistance related protein as well as encoding gene GsMSRB2 and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| ACCESSION NP_194867;GenPept;《GenPept》;20140122;全文 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105820220A (en) | 2016-08-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105037521B (en) | A kind of and plant adversity resistance related protein TaWrky48 and its encoding gene and application | |
| CN105753953B (en) | Disease-resistant wheat albumen and encoding gene and its application in regulation disease resistance of plant | |
| CN107459565B (en) | Application of soybean drought-resistant related protein in regulation of soybean drought resistance | |
| CN106188257B (en) | The application of soybean transcription factor GmbZIP336 and its encoding gene in regulation seed grain weight | |
| CN105061569B (en) | A kind of and relevant SiMYB107 albumen of stress resistance of plant and its relevant biological material and application | |
| CN105820220B (en) | The application of resistance relevant protein and its encoding gene in regulation plant alkali resistance | |
| CN105111295B (en) | The breeding method and its relevant biological material for turning WMYB-R DNA triticums of anti-root rot and banded sclerotial blight | |
| CN112457380A (en) | Protein for regulating and controlling content of fruit shape and/or fruit juice of plant, related biological material and application thereof | |
| CN109971766A (en) | A kind of and plant stress tolerance-associated protein PwRBP1 and its encoding gene and application | |
| CN105713079B (en) | Protein and its relevant biological material are improving the application in plant products | |
| CN105985417B (en) | Application of the growth associated protein GRP2 in regulating plant growth | |
| CN106047833B (en) | The application of OsCIPK31 and its encoding gene in regulation plant herbicide resistance | |
| CN105585623B (en) | The disease-resistant breeding method for turning TaMYB-KW DNA triticum and relevant biological material and application | |
| CN106367433B (en) | Plant is improved to the method and its application of gibberellin inhibitor sensitiveness | |
| CN105218650B (en) | A kind of and plant adversity resistance related protein Prp1 and its encoding gene and application | |
| CN105504031B (en) | From the grain weight GAP-associated protein GAP and its relevant biological material of soybean and application | |
| CN107663230A (en) | Application of the cold-resistant GAP-associated protein GAP in plant cold tolerance is regulated and controled | |
| CN105985419B (en) | Application of the growth associated protein GRP1 in regulating plant growth | |
| CN105985418B (en) | Application of the growth associated protein GRP4 in regulating plant growth | |
| CN110218247A (en) | Two kinds of interactions between protein collaborations of PwRBP1 and PwNAC1 improve plant stress tolerance and its application | |
| CN104744579B (en) | Applications of the resistance relevant protein GmL16 in regulating and controlling stress resistance of plant | |
| CN105669847B (en) | Application of the soybean protein GmVPS9a1 in regulation plant storage protein sorting | |
| CN105693834B (en) | Application of the soybean protein GmVPS9a2 in regulation plant storage protein sorting | |
| CN107739403B (en) | Protein related to plant flowering phase and coding gene and application thereof | |
| CN106674339A (en) | Application of protein to regulation and control of plant adverse resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |