CN105985419B - Application of the growth associated protein GRP1 in regulating plant growth - Google Patents
Application of the growth associated protein GRP1 in regulating plant growth Download PDFInfo
- Publication number
- CN105985419B CN105985419B CN201510050281.6A CN201510050281A CN105985419B CN 105985419 B CN105985419 B CN 105985419B CN 201510050281 A CN201510050281 A CN 201510050281A CN 105985419 B CN105985419 B CN 105985419B
- Authority
- CN
- China
- Prior art keywords
- plant
- gene
- growth
- sequence
- grp1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses application of the growth associated protein GRP1 in regulating plant growth.Growth associated protein GRP1 provided by the present invention is a) or b): a) amino acid sequence is the protein of sequence 1 in sequence table;B) protein with same protein function for obtaining the amino acid sequence of sequence 1 in sequence table by the substitution and/or deletion and/or addition of one or several amino acid residues.It is demonstrated experimentally that growth associated protein GRP1 and its encoding gene can promote nutrient growth and the reproductive growth of plant, it can use the nutrient growth of growth associated protein GRP1 and its encoding gene regulation plant and reproductive growth or cultivate genetically modified plants.
Description
Technical field
The present invention relates to application of the growth associated protein GRP1 in regulating plant growth in field of biotechnology.
Background technique
Lodging problem and photoperiodical reaction sensitivity are always to perplex the main problem of high-yield plant stable yields.Lodging occurs planting
Underproduction rate can be higher when the reproductive growth of object.Different latitude introduce a fine variety can because the variation of the duration of day leads to blooming for plant in section
Phase, maturity period are advanced or delayed, and will cause the yield decline of plant.Therefore, there is an urgent need to use molecular breeding means, pass through
The introducing of foreign gene or to the interior genetic manipulation in gene, the plant type and photoperiodical reaction sensibility of orientation adjustment plant add
Fast breeding process resistant to lodging and Wide-adaptive plant.
Summary of the invention
The technical problem to be solved by the present invention is to how promote the growth of plant.
In order to solve the above technical problems, present invention firstly provides growth associated proteins answering in regulating plant growth
With.
Growth associated protein provided by the present invention in regulating plant growth application in, the growth associated protein
Entitled GRP1, for a) or b):
A) amino acid sequence is the protein of sequence 1 in sequence table;
B) amino acid sequence of sequence 1 in sequence table is passed through to the substitution and/or missing of one or several amino acid residues
And/or the protein with same protein function that addition obtains.
Wherein, sequence 1 is made of 478 amino acid.
In order to make protein in a) convenient for purifying, can in sequence table the amino terminal of protein shown in sequence 1 or
Carboxyl terminal connects upper label as shown in Table 1.
The sequence of table 1, label
Label | Residue | Sequence |
Poly-Arg | 5-6 (usually 5) | RRRRR |
Poly-His | 2-10 (usually 6) | HHHHHH |
FLAG | 8 | DYKDDDDK |
Strep-tag II | 8 | WSHPQFEK |
c-myc | 10 | EQKLISEEDL |
It is above-mentioned b) in GRP1 can be artificial synthesized, can also first synthesize its encoding gene, then carry out biological expression and obtain.It is above-mentioned
B) encoding gene of the GRP1 in can be by will lack one or several amino acid in DNA sequence dna shown in sequence 2 in sequence table
The codon of residue, and/or the missense mutation of one or several base-pairs is carried out, and/or connect table at its 5 ' end and/or 3 ' ends
The coded sequence of label shown in 1 obtains.
For above-mentioned growth associated protein in the application in regulating plant growth, the plant can be monocotyledon or Shuangzi
Leaf plant.The dicotyledon can be crucifer, such as arabidopsis (Arabidopsis thaliana).
In order to solve the above technical problems, the present invention also provides biomaterials relevant to the GRP1 in regulation plant life
Application in length.
Biomaterial relevant to the GRP1 provided by the present invention is and described in the application in regulating plant growth
The relevant biomaterial of GRP1 is following A 1) any one of to A20):
A1 the nucleic acid molecules of the GRP1) are encoded;
A2) contain A1) expression cassettes of the nucleic acid molecules;
A3) contain A1) recombinant vectors of the nucleic acid molecules;
A4) contain A2) recombinant vector of the expression cassette;
A5) contain A1) recombinant microorganisms of the nucleic acid molecules;
A6) contain A2) recombinant microorganism of the expression cassette;
A7) contain A3) recombinant microorganism of the recombinant vector;
A8) contain A4) recombinant microorganism of the recombinant vector;
A9) contain A1) the transgenic plant cells systems of the nucleic acid molecules;
A10) contain A2) the transgenic plant cells system of the expression cassette;
A11) contain A3) the transgenic plant cells system of the recombinant vector;
A12) contain A4) the transgenic plant cells system of the recombinant vector;
A13) contain A1) Transgenic plant tissues of the nucleic acid molecules;
A14) contain A2) Transgenic plant tissue of the expression cassette;
A15) contain A3) Transgenic plant tissue of the recombinant vector;
A16) contain A4) Transgenic plant tissue of the recombinant vector;
A17) contain A1) the genetically modified plants organs of the nucleic acid molecules;
A18) contain A2) the genetically modified plants organ of the expression cassette;
A19) contain A3) the genetically modified plants organ of the recombinant vector;
A20) contain A4) the genetically modified plants organ of the recombinant vector.
Above-mentioned biomaterial relevant to the GRP1 is in the application in regulating plant growth, A1) nucleic acid molecules
For following a1) or a2) or a3) shown in gene:
A1) nucleotide sequence is the cDNA molecule or DNA molecular of sequence 2 in sequence table;
A2 the nucleotide sequence) and a1) limited has 75% or 75% or more identity, and encoding amino acid sequence is sequence
The cDNA molecule or genomic DNA molecule of the protein of column 1;
A3) the nucleotide sequence hybridization limited under strict conditions with a1), and encoding amino acid sequence is the egg of sequence 1
The cDNA molecule or genomic DNA molecule of white matter.
Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA;The nucleic acid molecules can also
To be RNA, such as mRNA or hnRNA.
Wherein, sequence 2 is made of 1437 nucleotide, amino acid sequence shown in coded sequence 1.
Those of ordinary skill in the art can easily adopt by known method, such as the side of directed evolution and point mutation
Method is mutated the nucleotide sequence of coding GRP1 of the invention.Those have and separate with the present invention by manually modified
The nucleotide sequence 75% of obtained GRP1 or the nucleotide of higher identity, as long as encoding GRP1 and having the function of GRP1,
It is derived from nucleotide sequence of the invention and to be equal to sequence of the invention.
Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair
Amino acid sequence shown in bright coded sequence 1 composition protein nucleotide sequence have 75% or higher or 85% or
Higher or 90% or higher or 95% or higher identity nucleotide sequence.Identity can with the naked eye or computer software
It is evaluated.Using computer software, identity between two or more sequences can be indicated with percentage (%), can be with
For evaluating the identity between correlated series.
The above-mentioned biomaterial with the GRP1 is in the application in regulating plant growth, the stringent condition be 2 ×
In the solution of SSC, 0.1%SDS, hybridizes at 68 DEG C and wash film 2 times, each 5min, and in 0.5 × SSC, 0.1%SDS's is molten
In liquid, hybridizes at 68 DEG C and wash film 2 times, each 15min;Or, the solution of 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS
In, hybridize under the conditions of 65 DEG C and washes film.
Above-mentioned 75% or 75% or more identity can be 80%, 85%, 90% or 95% or more identity.
The above-mentioned biomaterial with the GRP1 is in the application in regulating plant growth, B2) described in contain coding
The expression cassette (GRP1 expression casette) of the nucleic acid molecules of GRP1 is the DNA for referring to express GRP1 in host cell, should
DNA not only may include the promoter for starting GRP1 genetic transcription, may also include the terminator for terminating GRP1 genetic transcription.Into one
Step, the expression cassette may also include enhancer sequence.Promoter for use in the present invention includes but is not limited to: composing type starting
Son is organized, the promoter and inducible promoter that organ and development are special.The example of promoter includes but is not limited to: cauliflower
The constitutive promoter 35S: the wound-inducible promoter from tomato of mosaic virus, leucine aminopeptidase (" LAP ",
Chao et al. (1999) Plant Physiol 120:979-992);Chemical inducible promoter from tobacco, pathogenesis
1 (PR1) of correlation (is induced) by salicylic acid and BTH (diazosulfide -7- carbothioic acid S-methyl ester);Tomato protease inhibitors
II promoter (PIN2) or LAP promoter (available methyl jasmonate induction);Heat-shock promoters (United States Patent (USP) 5,187,
267);Tetracycline inducible promoter (United States Patent (USP) 5,057,422);Seed specific promoters, such as Millet Seed specificity
Promoter pF128 (CN101063139B (Chinese patent 200710099169.7)), the special promoter of seed storage protein matter
(for example, promoter (Beachy et al. (1985) of phaseolin, napin, oleosin and soybean beta conglycin
EMBO is J.4:3047-3053)).They can be used alone or are used in combination with other plant promoters.Institute cited herein
There is bibliography to be cited in full text.Suitable transcription terminator includes but is not limited to: Agrobacterium nopaline syntase terminator
(NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and kermes ammonia
Sour and octopine synthase terminator (see, e.g.: Odell et al. (I985)Nature 313:810;Rosenberg et al.
(1987)Gene,56:125;Guerineau et al. (1991) Mol.Gen.Genet, 262:141;Proudfoot(1991)
Cell,64:671;Sanfacon et al. Genes Dev., 5:141;Mogen et al. (1990) Plant Cell, 2:1261;
Munroe et al. (1990) Gene, 91:151;Ballad et al. (1989) Nucleic Acids Res.17:7891;Joshi etc.
People (1987) Nucleic Acid Res., 15:9627).
The recombinant vector of the GRP1 expression casette can be contained with existing expression vector establishment.The plant expression carries
Body includes double base agrobacterium vector and the carrier etc. that can be used for plant micropellet bombardment.As pAHC25, pBin438,
PCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or
PCAMBIA1391-Xb (CAMBIA company) etc..The plant expression vector also may include 3 ' end non-translational regions of foreign gene
Domain, i.e., comprising polyadenylation signals and any other DNA fragmentation for participating in mRNA processing or gene expression.The polyadenylic acid letter
Number bootable polyadenylic acid is added to 3 ' ends of mRNA precursor, as Agrobacterium crown gall nodule induces (Ti) plasmid gene (such as nopaline
Synthase gene Nos), plant gene (such as soybean storage protein genes) 3 ' end transcription non-translational region all have similar functions.
When using gene constructed plant expression vector of the invention, enhancer, including translational enhancer or transcriptional enhancer also can be used,
These enhancer regions can be ATG initiation codon or neighboring region initiation codon etc., but must read with coded sequence
Frame is identical, to guarantee the correct translation of entire sequence.The source of the translation control signal and initiation codon be it is extensive,
Can be it is natural, be also possible to synthesis.Translation initiation region can come from transcription initiation region or structural gene.In order to just
In transgenic plant cells or plant are identified and screened, plant expression vector used can be processed, it can as being added
The coding expressed in plant can produce the enzyme of color change or gene (gus gene, luciferase genes of luminophor
Deng), the marker gene of antibiotic (if assigned the nptII gene to kanamycins and associated antibiotic resistance, assigns to herbicide
The bar gene of phosphinothricin resistance assigns the hph gene to antibiotic hygromycin resistance, and assigns to methotrexate resistance
Dhfr gene is assigned to the EPSPS gene of glyphosate) or (such as anti-herbicide base such as anti-chemical reagent marker gene
Cause), provide metabolism mannose ability mannose-6-phosphate isomerase gene.It, can not from the security consideration of genetically modified plants
Add any selected marker, transformed plant is directly screened with adverse circumstance.
In the above-mentioned application with the biomaterial of the GRP1 in regulating plant growth, the carrier can be plasmid, stick
Grain, bacteriophage or viral vectors.
The above-mentioned biomaterial with the GRP1 is in the application in regulating plant growth, the microorganism can for yeast,
Bacterium, algae or fungi, such as Agrobacterium.
In the above-mentioned application with the biomaterial of the GRP1 in regulating plant growth, the transgenic plant cells
System, Transgenic plant tissue and genetically modified plants organ do not include propagation material.
In an embodiment of the invention, the encoding gene (i.e. DNA molecular shown in sequence 2) of GRP1 is by containing
The recombinant vector of the expression cassette of the encoding gene of GRP1 imports in Agrobacterium tumefaciems GV3101.The recombinant vector is with sequence 2
Shown in DNA molecular replacement pTF101.1-GFP Xba I and Sac I identification sequence between the obtained recombinant vector of DNA fragmentation
GRP1 albumen shown in pTF101.1-GRP1, pTF101.1-GRP1 expressed sequence 1.The pTF101.1-GRP1 with
The difference of pTF101.1-GFP, which is only that, identifies that the DNA between sequence replaces with sequence for Xba I and the Sac I of pTF101.1-GFP
DNA molecular shown in 2.
In the above-mentioned application with the biomaterial of the GRP1 in regulating plant growth, the plant can be planted for unifacial leaf
Object or dicotyledon.The dicotyledon can be crucifer, such as arabidopsis (Arabidopsis thaliana).
In order to solve the above technical problems, the present invention also provides a kind of methods for cultivating the increased genetically modified plants of growth.
A kind of method for cultivating the increased genetically modified plants of growth provided by the present invention, including imported into recipient plant
The step of encoding gene of the GRP1 obtains genetically modified plants;The genetically modified plants grow increasing compared with the recipient plant
Add.
Above-mentioned cultivation is grown in the method for increased genetically modified plants, and the coded sequence of the encoding gene of the GRP1 is sequence
The DNA molecular of sequence 2 in list.
Above-mentioned cultivation is grown in the method for increased genetically modified plants, and the plant can be monocotyledon or dicotyledonous plant
Object.The dicotyledon can be crucifer, such as arabidopsis (Arabidopsis thaliana).
In an embodiment of the present invention, the encoding gene (i.e. DNA molecular shown in sequence 2) of the GRP1 is by containing
The GRP1 gene recombinant vectors of GRP1 expression casette import in purpose plant.
Above-mentioned cultivation is grown in the method for increased genetically modified plants, wherein the GRP1 gene can be repaired first as follows
Decorations, then import in receptor seed plant, to reach better expression effect:
1) it modifies and optimizes according to actual needs, so that gene efficient expression;For example, can be according to recipient plant institute partially
The codon of love, it is inclined to meet plant while keeping the amino acid sequence of GRP1 gene of the present invention to change its codon
Love property;In optimization process, it is desirable that certain G/C content is kept in the coded sequence after optimization, to be best implemented in plant
The high level expression of quiding gene, wherein G/C content can be 35%, be more than 45%, more than 50% or more than about 60%;
2) gene order of neighbouring initial methionine is modified, so that translation effectively starting;For example, using in plant
The effective sequence known is modified;
3) it is connect with the promoter of various plants expression, in favor of its expression in plant;The promoter may include
Composing type, induction type, timing adjusting, growth adjustment, Chemical Regulation, tissue are preferably and tissue-specific promoter;Promoter
Selection will need with expression time and space and be changed, and also depend on target kind;Such as the specificity of tissue or organ
Promoter is expressed, receptor as needed is depending on what period of development;Although demonstrating many from dicotyledon
Promoter can act in monocotyledon, and vice versa, but it is desirable to select dicot promoters are used
Expression in dicotyledon, monocotyledonous promoter is for the expression in monocotyledon;
4) it is connect with suitable transcription terminator, can also be improved the expression efficiency of gene of the present invention;Such as from
The tml of CaMV, from the E9 of rbcS;Any known available terminator to work in plant can be with the present invention
Gene is attached;
5) enhancer sequence is introduced, such as intron sequences (such as from Adhl and bronzel) and viral leader sequence
(such as from TMV, MCMV and AMV).
The GRP1 gene recombinant vectors can be by using Ti-plasmids, plant virus carrying agent, and directly delivered DNA is micro-
Injection, the standard biologics technical method such as electroporation import plant cell (Weissbach, 1998, Method for Plant
Molecular Biology VIII,Academy Press,New York,pp.411-463;Geiserson and Corey,
1998,Plant Molecular Biology(2nd Edition).)。
Above-mentioned cultivation is grown in the method for increased genetically modified plants, and the genetically modified plants are interpreted as not only including by institute
The first generation genetically modified plants that GRP1 genetic transformation purpose plant obtains are stated, also include its filial generation.It, can be with for genetically modified plants
The gene is bred in the species, it is also possible to which the gene transfer is entered other kinds of same species by traditional breeding techniques, special
It Bao Kuo not be in commercial variety.The genetically modified plants include seed, callus, intact plant and cell.
In order to solve the above technical problems, the present invention also provides the nucleic acid molecules overall length of GRP1 described in amplification coding or its pieces
The primer pair of section.
In order to solve the above technical problems, the present invention also provides the GRP1.
In order to solve the above technical problems, the present invention also provides the biomaterials.
It is described to grow concretely nutrient growth and/or reproductive growth in the present invention.The nutrient growth can be root system
Growth, the growth of stem, the growth of leaf and/or the growth of fruit pod.The growth of the root system specifically may be embodied in root long and/or lateral root
In quantity, the growth of the stem specifically be may be embodied in plant height, and the growth of fruit pod specifically may be embodied in the length of fruit pod.It is described
Plant is seed plant, and the reproductive growth may be embodied in the length of flowering time and/or fruit pod.
In one embodiment of the invention, the regulating plant growth is to promote arabidopsis growth.The plant growth
Increase is embodied in the increase of the plant plant height, the increase of the total root long of the plant, and/or the increasing of the plant lateral roots number
Add, the shortening of the flowering of plant time, the increase of the plant fruit pod length.
It is demonstrated experimentally that growth associated protein GRP1 of the invention and its encoding gene can promote the nutrient growth of plant: turning
The plant height of GRP1 gene plant is 5.53 times of recipient plant, and total root long is 3.78 times of recipient plant, and lateral root number is receptor
5.33 times of plant.Growth associated protein GRP1 of the invention and its encoding gene can promote the reproductive growth of plant: turn GRP1
The flowering time of gene plant is 0.79 times of recipient plant, and fruit pod length is 3.22 times of recipient plant.It is demonstrated experimentally that can be with
Turned using the nutrient growth of growth associated protein GRP1 of the invention and its encoding gene regulation plant and reproductive growth or cultivation
Gene plant.
Detailed description of the invention
Fig. 1 is recombinant vector pTF101.1-GRP1, pTF101.1-GRP2, pTF101.1-GRP3 and pTF101.1-GRP4
Schematic diagram.Wherein, figure A is recombinant vector pTF101.1-GRP1 schematic diagram, schemes B for recombinant vector pTF101.1-GRP2 signal
Figure, figure C are recombinant vector pTF101.1-GRP3 schematic diagram, and figure D is recombinant vector pTF101.1-GRP4 schematic diagram.
Fig. 2 is the qualification result of transgenic Arabidopsis plants at the genomic level.Wherein, figure A is to turn GRP1 gene to intend
The qualification result of GRP1 gene in southern mustard plant, swimming lane M are Direct-loadTM Star Marker Plus(D2000 Plus)
(M121) DNA molecular amount standard, swimming lane 1 are water, and swimming lane 2 is arabidopsis cpd, and swimming lane 3-5 is T3In generation, turns the quasi- south of GRP1 gene
Three strains of mustard plant;Figure B is the qualification result for turning GRP2 gene in GRP2 gene Arabidopsis plant, and swimming lane M is Direct-
loadTMThe DNA molecular amount standard of Star Marker Plus (D2000 Plus) (M121), swimming lane 1 are water, and swimming lane 2 is quasi- south
Mustard cpd, swimming lane 3 and 4 are T3In generation, turns two strains of GRP2 gene transgenic plant;Figure C is to turn GRP3 gene Arabidopsis plant
The qualification result of middle GRP3 gene, swimming lane M are Direct-loadTMStar Marker Plus's (D2000 Plus) (M121)
DNA molecular amount standard, swimming lane 1 are water, and swimming lane 2 is arabidopsis cpd, and swimming lane 3-5 is T3In generation, turns GRP3 gene Arabidopsis plant
Three strains;Figure D is the qualification result for turning GRP4 gene in GRP4 gene Arabidopsis plant, and swimming lane M is Direct-loadTM
The DNA molecular amount standard of Star Marker Plus (D2000 Plus) (M121), swimming lane 1 are water, and swimming lane 2 is arabidopsis cpd,
Swimming lane 3-5 is T3In generation, turns three strains of GRP4 gene Arabidopsis plant.
Fig. 3 is the expression that the target gene in transgenic Arabidopsis plants is identified using semiquantitive PCR.Wherein, figure A is to turn
The detection of expression of GRP1 gene is as a result, swimming lane from left to right is followed successively by water in GRP1 gene Arabidopsis plant, arabidopsis cpd,
T3In generation, turns GRP1 gene Arabidopsis plant;Figure B be turn GRP2 gene in GRP2 gene Arabidopsis plant detection of expression as a result, from
The swimming lane of left-to-right is followed successively by water, arabidopsis cpd, T3In generation, turns GRP2 gene Arabidopsis plant;Figure C is to turn GRP3 gene arabidopsis
The detection of expression of GRP3 gene is as a result, swimming lane from left to right is followed successively by water, arabidopsis cpd, T in plant3In generation, turns GRP3 gene
Arabidopsis plant;Figure D be turn GRP4 gene in GRP4 gene Arabidopsis plant detection of expression as a result, swimming lane from left to right according to
Secondary is water, arabidopsis cpd, T3In generation, turns GRP4 gene Arabidopsis plant.
Fig. 4 is the Phenotypic examination result of transgenic Arabidopsis plants.Wherein, A is the table for turning GRP1 gene Arabidopsis plant
Type, B are the phenotype for turning GRP2 gene Arabidopsis plant, and C is the phenotype for turning GRP3 gene Arabidopsis plant, and D is to turn GRP4 gene
The phenotype of Arabidopsis plant.
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.Experimental method in following embodiments is unless otherwise specified
Conventional method.The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Carrier pTF101.1 in following embodiments is the present of the laboratory Iowa State University, U.S. Wang Kan, (Margie
M.Paz,Juan Carlos Martinezm,Andrea B.Kalvig,Tina M.Fonger,Kan Wang.(2006)
Improved cotyledonary node method using an alternative explant derived from
mature seed for efficient Agrobacterium-mediated soybean transformation.Plant
Cell Reports.Plant Cell Reports 25:206-213), the public can grind from Chinese Academy of Agricultural Sciences's crop science
Study carefully institute (i.e. applicant) acquisition, which only attaches most importance to used in the related experiment of duplicate invention, and not can be used as other purposes makes
With.
In following embodiments arabidopsis cpd mutant (Szekeres M, Nemeth K, KonczKalman Z,
Mathur J,Kauschmann A,et al.(1996)Brassinosteroids rescue the deficiency of
CYP90,a cytochrome P450,controlling cell elongation and de-etiolation in
Arabidopsis.Cell 85:171-182.) public can obtain from Institute of Crop Science, Chinese Academy of Agricultural Science (i.e. applicant)
, which only attaches most importance to used in the related experiment of duplicate invention, not can be used as other purposes and uses.Arabidopsis cpd mutation
Body hereinafter referred to as arabidopsis cpd.
Embodiment 1 cultivates the increased transgenic Arabidopsis plants of growth using growth associated protein gene
Present embodiments provide four from soybean Williams 82 (Haun, W.J., Hyten, D.L., Xu, W.W.,
Gerhardt,D.J.,Albert,T.J.,Richmond,T.,Jeddeloh,J.A.,Jia,G.F.,Springer,N.M.,
Vance,C.P.&Stupar,R.M.(2011).The Composition and Origins of Genomic Variation
among Individuals of the Soybean Reference Cultivar Williams 82.Plant
Physiology 155,645-655. national genebank number: I2A12645, Unified number: WDD00587) growth correlation egg
White gene, be respectively growth associated protein GRP1 gene, growth associated protein GRP2 gene, growth associated protein GRP3 gene and
Growth associated protein GRP4 gene.
DNA molecular (i.e. growth associated protein GRP1 gene, abbreviation GRP1 gene) shown in sequence 2 in sequence table is prepared,
Protein shown in DNA molecular coded sequence 1 shown in sequence 2 (i.e. growth associated protein GRP1, abbreviation GRP1 albumen).
DNA molecular (i.e. growth associated protein GRP2 gene, abbreviation GRP2 gene) shown in sequence 4 in sequence table is prepared,
Protein shown in DNA molecular coded sequence 3 shown in sequence 4 (i.e. growth associated protein GRP2, abbreviation GRP2 albumen).
DNA molecular (i.e. growth associated protein GRP3 gene, abbreviation GRP3 gene) shown in sequence 6 in sequence table is prepared,
Protein shown in DNA molecular coded sequence 5 shown in sequence 6 (i.e. growth associated protein GRP3, abbreviation GRP3 albumen).
DNA molecular (i.e. growth associated protein GRP4 gene, abbreviation GRP4 gene) shown in sequence 8 in sequence table is prepared,
Protein shown in DNA molecular coded sequence 7 shown in sequence 8 (i.e. growth associated protein GRP4, abbreviation GRP4 albumen).
1, the building of recombinant vector and recombinational agrobacterium
The preparation of carrier pTF101.1-GFP: Hind III and the EcoR I of carrier pTF101.1 is identified into the piece between sequence
Section replaces with DNA molecular shown in sequence 9 (i.e. GFP expression cassette) and obtains recombinant vector pTF101.1-GFP, pTF101.1-GFP
It is only that with the difference of pTF101.1 and Hind III and the EcoR I of pTF101.1 is identified that the DNA between sequence replaces with sequence 9
Shown in DNA molecular.In GFP expression cassette shown in sequence 9,25-859 nucleotide of sequence 9 are the sequence of 35S promoter
Column, 880-1596 nucleotide of sequence 9 are the sequence of GFP gene, and 1640-1894 nucleotide of sequence 9 are NOS whole
Only sub sequence.
Xba I and the Sac I of pTF101.1-GFP is identified that the segment between sequence replaces with GRP1 gene (i.e. 2 institute of sequence
The DNA molecular shown) it obtains recombinant vector pTF101.1-GRP1 (A in Fig. 1), shown in pTF101.1-GRP1 expressed sequence 1
The difference of GRP1 albumen, pTF101.1-GRP1 and pTF101.1-GFP are only that Xba I and the Sac I of pTF101.1-GFP
DNA between identification sequence replaces with DNA molecular shown in sequence 2.Recombinant vector pTF101.1-GRP1 is imported into Agrobacterium tumefaciems
In GV3101 (Tiangeng biochemical technology Co., Ltd product), the recombinational agrobacterium containing recombinant vector pTF101.1-GRP1 is obtained
GV3101/pTF101.1-GRP1。
Xba I and the Sac I of pTF101.1-GFP is identified that the segment between sequence replaces with GRP2 gene (i.e. 4 institute of sequence
The DNA molecular shown) it obtains recombinant vector pTF101.1-GRP2 (B in Fig. 1), shown in pTF101.1-GRP2 expressed sequence 3
The difference of GRP2 albumen, pTF101.1-GRP2 and pTF101.1-GFP are only that Xba I and the Sac I of pTF101.1-GFP
DNA between identification sequence replaces with DNA molecular shown in sequence 4.Recombinant vector pTF101.1-GRP2 is imported into Agrobacterium tumefaciems
In GV3101, the recombinational agrobacterium GV3101/pTF101.1-GRP2 containing recombinant vector pTF101.1-GRP2 is obtained.
Xba I and the Sac I of pTF101.1-GFP is identified that the segment between sequence replaces with GRP3 gene (i.e. 6 institute of sequence
The DNA molecular shown) it obtains recombinant vector pTF101.1-GRP3 (C in Fig. 1), shown in pTF101.1-GRP3 expressed sequence 5
The difference of GRP3 albumen, pTF101.1-GRP3 and pTF101.1-GFP are only that Xba I and the Sac I of pTF101.1-GFP
DNA between identification sequence replaces with DNA molecular shown in sequence 6.Recombinant vector pTF101.1-GRP3 is imported into Agrobacterium tumefaciems
In GV3101, the recombinational agrobacterium GV3101/pTF101.1-GRP3 containing recombinant vector pTF101.1-GRP3 is obtained.
Xba I and the Sac I of pTF101.1-GFP is identified that the segment between sequence replaces with GRP4 gene (i.e. 8 institute of sequence
The DNA molecular shown) it obtains recombinant vector pTF101.1-GRP4 (D in Fig. 1), shown in pTF101.1-GRP4 expressed sequence 7
The difference of GRP4 albumen, pTF101.1-GRP4 and pTF101.1-GFP are only that Xba I and the Sac I of pTF101.1-GFP
DNA between identification sequence replaces with DNA molecular shown in sequence 8.Recombinant vector pTF101.1-GRP4 is imported into Agrobacterium tumefaciems
In GV3101, the recombinational agrobacterium GV3101/pTF101.1-GRP4 containing recombinant vector pTF101.1-GRP4 is obtained.
2, the building of transgenic arabidopsis
The recombinational agrobacterium GV3101/pTF101.1-GRP1 of step 1 is inoculated in the LB culture medium containing antibiotic (should
Spectinomycin, kanamycins, chloramphenicol and rifampin are added into LB culture medium and obtains for LB culture medium containing antibiotic
Fluid nutrient medium, wherein the concentration of spectinomycin is 50mg/L, and the concentration of kanamycins is 50mg/L, and the concentration of chloramphenicol is
25mg/L, the concentration of rifampin are 20mg/L) on, 250rpm shaken cultivation is to OD at 28 DEG C600Value is 0.6-0.8, collects bacterium
Liquid is placed in centrifuge tube, and 5min is centrifuged under 5000rpm and collects thallus, thallus is resuspended with MS fluid nutrient medium, obtains
GV3101/pTF101.1-GRP1 suspension, the OD of GV3101/pTF101.1-GRP1 suspension600Value about 0.6, to
Silwet L-77 is added in GV3101/pTF101.1-GRP1 suspension, and (Beijing Five continents member industry science and trade Products, article No. are
SL77080596), GV3101/pTF101.1-GRP1 infected liquid is obtained.
Using being stained with colored dip method (Clough SJ, Bent AF (1998) Floral dip:a simplified method
for Agrobacterium-mediated transformation of Arabidopsis thaliana.Plant
Journal 16:735-743.) use GV3101/pTF101.1-GRP1 infected liquid arabidopsis thaliana transformation cpd to harvest T1In generation, turns GRP1 base
Because of seed.By T1Generation turns GRP1 gene seed, and in the MS culture medium containing Bastar (Japanese Mingzhi company), (Bastar is cultivated in MS
Concentration in base obtains T to be screened on 10mg/L)1In generation, turns GRP1 gene Arabidopsis thaliana Seedlings.By T1It is quasi- that in generation, turns GRP1 gene
Southern mustard seedling is cultivated in the long-day phjytotron that temperature is 22 DEG C, the photoperiod is 16h illumination and 8h dark, obtains
T2In generation, turns GRP1 gene arabidopsis seed.By T2In generation, turns GRP1 gene arabidopsis seed and is containing Bastar (Japanese Mingzhi company)
It is screened on MS culture medium (Bastar is 10mg/L in the concentration in MS culture medium), obtains T2In generation, turns GRP1 gene arabidopsis
Seedling.By T2In generation, turns GRP1 gene Arabidopsis thaliana Seedlings in the long-day people that temperature is 22 DEG C, the photoperiod is 16h illumination and 8h dark
It is cultivated in work climatic chamber, obtains T3In generation, turns GRP1 gene arabidopsis seed.
According to the method described above, above-mentioned recombinational agrobacterium GV3101/pTF101.1-GRP1 is replaced with into recombinational agrobacterium respectively
GV3101/pTF101.1-GRP2, recombinational agrobacterium GV3101/pTF101.1-GRP3 and recombinational agrobacterium GV3101/
PTF101.1-GRP4, other steps are constant, respectively obtain T3In generation, turns GRP2 gene arabidopsis seed, T3It is quasi- that in generation, turns GRP3 gene
Southern canola seed and T3In generation, turns GRP4 gene arabidopsis seed.
By T3In generation, turns GRP1 gene arabidopsis seed, T3In generation, turns GRP2 gene arabidopsis seed, T3In generation, turns the quasi- south of GRP3 gene
Canola seed, T3In generation, turns GRP4 gene arabidopsis seed and arabidopsis cpd seed is seeded into compost, is 22 DEG C, light in temperature
Period to be cultivated in the long-day phjytotron of 16h illumination and 8h dark, respectively obtains T3In generation, turns the quasi- south of GRP1 gene
Mustard plant, T3In generation, turns GRP2 gene Arabidopsis plant, T3In generation, turns GRP3 gene Arabidopsis plant, T3In generation, turns GRP4 gene arabidopsis
Plant and arabidopsis cpd plant.
3, the identification of transgenic arabidopsis
3.1, transgenic Arabidopsis plants of authentication step 2 at the genomic level, the specific method is as follows:
It is control, the T of difference authentication step 2 with the arabidopsis cpd plant of step 2 and water3In generation, turns GRP1 gene arabidopsis
3 strains (1-1,1-2 and 1-3), the T of plant3In generation, turns 2 strains of GRP2 gene Arabidopsis plant (2-1 and 2-2), T3In generation, turns
3 strains (3-1,3-2 and 3-3) of GRP3 gene Arabidopsis plant and T3Generation turn 3 strains of GRP4 gene Arabidopsis plant (4-1,
4-2 and 4-3).Identify T3In generation, turns the primer pair of GRP1 gene Arabidopsis plant are as follows: ATGGCATCTTTCATCATCATACCAC and
TCATGGCGATTTACTTAGTCTGGAC.Identify T3In generation, turns the primer pair of GRP2 gene Arabidopsis plant are as follows:
ATGGCATCTTTCATCTTCACACCTG and TCATGGCGATTTACTTAGTTTGGAC.Identify T3In generation, turns GRP3 gene arabidopsis
The primer pair of plant are as follows: ATGGCTTCTTTGCCAGCTTTGCCAA and CTAGTCTCTACGCTGCACAATAATT.Identify T3Generation
Turn the primer pair of GRP4 gene Arabidopsis plant are as follows: ATGGCTTCTTTGCCAACACTTCTCT and
CTAATGTCTACGCTGCACAATAATA。
Experimental result is shown in Fig. 2, the results showed that, the T of step 23The PCR that generation turns three strains of GRP1 gene Arabidopsis plant is produced
Having size in object is the purpose band (A swimming lane 3,4 and 5 in Fig. 2) of 1437bp, and without purpose band, (A swims in Fig. 2 in compareing
Road 1 and 2), illustrates the T of step 23In generation, turns to contain GRP1 gene in GRP1 gene Arabidopsis plant;The T of step 23In generation, turns GRP2
Having size in two strain PCR products of gene Arabidopsis plant is the purpose band (B swimming lane 3 and 4 in Fig. 2) of 1440bp,
And illustrate the T of step 2 without purpose band (B swimming lane 1 and 2 in Fig. 2) in compareing3In generation, turns to contain in GRP2 gene Arabidopsis plant
There is GRP2 gene;The T of step 23It is 1425bp that generation, which turns to have size in three strain PCR products of GRP3 gene Arabidopsis plant,
Purpose band (C swimming lane 3,4 and 5 in Fig. 2), and compare in without purpose band (C swimming lane 1 and 2 in Fig. 2), illustrate the T of step 23
In generation, turns to contain GRP3 gene in GRP3 gene Arabidopsis plant;The T of step 23In generation, turns three of GRP4 gene Arabidopsis plant
Having size in strain PCR product is the purpose band (D swimming lane 3,4 and 5 in Fig. 2) of 1419bp, and without purpose band in compareing
(D swimming lane 1 and 2 in Fig. 2), illustrates the T of step 23In generation, turns to contain GRP4 gene in GRP4 gene Arabidopsis plant.
3.2, the expression of the target gene in the transgenic Arabidopsis plants of semiquantitive PCR authentication step 2, specific side are utilized
Method is as follows:
It is control, the T of difference authentication step 2 with the arabidopsis cpd plant of step 2 and water3In generation, turns GRP1 gene arabidopsis
Plant strains 1-1, T3In generation, turns GRP2 gene Arabidopsis plant strain 2-1, T3Generation turn GRP3 gene Arabidopsis plant strain 3-1 and
T3In generation, turns the expression of target gene in GRP4 gene Arabidopsis plant strain 4-1, and internal reference is the ACTIN2 of arabidopsis, and internal reference draws
Object is actctcccgctatgtatgtcgc and agaaaccctcgtagattggcac.Identify T3In generation, turns the plant of GRP1 gene arabidopsis
The primer pair of strain are as follows: GCATCTTTCATCATCATACCACTCC and CAACAAAGGGGAGTCCGAGC.Identify T3In generation, turns GRP2 base
Because of the primer pair of Arabidopsis plant are as follows: ATGGCATCTTTCATCTTCACACCTG and CGAAGGGGAGCCCGAGTGTAC.Identification
T3In generation, turns the primer pair of GRP3 gene Arabidopsis plant are as follows: ATGGCTTCTTTGCCAGCTTTGC and
CGGCGGAGGAAGAGGAGGAG.Identify T3In generation, turns the primer pair of GRP4 gene Arabidopsis plant are as follows:
ATGGCTTCTTTGCCAACACTTCTCT and GAACACGCGGCGGAGGTATAAG.
Experimental result is shown in Fig. 3, the results showed that, the T of step 23The PCR that generation turns GRP1 gene Arabidopsis plant strain 1-1 is produced
Contain purpose band (an A swimming lane left side 3 in Fig. 3) in object, and illustrates to walk without purpose band (an A swimming lane left side 1 and a left side 2 in Fig. 3) in compareing
Rapid 2 T3In generation, turns the expression for having GRP1 gene in GRP1 gene Arabidopsis plant strain 1-1;The T of step 23It is quasi- that in generation, turns GRP2 gene
Contain purpose band (a B swimming lane left side 3 in Fig. 3) in the PCR product of southern mustard plant strains 2-1, and without purpose band (Fig. 3 in compareing
2) a middle B swimming lane left side 1 and a left side, illustrate the T of step 23In generation, turns the table for having GRP2 gene in GRP2 gene Arabidopsis plant strain 2-1
It reaches;The T of step 23For in the PCR product for turning GRP3 gene Arabidopsis plant strain 3-1, containing purpose band, (C swimming lane is left in Fig. 3
3), and without purpose band (a C swimming lane left side 1 and a left side 2 in Fig. 3) in compareing, illustrate the T of step 23In generation, turns GRP3 gene Arabidopsis plant
There is the expression of GRP3 gene in strain 3-1;The T of step 23In generation, turns to contain in the PCR product of GRP4 gene Arabidopsis plant strain 4-1
Have on purpose band (a D swimming lane left side 3 in Fig. 3), and illustrates step 2 without purpose band (a D swimming lane left side 1 and a left side 2 in Fig. 3) in compareing
T3In generation, turns the expression for having GRP4 gene in GRP4 gene Arabidopsis plant strain 4-1.
4, the Phenotypic examination of transgenic arabidopsis
In triplicate, duplicate every time specific step is as follows for experiment:
By the T of step 23In generation, turns the seeds of GRP1 gene three strains of arabidopsis and is seeded into compost, each strain with
Machine chooses 20 plants of Arabidopsis plants for growing to 13 days, is counted to obtain to the total root long and lateral root number of each Arabidopsis plant
T3In generation, turns the total root long and lateral root number statistical result of GRP1 gene arabidopsis.
According to the method described above, by T3In generation, turns three strains of GRP1 gene arabidopsis and replaces with T3In generation, turns GRP2 gene arabidopsis
Two strains, T3In generation, turns GRP3 gene arabidopsis three strains, T3In generation, turns three strains of GRP4 gene arabidopsis and arabidopsis cpd,
Other steps are constant, respectively obtain T3In generation, turns the total root long and lateral root number statistical result, T of GRP2 gene arabidopsis3In generation, turns
The total root long and lateral root number statistical result, T of GRP3 gene arabidopsis3In generation, turns the total root long and lateral root number of GRP4 gene arabidopsis
The total root long and lateral root number statistical result of mesh statistical result and arabidopsis cpd.
By the T of step 23In generation, turns the seeds of GRP1 gene three strains of arabidopsis and is seeded into compost, each strain with
Machine chooses 20 plants of Arabidopsis plants for growing to 55 days, and plant height and fruit pod length to each Arabidopsis plant are counted to obtain T3
In generation, turns the plant height and fruit pod length statistical result of GRP1 gene arabidopsis, while to each Arabidopsis plant from sprouting just flower
Number of days (i.e. flowering time) is also counted to obtain T3In generation, turns the flowering time of GRP1 gene arabidopsis.
According to the method described above, by T3In generation, turns three strains of GRP1 gene arabidopsis and replaces with T3In generation, turns GRP2 gene arabidopsis
Two strains, T3In generation, turns GRP3 gene arabidopsis three strains, T3In generation, turns three strains of GRP4 gene arabidopsis and arabidopsis cpd,
Other steps are constant, respectively obtain T3In generation, turns the plant height of GRP2 gene arabidopsis, the statistics knot of fruit pod length and flowering time
Fruit, T3In generation, turns the plant height of GRP3 gene arabidopsis, the statistical result of fruit pod length and flowering time, T3In generation, turns the quasi- south of GRP4 gene
The system of the plant height of mustard, the plant height of the statistical result of fruit pod length and flowering time and arabidopsis cpd, fruit pod length and flowering time
Count result.
T3In generation, turns GRP1 gene Arabidopsis plant strain 1-1, T3In generation, turns GRP2 gene Arabidopsis plant strain 2-1, T3Generation
Turn GRP3 gene Arabidopsis plant strain 3-1, T3In generation, turns GRP4 gene Arabidopsis plant strain 4-1 and arabidopsis cpd plant
Phenotype is as shown in Figure 4.T3In generation, turns GRP1 gene Arabidopsis plant, T3In generation, turns GRP2 gene Arabidopsis plant, T3In generation, turns GRP3 gene
Arabidopsis plant, T3In generation, turns the plant height of GRP4 gene Arabidopsis plant and arabidopsis cpd plant, total root long, lateral root number, blooms
Time and fruit pod length are as shown in table 2.
The phenotype of table 2, transgenic arabidopsis
Plant height (cm) | Total root long (cm) | Lateral root number (a) | Flowering time (day) | Fruit pod length (cm) | |
Turn GRP1 gene plant | 10.39±3.21 | 1.70±0.39 | 16±4 | 38±2 | 0.74±0.19 |
Turn GRP2 gene plant | 15.15±3.26 | 1.43±0.29 | 9±4 | 34±2 | 0.93±0.10 |
Turn GRP3 gene plant | 16.33±4.00 | 1.20±0.16 | 7±2 | 33±2 | 0.94±0.11 |
Turn GRP4 gene plant | 10.30±6.73 | 1.61±0.26 | 12±5 | 35±2 | 0.93±0.10 |
Arabidopsis cpd | 1.88±0.77 | 0.45±0.12 | 3±2 | 48±1 | 0.23±0.05 |
The result shows that growth associated protein GRP1, GRP2, GRP3 and GRP4 and its corresponding encoding gene can promote to intend
The nutrient growth of southern mustard: the plant height for turning GRP1 gene Arabidopsis plant is 5.53 times of arabidopsis cpd, and total root long is arabidopsis
3.78 times of cpd, lateral root number are 5.33 times of arabidopsis cpd;The plant height for turning GRP2 gene Arabidopsis plant is arabidopsis cpd
8.09 times, total root long is 3.18 times of arabidopsis cpd, and lateral root number is 3 times of arabidopsis cpd;Turn GRP3 gene arabidopsis
The plant height of plant is 8.69 times of arabidopsis cpd, and total root long is 2.67 times of arabidopsis cpd, and lateral root number is arabidopsis cpd's
2.33 again;The plant height for turning GRP4 gene Arabidopsis plant is 5.48 times of arabidopsis cpd, and total root long is the 3.58 of arabidopsis cpd
Times, lateral root number is 4.00 times of arabidopsis cpd.
Growth associated protein GRP1, GRP2, GRP3 and GRP4 and its corresponding encoding gene can promote the life of arabidopsis
Reproductive growth: the flowering time for turning GRP1 gene Arabidopsis plant is 0.79 times of arabidopsis cpd, and fruit pod length is arabidopsis cpd
3.22 times;The flowering time for turning GRP2 gene Arabidopsis plant is 0.71 times of arabidopsis cpd, and fruit pod length is arabidopsis
4.04 times of cpd;The flowering time for turning GRP3 gene Arabidopsis plant is 0.69 times of arabidopsis cpd, and fruit pod length is quasi-
4.09 times of southern mustard cpd;The flowering time for turning GRP4 gene Arabidopsis plant is 0.73 times of arabidopsis cpd, fruit pod length
It is 4.04 times of arabidopsis cpd.
It is demonstrated experimentally that growth associated protein GRP1, GRP2, GRP3 and GRP4 and its corresponding encoding gene can promote to plant
The nutrient growth of object and reproductive growth can use growth associated protein GRP1, GRP2, GRP3 and GRP4 and its corresponding coding
The nutrient growth of gene regulation plant and reproductive growth cultivate genetically modified plants.
Claims (7)
1. application of the growth associated protein GRP1 in regulating plant growth;The amino acid sequence of the growth associated protein GRP1
As shown in sequence 1 in sequence table;
It is described to be grown to nutrient growth and/or reproductive growth.
2. application of the biomaterial relevant to growth associated protein GRP1 described in claim 1 in regulating plant growth;
The biomaterial relevant to growth associated protein GRP1 described in claim 1 is following A 1) any into A8)
Kind:
A1 the nucleic acid molecules of growth associated protein GRP1 described in claim 1) are encoded;
A2) contain A1) expression cassettes of the nucleic acid molecules;
A3) contain A1) recombinant vectors of the nucleic acid molecules;
A4) contain A2) recombinant vector of the expression cassette;
A5) contain A1) recombinant microorganisms of the nucleic acid molecules;
A6) contain A2) recombinant microorganism of the expression cassette;
A7) contain A3) recombinant microorganism of the recombinant vector;
A8) contain A4) recombinant microorganism of the recombinant vector;
It is described to be grown to nutrient growth and/or reproductive growth.
3. application according to claim 2, it is characterised in that: A1) the nucleotide sequence such as sequence tables of the nucleic acid molecules
Shown in middle sequence 2.
4. application according to claim 1 to 3, it is characterised in that: the plant is monocotyledon or dicotyledonous plant
Object.
5. a kind of cultivate the method for growing increased genetically modified plants, including imports life described in claim 1 into recipient plant
The step of encoding gene of long correlation Protein G RP1 obtains genetically modified plants;The genetically modified plants are compared with the recipient plant
Growth increases;The amino acid sequence of the growth associated protein GRP1 is as shown in sequence 1 in sequence table;It is described to be grown to nutrition life
Long and/or reproductive growth.
6. according to the method described in claim 5, it is characterized by: the coding of growth associated protein GRP1 described in claim 1
The coded sequence of gene is the DNA molecular of sequence 2 in sequence table.
7. method according to claim 5 or 6, it is characterised in that: the plant is monocotyledon or dicotyledon.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510050281.6A CN105985419B (en) | 2015-01-30 | 2015-01-30 | Application of the growth associated protein GRP1 in regulating plant growth |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510050281.6A CN105985419B (en) | 2015-01-30 | 2015-01-30 | Application of the growth associated protein GRP1 in regulating plant growth |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105985419A CN105985419A (en) | 2016-10-05 |
CN105985419B true CN105985419B (en) | 2019-08-30 |
Family
ID=57036948
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510050281.6A Active CN105985419B (en) | 2015-01-30 | 2015-01-30 | Application of the growth associated protein GRP1 in regulating plant growth |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105985419B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106046132B (en) * | 2016-06-30 | 2019-10-18 | 中国农业科学院作物科学研究所 | Rice RPS3a gene and its application for encoding albumen |
CN109354618B (en) * | 2018-12-13 | 2020-09-15 | 中国农业科学院蔬菜花卉研究所 | Application of G protein alpha subunit in regulation and control of cucumber seed germination, seedling growth and plant low temperature resistance |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101365786A (en) * | 2005-12-01 | 2009-02-11 | 克罗普迪塞恩股份有限公司 | Plants having improved growth characteristics and methods for making the same |
CN103130885A (en) * | 2013-03-15 | 2013-06-05 | 中国农业大学 | Malus sieversii (Ledeb.) Roem-derived plant growth-related protein, and coding gene and application thereof |
CN103667314A (en) * | 2013-12-09 | 2014-03-26 | 中国科学院遗传与发育生物学研究所 | Protein OsMKK4 originated from rice and application of biomaterial related to protein OsMKK4 in regulation and control of size of plant seed |
CN103739686A (en) * | 2013-12-23 | 2014-04-23 | 中国农业科学院油料作物研究所 | Protein related to plant yield improvement and quality improvement, and encoding gene and application thereof |
-
2015
- 2015-01-30 CN CN201510050281.6A patent/CN105985419B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101365786A (en) * | 2005-12-01 | 2009-02-11 | 克罗普迪塞恩股份有限公司 | Plants having improved growth characteristics and methods for making the same |
CN103130885A (en) * | 2013-03-15 | 2013-06-05 | 中国农业大学 | Malus sieversii (Ledeb.) Roem-derived plant growth-related protein, and coding gene and application thereof |
CN103667314A (en) * | 2013-12-09 | 2014-03-26 | 中国科学院遗传与发育生物学研究所 | Protein OsMKK4 originated from rice and application of biomaterial related to protein OsMKK4 in regulation and control of size of plant seed |
CN103739686A (en) * | 2013-12-23 | 2014-04-23 | 中国农业科学院油料作物研究所 | Protein related to plant yield improvement and quality improvement, and encoding gene and application thereof |
Non-Patent Citations (1)
Title |
---|
PREDICTED: cytochrome P450 90A1-like [Glycine max];NCBI;《Genbank》;20140107;Accession No:XP_003545232 * |
Also Published As
Publication number | Publication date |
---|---|
CN105985419A (en) | 2016-10-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN105037521B (en) | A kind of and plant adversity resistance related protein TaWrky48 and its encoding gene and application | |
CN107299100B (en) | Plant constitutive expression promoter and application thereof | |
CN105753953B (en) | Disease-resistant wheat albumen and encoding gene and its application in regulation disease resistance of plant | |
CN107827964A (en) | A kind of transcription factor PwNAC2 related to plant stress tolerance and its encoding gene and application | |
CN106188257B (en) | The application of soybean transcription factor GmbZIP336 and its encoding gene in regulation seed grain weight | |
CN105985417B (en) | Application of the growth associated protein GRP2 in regulating plant growth | |
CN105061569B (en) | A kind of and relevant SiMYB107 albumen of stress resistance of plant and its relevant biological material and application | |
CN105218650B (en) | A kind of and plant adversity resistance related protein Prp1 and its encoding gene and application | |
CN105820220B (en) | The application of resistance relevant protein and its encoding gene in regulation plant alkali resistance | |
CN104744579B (en) | Applications of the resistance relevant protein GmL16 in regulating and controlling stress resistance of plant | |
CN106367433B (en) | Plant is improved to the method and its application of gibberellin inhibitor sensitiveness | |
CN106047833B (en) | The application of OsCIPK31 and its encoding gene in regulation plant herbicide resistance | |
CN105985419B (en) | Application of the growth associated protein GRP1 in regulating plant growth | |
CN105985418B (en) | Application of the growth associated protein GRP4 in regulating plant growth | |
CN107325161B (en) | Protein related to low-nitrogen stress and high-salt stress resistance as well as encoding gene and application thereof | |
CN105713079B (en) | Protein and its relevant biological material are improving the application in plant products | |
CN105585623B (en) | The disease-resistant breeding method for turning TaMYB-KW DNA triticum and relevant biological material and application | |
CN107602683A (en) | One from transcription factor ZmNLP4 of corn and application thereof | |
CN106279386B (en) | A kind of Rice Panicle grown on top development associated protein and its encoding gene and application | |
CN105504031B (en) | From the grain weight GAP-associated protein GAP and its relevant biological material of soybean and application | |
CN114805508B (en) | Rice heading stage gene DHD3 function and application | |
CN105566468B (en) | Plant fertility GAP-associated protein GAP and its application | |
CN110627887B (en) | Application of SlTLFP8 protein and related biological material thereof in regulation and control of tomato drought resistance | |
CN105985420B (en) | Application of the growth associated protein GRP3 in regulating plant growth | |
CN105693834B (en) | Application of the soybean protein GmVPS9a2 in regulation plant storage protein sorting |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |