CN105820220A - Stress resistance relevant protein and application of coding gene in regulating alkali resistance of plants - Google Patents
Stress resistance relevant protein and application of coding gene in regulating alkali resistance of plants Download PDFInfo
- Publication number
- CN105820220A CN105820220A CN201510003844.6A CN201510003844A CN105820220A CN 105820220 A CN105820220 A CN 105820220A CN 201510003844 A CN201510003844 A CN 201510003844A CN 105820220 A CN105820220 A CN 105820220A
- Authority
- CN
- China
- Prior art keywords
- sequence
- protein
- resistance
- rak1
- transgenic plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a stress resistance relevant protein and an application of a coding gene of the protein in regulating alkali resistance of plants. The stress resistance relevant protein provided by the invention is a protein as shown in the following a) or b) or c) or d): a) a protein with amino acid sequence being the 93-774th amino acid of the sequence 1 in the sequence table; b) a protein which is obtained after substitution and/or deletion and/or addition of one or more amino acid residues of the 93-774th amino acid of the sequence 1 in the sequence table and has the stress resistance relevant protein function; c) a protein with amino acid sequence being the sequence 1 in the sequence table; and d) a protein which is obtained after substitution and/or deletion and/or addition of one or more amino acid residues of the amino acid sequence of the sequence 1 in the sequence table and has the same protein function. It shows through experiments that the stress resistance relevant protein and its coding gene can be applied in cultivation of alkali resistant plants.
Description
Technical field
The present invention relates to resistance relevant protein and encoding gene application in regulation and control plant alkali resistance thereof in biological technical field.
Background technology
Alkaline stress is the key factor affecting crop yield in China's agricultural production.Reporting that current China exists the soil of salinization of soil and reaches 1,500,000,000 mu, and have a large amount of soil to deteriorate to be not suitable for the salt-soda soil of plant growth because farming is not good at every year, raising plant alkali resistance is significant to the grain security of China.
For plant, the growth promoter of plant roots can be impacted by pH environment；Alkaline stress meeting appreciable impact photosynthesis of plant speed, light respiration and alimentation etc., such as arabidopsis can cause Fv/Fm value to reduce under alkaline environment.The mutually coordinated interior environment with stable plant cell between intracellular each organelle, thus ensure that intracellular reaction is normally carried out.Same intracellular physiological activity also can affect the environment pH of root system.
Summary of the invention
The technical problem to be solved is how to improve the resistance of plant.
For solving above-mentioned technical problem, present invention firstly provides resistance relevant protein application in regulation and control stress resistance of plant.
In the resistance relevant protein provided by the present invention application in regulation and control stress resistance of plant, described resistance relevant protein, its entitled RAK1, is following protein a) or b) or c) or d):
A) protein of the 93-774 amino acids of sequence 1 during aminoacid sequence is sequence table；
B) protein with described resistance relevant protein function that the 93-774 amino acids of sequence in sequence table 1 is obtained through the replacement of one or several amino acid residue and/or disappearance and/or interpolation；
C) protein of sequence 1 during aminoacid sequence is sequence table；
D) protein with same protein function that the aminoacid sequence of sequence in sequence table 1 is obtained through the replacement of one or several amino acid residue and/or disappearance and/or interpolation.
In order to the protein in making a) is easy to purification, in sequence table, label as shown in table 1 can be connected by amino terminal or the carboxyl terminal of the protein shown in sequence 1.
Table 1, the sequence of label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (usually 5) | RRRRR |
| Poly-His | 2-10 (usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
Above-mentioned b) in RAK1 can synthetic, it is possible to first synthesize its encoding gene, then carry out biological expression and obtain.Above-mentioned b) in the encoding gene of RAK1 can be by the codon by lacking one or several amino acid residue in the DNA sequence shown in the 277-2325 position nucleotide of sequence in sequence table 2, and/or carry out the missense mutation of one or several base pair, and/or connect the coded sequence of the label shown in table 1 at its 5 ' end and/or 3 ' ends and obtain.
Above-mentioned d) in protein can synthetic, it is possible to first synthesize its encoding gene, then carry out biological expression and obtain.Above-mentioned d) in the encoding gene of protein can be by the codon by lacking one or several amino acid residue in the DNA sequence shown in sequence in sequence table 2, and/or carry out the missense mutation of one or several base pair, and/or connect the coded sequence of the label shown in table 1 at its 5 ' end and/or 3 ' ends and obtain.
Wherein, sequence 2 is made up of 2325 nucleotide, the aminoacid sequence shown in coded sequence 1.The RAK1 albumen shown in 93-774 amino acids of the 277-2325 position nucleotide coding sequence 1 of sequence 2；The MYC label shown in 1-92 amino acids of the 1-276 position nucleotide coding sequence 1 of sequence 2.
For solving above-mentioned technical problem, present invention also offers the biomaterial relevant to described RAK1 application in regulation and control stress resistance of plant.
In the biomaterial relevant for RAK1 provided by the present invention and described application in regulation and control stress resistance of plant, described and described biomaterial relevant for RAK1, for following C1) to C20) in any one:
C1) nucleic acid molecules of described RAK1 is encoded；
C2) containing C1) expression cassette of described nucleic acid molecules；
C3) containing C1) recombinant vector of described nucleic acid molecules；
C4) containing C2) recombinant vector of described expression cassette；
C5) containing C1) recombinant microorganism of described nucleic acid molecules；
C6) containing C2) recombinant microorganism of described expression cassette；
C7) containing C3) recombinant microorganism of described recombinant vector；
C8) containing C4) recombinant microorganism of described recombinant vector；
C9) containing C1) the transgenic plant cells system of described nucleic acid molecules；
C10) containing C2) the transgenic plant cells system of described expression cassette；
C11) containing C3) the transgenic plant cells system of described recombinant vector；
C12) containing C4) the transgenic plant cells system of described recombinant vector；
C13) containing C1) Transgenic plant tissue of described nucleic acid molecules；
C14) containing C2) Transgenic plant tissue of described expression cassette；
C15) containing C3) Transgenic plant tissue of described recombinant vector；
C16) containing C4) Transgenic plant tissue of described recombinant vector；
C17) containing C1) the transgenic plant organ of described nucleic acid molecules；
C18) containing C2) the transgenic plant organ of described expression cassette；
C19) containing C3) the transgenic plant organ of described recombinant vector；
C20) containing C4) the transgenic plant organ of described recombinant vector.
Wherein, described nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；Described nucleic acid molecules can also be RNA, such as mRNA or hnRNA etc..
In above-mentioned application, C1) described nucleic acid molecules is following 1) or 2) or 3) or 4) or 5) or 6) shown in gene:
1) the cDNA molecule of the 277-2325 position nucleotide of sequence 2 or DNA molecular during nucleotide sequence is sequence table；
2) with 1) nucleotide sequence that limits has 75% or more than 75% homogeneity, and encodes cDNA molecule or the genomic DNA molecule of described RAK1；
3) under strict conditions with 1) nucleotide sequence hybridization that limits, and encode cDNA molecule or the genomic DNA molecule of described RAK1；
4) the cDNA molecule of sequence 2 or DNA molecular during nucleotide sequence is sequence table；
5) with 4) nucleotide sequence that limits has 75% or more than 75% homogeneity, and the cDNA molecule of the protein that encoding amino acid sequence is sequence 1 or genomic DNA molecule；
6) under strict conditions with 4) nucleotide sequence hybridization that limits, and the cDNA molecule of the protein that encoding amino acid sequence is sequence 1 or genomic DNA molecule.
The method that those of ordinary skill in the art can use known method, such as orthogenesis and point mutation easily, the nucleotide sequence that the present invention encodes RAK1 suddenlys change.Those are through manually modified, there is the nucleotide sequence 75% with the RAK1 of isolated of the present invention or the nucleotide of higher homogeneity, as long as encoding RAK1 and there is RAK1 function, all it is derived from the nucleotide sequence of the present invention and is equal to the sequence of the present invention.
Term used herein " homogeneity " refers to the sequence similarity with native sequence nucleic acid." homogeneity " includes that the nucleotide sequence of the protein of the composition of the aminoacid sequence shown in 93-774 amino acids of the coded sequence 1 with the present invention has 75% or higher, or 85% or higher, or 90% or higher, or the nucleotide sequence of 95% or higher homogeneity.Homogeneity can with the naked eye or computer software is evaluated.Using computer software, the homogeneity between two or more sequences can use percentage ratio (%) to represent, it can be used to the homogeneity evaluating between correlated series.
In above-mentioned application, described stringent condition is at 2 × SSC, in the solution of 0.1%SDS, hybridizes and wash film 2 times at 68 DEG C, and each 5min, again in 0.5 × SSC, in the solution of 0.1%SDS, hybridizes at 68 DEG C and washes film 2 times, each 15min.
Above-mentioned 75% or more than 75% homogeneity, can be the homogeneity of 80%, 85%, 90% or more than 95%.
In above-mentioned application, the expression cassette (RAK1 expression casette) of the nucleic acid molecules containing coding RAK1 described in C2), refer to express the DNA of RAK1 in host cell, this DNA not only can include the promoter starting RAK1 genetic transcription, may also include the terminator terminating RAK1 genetic transcription.Further, described expression cassette may also include enhancer sequence.The promoter that can be used for the present invention includes but not limited to: constitutive promoter, the promoter that tissue, organ and growth are special, and inducible promoter.The example of promoter includes but not limited to: the constitutive promoter 35S of cauliflower mosaic virus: from the wound-inducible promoter of Fructus Lycopersici esculenti, leucine aminopeptidase (" LAP ", Chao et al. (1999) PlantPhysiol120:979-992)；From chemical inducible promoter of Nicotiana tabacum L., pathogeny is correlated with 1 (PR1) (being induced by salicylic acid and BTH (diazosulfide-7-carbothioic acid S-methyl ester))；Fructus Lycopersici esculenti protease inhibitor II promoter (PIN2) or LAP promoter (all can use methyl jasmonate to induce)；Heat-shock promoters (United States Patent (USP) 5,187,267)；Tetracycline inducible promoter (United States Patent (USP) 5,057,422)；Seed specific promoters, such as Millet Seed specificity promoter pF128 (CN101063139B (Chinese patent 200710099169.7)), the special promoter of seed storage protein matter is (such as, phaseollin., napin, the promoter (Beachy et al. (1985) EMBOJ.4:3047-3053) of oleosin and Semen sojae atricolor betaconglycin).They can be used alone or be used in combination with other plant promoter.All references cited herein all quotes in full.Suitably transcription terminator includes but not limited to: Agrobacterium nopaline syntase terminator (NOS terminator), cauliflower mosaic virus CaMV35S terminator, tml terminator, Semen Pisi sativi rbcSE9 terminator and nopaline and octopine synthase terminator (see, e.g.: Odell et al. (I985)Nature313:810；Rosenberg et al. (1987) Gene, 56:125；Guerineau et al. (1991) Mol.Gen.Genet, 262:141；Proudfoot(1991)Cell,64:671；Sanfacon et al. GenesDev., 5:141；Mogen et al. (1990) PlantCell, 2:1261；Munroe et al. (1990) Gene, 91:151；Ballad et al. (1989) NucleicAcidsRes.17:7891；Joshi et al. (1987) NucleicAcidRes., 15:9627).
Available existing expression vector establishment contains the recombinant vector of described RAK1 expression casette.Described plant expression vector includes double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA company) etc..Described plant expression vector also can comprise 3 ' end untranslated regions of exogenous gene, i.e. comprises polyadenylation signals and any other participates in mRNA processing or the DNA fragmentation of gene expression.The bootable polyadenylic acid of described polyadenylation signals joins 3 ' ends of mRNA precursor, and the untranslated region transcribed such as Agrobacterium crown gall nodule induction (Ti) plasmid gene (such as rouge alkali synthetase gene Nos), plant gene (such as soybean storage protein genes) 3 ' end is respectively provided with similar functions.When using the gene constructed plant expression vector of the present invention, it be also possible to use enhancer, including translational enhancer or transcriptional enhancer, these enhancer regions can be ATG initiation codon or neighboring region start codon etc., but must be identical with the reading frame of coded sequence, to ensure the correct translation of whole sequence.The source of described translation control signal and start codon is widely, can be natural, it is also possible to be synthesis.Translation initiation region can come from transcription initiation region or structural gene.For the ease of transgenic plant cells or plant being identified and screening, plant expression vector used can be processed, enzyme or the gene (gus gene of luminophor of color change can be produced as added the coding can expressed in plant, luciferase genes etc.), the marker gene of antibiotic is (as given the nptII gene to kanamycin and associated antibiotic resistance, give the bar gene to herbicide phosphinothricin resistance, give the hph gene to antibiotic hygromycin resistance, with the dhfr gene given methotrexate resistance, give EPSPS gene to glyphosate) or anti-chemical reagent marker gene etc. (such as anti-herbicide gene), the mannose-6-phosphate isomerase gene of metabolism mannose ability is provided.From the security consideration of transgenic plant, any selected marker can be not added with, directly screen transformed plant with adverse circumstance.
In above-mentioned application, described carrier can be plasmid, glutinous grain, phage or viral vector.
In above-mentioned application, described microorganism can be yeast, antibacterial, algae or fungus, such as Agrobacterium.
In above-mentioned application, described transgenic plant cells system, Transgenic plant tissue and transgenic plant organ the most do not include propagating materials.
In an embodiment of the invention, the encoding gene (i.e. DNA molecular shown in sequence 2) of RAK1 is imported in Agrobacterium GV3101 by the recombinant vector of the expression cassette of the encoding gene containing RAK1.Described recombinant vector is the recombinant vector pCAMBIA1307-RAK1 that the fragment between BamHI and the SalI recognition site replacing pCAMBIA1307 with the DNA molecular shown in sequence 2 obtains, and described pCAMBIA1307-RAK1 express amino acid sequence is the protein of sequence 1.
In above-mentioned application, described plant can be monocotyledon or dicotyledon.Described dicotyledon concretely crucifer.Described crucifer can be arabidopsis.
For solving above-mentioned technical problem, present invention also offers a kind of method cultivating resistance transgenic plant.
A kind of method cultivating resistance transgenic plant provided by the present invention, obtains the resistance step higher than the resistance transgenic plant of described recipient plant including the encoding gene importing described RAK1 in recipient plant.
In an embodiment of the present invention, the encoding gene (i.e. DNA molecular shown in sequence 2) of described RAK1 is imported in purpose plant by the RAK1 gene recombinant vectors containing RAK1 expression casette.
In said method, wherein said RAK1 gene can be modified the most as follows, then imports in receptor seed plant, to reach more preferable expression effect:
1) modify according to actual needs and optimize, so that gene efficient expression；Such as, the codon can being had a preference for according to recipient plant, while keeping the aminoacid sequence of RAK1 gene of the present invention, change its codon to meet plant-preference；During optimization, it is desirable that the coded sequence after optimization keeps certain G/C content, to be best implemented with the high level expression of quiding gene in plant, wherein G/C content can be 35%, more than 45%, more than 50% or more than about 60%；
2) gene order of neighbouring initial methionine is modified, so that translation is the most initial；Such as, known effective sequence in plant is utilized to modify；
3) promoter expressed with various plants is connected, and is beneficial to its expression in plant；Described promoter can include that the regulation of composing type, induction type, sequential, Growth adjustment, Chemical Regulation, tissue are preferably and tissue-specific promoter；The selection of promoter will change along with expression time and space requirement, and also depend on target kind；Such as tissue or the specific expressing promoter of organ, receptor is depending on what period grown as required；Although demonstrating and deriving from many promoteres of dicotyledon is operational in monocotyledon, vice versa, but it is desirable to select the expression that dicot promoters is in dicotyledon, the expression in monocotyledon of the monocotyledonous promoter；
4) it is connected with the transcription terminator being suitable for, it is also possible to improve the expression efficiency of gene of the present invention；Such as derive from the tml of CaMV, derive from the E9 of rbcS；Any known available terminator worked in plant can be attached with gene of the present invention；
5) enhancer sequence is introduced, such as intron sequences (such as deriving from Adhl and bronzel) and viral leader sequence (such as deriving from TMV, MCMV and AMV).
In one embodiment of the invention, the protein that recombinant vector pCAMBIA1307-RAK1, pCAMBIA1307-RAK1 express amino acid sequence is sequence 1 that the fragment that RAK1 gene recombinant vectors is specially between BamHI and the SalI recognition site replacing pCAMBIA1307 with the DNA molecular shown in sequence 2 obtains.
Described RAK1 gene recombinant vectors can be by using Ti-plasmids, plant virus carrying agent, directly delivered DNA, microinjection, the standard biologic technical method such as electroporation import plant cell (Weissbach, 1998, MethodforPlantMolecularBiologyVIII, AcademyPress, NewYork, pp.411-463；GeisersonandCorey,1998,PlantMolecularBiology(2ndEdition).).
In said method, the coded sequence of the encoding gene of described RAK1 can be sequence 2 in sequence table.
In said method, described plant can be monocotyledon or dicotyledon.Described dicotyledon concretely crucifer.Described crucifer can be arabidopsis.
In said method, described transgenic plant is interpreted as not only comprising the first generation transgenic plant obtained by described gene transformation purpose plant, also includes its filial generation.For transgenic plant, this gene can be bred in these species, it is also possible to this gene is transitioned into other kind of same species by traditional breeding method, in commercial variety.Described transgenic plant includes seed, callus, whole plant and cell.
For solving above-mentioned technical problem, present invention also offers the described biomaterial relevant to described RAK1.
For solving above-mentioned technical problem, present invention also offers described resistance relevant protein.
In the present invention, described resistance can be alkali resistance.The pH of described alkalescence can be more than 6.3.Described pH can be 6.3-8.2.Described pH concretely 8.2.
It is demonstrated experimentally that the resistance relevant protein of the present invention and encoding gene thereof can improve the alkali resistance of plant: in the MS culture medium that pH value is 8.2, the fresh weight of OE-1 is 2.21 times of rak1, and difference reaches pole significant level；The fresh weight of OE-1 is 1.07 times of Col-0；The fresh weight of OE-2 is 2.40 times of rak1, and difference reaches pole significant level；The fresh weight of OE-2 is 1.16 times of Col-0, and difference reaches significant level.In the MS culture medium that pH value is 8.2,1.69 times of a length of rak1-of main root of OE-1, difference reaches significant level；1.24 times of a length of Col-0 of main root of OE-1, difference reaches significant level；1.85 times of a length of rak1 of main root of OE-2, difference reaches significant level；1.36 times of a length of Col-0 of main root of OE-2, difference reaches significant level.It is demonstrated experimentally that the albumen RAK1 of RAK1 gene or its coding can improve the alkali resistance of plant, can be used to the plant being applied to cultivate alkali resistance.
Accompanying drawing explanation
Fig. 1 is the expression of RAK1 gene in semiquantitive PCR detection rak1 mutant.Wherein, A is the expression of semiquantitive PCR detection RAK1 gene；B is that the method for immuning hybridization detects the expression of RAK1 albumen in rak1 mutant.
Fig. 2 is the upgrowth situation of Col-0, OE-1, OE-2, rak1, fresh weight and main root length and the expression of RAK1 albumen.Wherein, A be pH value be 4.8 MS culture medium on the upgrowth situation of Col-0, OE-1, OE-2, rak1；B be pH value be 5.8 MS culture medium on the upgrowth situation of Col-0, OE-1, OE-2, rak1；C be pH value be 8.2 MS culture medium on the upgrowth situation of Col-0, OE-1, OE-2, rak1；D be pH value be 4.8,5.8 and 8.2 MS culture medium on the fresh weight of Col-0, OE-1, OE-2, rak1；E be pH value be 4.8,5.8 and 8.2 MS culture medium on the main root of Col-0, OE-1, OE-2, rak1 long；F is the expression of RAK1 albumen in Col-0, OE-1, OE-2, rak1.
Detailed description of the invention
Being further described in detail the present invention below in conjunction with detailed description of the invention, the embodiment be given is only for illustrating the present invention rather than in order to limit the scope of the present invention.
Experimental technique in following embodiment, if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
PCAMBIA1307 carrier in following embodiment is Biovector product, and article No. is Biovector-168625.
Wildtype Arabidopsis thaliana Col-0 in following embodiment is SALKInstitute product.
Embodiment 1, the preparation of resistance relevant protein RAK1 gene
The DNA molecular (i.e. resistance relevant protein RAK1 gene) shown in the nucleotide of 277-2325 position of sequence 2 in composition sequence table.Wherein the 277-2325 position nucleotide coding aminoacid sequence of sequence 2 is the RAK1 albumen (i.e. resistance relevant protein RAK1) shown in 93-774 amino acids of sequence 1 in sequence table；The MYC label shown in 1-92 amino acids of the 1-276 position nucleotide coding sequence 1 of sequence 2.
Embodiment 2, RAK1 gene improve the alkali resistance of plant
1, the qualification of the mutant of RAK1 gene
The mutant Salk_057147 of RAK1 gene is bought, by its named rak1 from ABRC (OhioStateUniversity).With primer, ATGGAGTCAATCCACTGCAATAGT (forward primer) and TCATCTGTCGGATAATACTGAGT (reverse primer) carried out to Col-0 and RAK1 respectively semiquantitive PCR (Fig. 1), internal reference be the primer of ACTIN, ACTIN be GGTCGTACTACTGGTATTGTGCT and TGACAATTTCACGCTCAGCT.Result shows, without the expression of RAK1 gene in rak1.
Extract the total protein of wildtype Arabidopsis thaliana Col-0 and rak1, respectively obtain Col-0 total protein and rak1 total protein.By the method for immuning hybridization, Col-0 total protein and rak1 total protein are detected by RAK1 specific antibody respectively that utilize the polypeptide immune rat shown in the 534-683 amino acids residue of sequence 1 to obtain with NIBS antibody center, with TUBULIN as internal reference, the antibody of TUBULIN is TUBULIN specific antibody (BIOCW Products).Result is as shown in F in B and Fig. 2 in Fig. 1, and result shows, without the expression of RAK1 albumen in rak1.
2, the preparation of RAK1 gene arabidopsis is turned
DNA between pCAMBIA1307 carrier B amHI and SalI recognition site is replaced with the resistance relevant protein RAK1 gene (i.e. DNA molecular shown in sequence 2 in sequence table) of embodiment 1, other sequences are the most constant, obtaining recombinant vector pCAMBIA1307-RAK1, pCAMBIA1307-RAK1 express amino acid sequence is the protein of sequence 1 in sequence table.
Recombinant vector pCAMBIA1307-RAK1 is imported in Agrobacterium GV3101, obtains recombinational agrobacterium.According to document (HarryKlee, RobertHorsch, StephenRogers, Zhang Yi, agriculture bacillus mediated Plant Transformation and the in the future application in Plant Physiology, biological engineering is in progress, 05 phase in 1988) in method, by this recombinational agrobacterium, rak1 is converted, and utilize hygromycin selection to obtain T0 for the plant turning RAK1 gene.Cultivating this T0 generation turns the plant of RAK1 gene, and obtains T3 generation and turn plant OE-1 and OE-2 of RAK1 gene.
Extract the total protein of OE-1 and OE-2 respectively, obtain OE-1 total protein and OE-2 total protein.With the Col-0 total protein of step 1 and rak1 total protein for comparison, by the method for immuning hybridization, respectively OE-1 total protein and OE-2 total protein are detected with the RAK1 specific antibody of step 1, with TUBULIN as internal reference, the antibody of TUBULIN is TUBULIN specific antibody (BIOCW Products).Result is as shown in F in Fig. 2.Result shows, equal expressing protein (containing MYC-RAK1 in MYC label, i.e. figure) in OE-1 and OE-2.
3, the alkali resistance of OE-1 and OE-2 raises
Transferring to pH value after the OE-160 strain of step 2 being grown 6 days in common MS culture medium respectively be respectively in the MS culture medium of 4.8,5.8 and 8.2 (MS culture medium 20 strain of every kind of pH), the most all at illumination box, (intensity of illumination is particularly as follows: 80 μm olphotonsm-2s-1Cultivate 10 days in), respectively obtain the OE-1 of OE-1 and pH8.2 of OE-1, pH5.8 of pH4.8.
According to the method described above, respectively OE-1 is replaced with wildtype Arabidopsis thaliana Col-0, OE-2 and rak1, other steps are the most constant, respectively obtain the rak1 of rak1, pH8.2 of rak1, pH5.8 of OE-2, pH4.8 of OE-2, pH8.2 of OE-2, pH5.8 of Col-0, pH4.8 of Col-0, pH8.2 of Col-0, pH5.8 of pH4.8.
Observe the phenotype (A, B and C in Fig. 2) of the RAK1 of rak1, pH8.2 of rak1, pH5.8 of OE-2, pH4.8 of OE-2, pH8.2 of OE-2, pH5.8 of Col-0, pH4.8 of Col-0, pH8.2 of Col-0, pH5.8 of OE-1, pH4.8 of OE-1, pH8.2 of OE-1, pH5.8 of above-mentioned pH4.8, result shows, the basic zero difference of upgrowth situation between various arabidopsiss in the MS culture medium that pH value is 4.8 and 5.8；In the MS culture medium that pH value is 8.2, the growth conditions of OE-1 and OE-2 is significantly better than rak1 and Col-0, illustrates that RAK1 gene can improve the arabidopsis resistance of reverse to alkaline ph values.
Measure fresh weight and the main root length (D and E and table 2 in Fig. 2) of the rak1 of rak1, pH8.2 of OE-2, pH5.8 of OE-2, pH8.2 of Col-0, pH5.8 of Col-0, pH8.2 of OE-1, pH5.8 of OE-1, pH8.2 of above-mentioned pH5.8.
Fresh weight and the main root of table 2, transgenic arabidopsis and mutant are long
Result shows, in the MS culture medium that pH value is 5.8, the fresh weight of various arabidopsiss and main root length are all without significant difference.In the MS culture medium that pH value is 8.2, the fresh weight of OE-1 Yu OE-2 and main root length are without equal significant difference.In the MS culture medium that pH value is 8.2, the fresh weight of OE-1 is 2.21 times of rak1, and difference reaches significant level；The fresh weight of OE-1 is 1.07 times of Col-0；The fresh weight of OE-2 is 2.40 times of rak1, and difference reaches pole significant level；The fresh weight of OE-2 is 1.16 times of Col-0, and difference reaches significant level.In the MS culture medium that pH value is 8.2,1.69 times of a length of rak1 of main root of OE-1, difference reaches significant level；1.24 times of a length of Col-0 of main root of OE-1, difference reaches significant level；1.85 times of a length of rak1 of main root of OE-2, difference reaches significant level；1.36 times of a length of Col-0 of main root of OE-2, difference reaches significant level.Result shows, the albumen RAK1 of RAK1 gene or its coding can improve the alkali resistance of plant.
In the MS culture medium that pH value is 8.2, the fresh weight of rak1 is 0.48 times of Col-0, and difference reaches significant level；0.73 times of a length of Col-0 of main root of rak1, difference reaches significant level.Result shows, after RAK1 gene mutation, the alkali resistance of plant declines.
Claims (10)
1. resistance relevant protein application in regulation and control stress resistance of plant；Described resistance relevant protein is following protein a) or b) or c) or d):
A) protein of the 93-774 amino acids of sequence 1 during aminoacid sequence is sequence table；
B) protein with described resistance relevant protein function that the 93-774 amino acids of sequence in sequence table 1 is obtained through the replacement of one or several amino acid residue and/or disappearance and/or interpolation；
C) protein of sequence 1 during aminoacid sequence is sequence table；
D) protein with same protein function that the aminoacid sequence of sequence in sequence table 1 is obtained through the replacement of one or several amino acid residue and/or disappearance and/or interpolation.
2. the biomaterial relevant to resistance relevant protein described in claim 1 application in regulation and control stress resistance of plant；
The described biomaterial relevant to resistance relevant protein described in claim 1, for following C1) to C20) in any one:
C1) nucleic acid molecules of resistance relevant protein described in coding claim 1；
C2) containing C1) expression cassette of described nucleic acid molecules；
C3) containing C1) recombinant vector of described nucleic acid molecules；
C4) containing C2) recombinant vector of described expression cassette；
C5) containing C1) recombinant microorganism of described nucleic acid molecules；
C6) containing C2) recombinant microorganism of described expression cassette；
C7) containing C3) recombinant microorganism of described recombinant vector；
C8) containing C4) recombinant microorganism of described recombinant vector；
C9) containing C1) the transgenic plant cells system of described nucleic acid molecules；
C10) containing C2) the transgenic plant cells system of described expression cassette；
C11) containing C3) the transgenic plant cells system of described recombinant vector；
C12) containing C4) the transgenic plant cells system of described recombinant vector；
C13) containing C1) Transgenic plant tissue of described nucleic acid molecules；
C14) containing C2) Transgenic plant tissue of described expression cassette；
C15) containing C3) Transgenic plant tissue of described recombinant vector；
C16) containing C4) Transgenic plant tissue of described recombinant vector；
C17) containing C1) the transgenic plant organ of described nucleic acid molecules；
C18) containing C2) the transgenic plant organ of described expression cassette；
C19) containing C3) the transgenic plant organ of described recombinant vector；
C20) containing C4) the transgenic plant organ of described recombinant vector.
Application the most according to claim 2, it is characterised in that: C1) described nucleic acid molecules is following 1) or 2) or 3) or 4) or 5) or 6) shown in gene:
1) the cDNA molecule of the 277-2325 position nucleotide of sequence 2 or DNA molecular during nucleotide sequence is sequence table；
2) with 1) nucleotide sequence that limits has 75% or more than 75% homogeneity, and encodes cDNA molecule or the genomic DNA molecule of described RAK1；
3) under strict conditions with 1) nucleotide sequence hybridization that limits, and encode cDNA molecule or the genomic DNA molecule of described RAK1；
4) the cDNA molecule of sequence 2 or DNA molecular during nucleotide sequence is sequence table；
5) with 4) nucleotide sequence that limits has 75% or more than 75% homogeneity, and the cDNA molecule of the protein that encoding amino acid sequence is sequence 1 or genomic DNA molecule；
6) under strict conditions with 4) nucleotide sequence hybridization that limits, and the cDNA molecule of the protein that encoding amino acid sequence is sequence 1 or genomic DNA molecule.
4. according to the application described in claim 1 or 2 or 3, it is characterised in that: described plant is monocotyledon or dicotyledon.
5. the method cultivating resistance transgenic plant, obtains the resistance step higher than the resistance transgenic plant of described recipient plant including importing the encoding gene of resistance relevant protein described in claim 1 in recipient plant.
Method the most according to claim 5, it is characterised in that: the coded sequence of the encoding gene of resistance relevant protein described in claim 1 is the DNA molecular of sequence 2 in sequence table.
7. according to the method described in claim 5 or 6, it is characterised in that: described plant is monocotyledon or dicotyledon.
8. according to arbitrary described method in described application arbitrary in claim 1-4 or claim 5-7, it is characterised in that: described resistance is alkali resistance.
9. the resistance relevant protein described in claim 1.
10. the biomaterial described in Claims 2 or 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510003844.6A CN105820220B (en) | 2015-01-06 | 2015-01-06 | The application of resistance relevant protein and its encoding gene in regulation plant alkali resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510003844.6A CN105820220B (en) | 2015-01-06 | 2015-01-06 | The application of resistance relevant protein and its encoding gene in regulation plant alkali resistance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105820220A true CN105820220A (en) | 2016-08-03 |
| CN105820220B CN105820220B (en) | 2019-04-30 |
Family
ID=56513622
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510003844.6A Active CN105820220B (en) | 2015-01-06 | 2015-01-06 | The application of resistance relevant protein and its encoding gene in regulation plant alkali resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105820220B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107936099A (en) * | 2017-11-17 | 2018-04-20 | 中国科学院植物研究所 | The application of LHAP1 albumen and its encoding gene in photosynthesis of plant is regulated and controled |
| CN110746498A (en) * | 2018-07-04 | 2020-02-04 | 中国农业科学院作物科学研究所 | Application of plant stress tolerance-related protein TaANTL7A.2 in regulation and control of plant stress tolerance |
| CN112724219A (en) * | 2021-02-01 | 2021-04-30 | 内蒙古大学 | Transgenic salt-tolerant poplar with overexpression Siberian nitraria high-affinity potassium ion transporter gene |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004035798A2 (en) * | 2002-10-18 | 2004-04-29 | Cropdesign N.V. | Identification of e2f target genes and uses thereof |
| CN104004077A (en) * | 2014-06-04 | 2014-08-27 | 东北农业大学 | Plant adverse resistance related protein as well as encoding gene GsMSRB2 and application thereof |
-
2015
- 2015-01-06 CN CN201510003844.6A patent/CN105820220B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004035798A2 (en) * | 2002-10-18 | 2004-04-29 | Cropdesign N.V. | Identification of e2f target genes and uses thereof |
| CN104004077A (en) * | 2014-06-04 | 2014-08-27 | 东北农业大学 | Plant adverse resistance related protein as well as encoding gene GsMSRB2 and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| GENPEPT: "ACCESSION NP_194867", 《GENPEPT》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107936099A (en) * | 2017-11-17 | 2018-04-20 | 中国科学院植物研究所 | The application of LHAP1 albumen and its encoding gene in photosynthesis of plant is regulated and controled |
| CN107936099B (en) * | 2017-11-17 | 2020-04-14 | 中国科学院植物研究所 | LHAP1 protein and application of encoding gene thereof in regulation and control of plant photosynthesis |
| CN110746498A (en) * | 2018-07-04 | 2020-02-04 | 中国农业科学院作物科学研究所 | Application of plant stress tolerance-related protein TaANTL7A.2 in regulation and control of plant stress tolerance |
| CN112724219A (en) * | 2021-02-01 | 2021-04-30 | 内蒙古大学 | Transgenic salt-tolerant poplar with overexpression Siberian nitraria high-affinity potassium ion transporter gene |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105820220B (en) | 2019-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105037521B (en) | A kind of and plant adversity resistance related protein TaWrky48 and its encoding gene and application | |
| CN109705203B (en) | Protein related to plant type and coding gene and application thereof | |
| CN105859860A (en) | Application of disease resistance-related protein to regulation and control of plant disease resistance | |
| Yamchi et al. | Proline accumulation in transgenic tobacco as a result of expression of Arabidopsis Δ 1-pyrroline-5-carboxylate synthetase (P5CS) during osmotic stress | |
| CN107629121B (en) | Transcription factor ZmNLP9 from corn and application thereof | |
| CN110563827B (en) | Protein related to corn kernel yield and coding gene thereof | |
| CN112457380B (en) | Protein for regulating and controlling content of plant fruit shape and/or fruit juice, related biological material and application thereof | |
| CN105061569B (en) | A kind of and relevant SiMYB107 albumen of stress resistance of plant and its relevant biological material and application | |
| CN107602683B (en) | Transcription factor ZmNLP4 from corn and application thereof | |
| CN105820220A (en) | Stress resistance relevant protein and application of coding gene in regulating alkali resistance of plants | |
| CN105713079B (en) | Protein and its relevant biological material are improving the application in plant products | |
| CN106047833B (en) | The application of OsCIPK31 and its encoding gene in regulation plant herbicide resistance | |
| CN104829699A (en) | Plant adverse resistance associated protein Gshdz4 and coding gene and application thereof | |
| US20230313212A1 (en) | Plastid transformation by complementation of nuclear mutations | |
| CN110684089B (en) | Application of plant stress tolerance related protein GmMYB118 in regulation and control of plant stress tolerance | |
| CN105504031B (en) | From the grain weight GAP-associated protein GAP and its relevant biological material of soybean and application | |
| CN109811005A (en) | The application of plant type GAP-associated protein GAP OsSLA1 and its encoding gene in adjusting and controlling rice Leaf inclination | |
| CN104744579A (en) | Application of stress resistance related protein GmL16 in regulating stress resistance of plant | |
| CN106674339B (en) | Application of protein in regulating and controlling plant stress resistance | |
| CN110684114B (en) | Application of plant stress tolerance associated protein TaBAKL in regulation and control of plant stress tolerance | |
| CN105985418A (en) | Application of growth-related protein GRP4 in regulation of plant growth | |
| CN105985419A (en) | Application of growth-related protein GRP1 in regulation of plant growth | |
| CN114196644B (en) | Protein palmitoyl transferase DHHC16 and application thereof in improving salt tolerance of rice | |
| CN105001314A (en) | SiLNT2 protein relevant to plant low-nitrogen tolerance, relevant biological materials thereof and application thereof | |
| CN105669847A (en) | Application of soy protein GmVPS9a1 in regulation and control on plant storage protein sorting |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |