CN107936099A

CN107936099A - The application of LHAP1 albumen and its encoding gene in photosynthesis of plant is regulated and controled

Info

Publication number: CN107936099A
Application number: CN201711143127.9A
Authority: CN
Inventors: 张立新; 刘旖旎; 马今方
Original assignee: Institute of Botany of CAS
Current assignee: Institute of Botany of CAS
Priority date: 2017-11-17
Filing date: 2017-11-17
Publication date: 2018-04-20
Anticipated expiration: 2037-11-17
Also published as: CN107936099B

Abstract

The invention discloses the application of LHAP1 albumen and its encoding gene in photosynthesis of plant is regulated and controled.Present invention finds the transmembrane protein LHAP1 for being positioned at chloroplaset, and it was found that it is yellowish green that the deletion mutant plant (lhap1) of LHAP1 genes shows leaf color, and photosynthetic efficiency reduces.The present invention establishes regulating and controlling effects of the LHAP1 in plant catches photochromic fibroin LHCII transport processes, regulates and controls LHCII protein contents by transgenic approach using the gene in actual production by the separation to LHAP1 and the identification and analysis of gene function.

Description

The application of LHAP1 albumen and its encoding gene in photosynthesis of plant is regulated and controled

Technical field

The invention belongs to biological technical field, and in particular to LHAP1 albumen and its encoding gene are in regulation and control Plant Light cooperation Application in.

Background technology

In higher plant body, Light_harvesting chlorophyll_protein complex (LHC) is a kind of capture luminous energy, and energy is reached rapidly Reaction center causes photochemically reactive Pigment-protein Complexes.Although Photosystem I (LHCI) and spectrum in higher plant body System II (LHCII) contains respective Light_harvesting chlorophyll_protein complex, but since LHCII combinations account in photosynthetic membrane nearly 50% color Element and about 1/3 protein, physiological function it is complicated and easily largely extracted and by the concern of researcher.The component of LHCII is One class formation is similar, it is related to evolve, Pigment-protein Complexes man that is being formed by the albumen of karyogene (Lhcb) coding with pigment Race (LHCB).They in addition to carrying out the absorption and transmission of luminous energy, are maintaining the structure of thylakoid membrane, are adjusting in thylakoid membrane Section excitation can all play important during the distribution between two photosystems, light protection and adaptation to various environment etc. Effect.

Gene type according to its protein component is encoded has carried out the polypeptide fractions of LHCII the name compared with system. LHCII is mainly made of six kinds of Pigment-protein Complexes, they respectively by Lhcb1, Lchb2, Lhcb3, Lhcb4, Lhcb5 and The albumen of six kinds of genotype codes of Lhcb6 forms main body LHCII (LHCB1, LHCB2 and LHCB3) and micro LHCII with pigment (CP29, CP26 and CP24).The expression of LHCB albumen and transport chloroplaset process, influence excitation can two photosystems it Between distribution, the regulation and control of thylakoid membrane ultra microstructure, and all various aspects such as photophosphorylation, pigment and Protein reconstitution.Although In higher plant, LHCB albumen is current most study and structure relatively clearly a kind of protein family, but to its family The research of the function of each member and their correlation and factor of influence is not goed deep into still.Therefore research influences LHCB protein expressions And the regulatory factor of transhipment, and its regulatory mechanism is parsed, it is applied to improve or purposefully control LHCB protein contents, from And improving plant light energy conversion efficiency has certain production practices meaning.

The content of the invention

The technical problem to be solved in the present invention is how to regulate and control photosynthesis of plant.

In order to solve the above-mentioned technical problem, present invention firstly provides the new application of LHAP1 albumen；The LHAP1 albumen For application of following protein a) or b) or c) or d) in photosynthesis of plant is regulated and controled：

A) amino acid sequence is the protein shown in sequence 2；

B) fused protein obtained in N-terminal and/or C-terminal the connection label of the protein shown in sequence 2；

C) by the amino acid sequence shown in sequence 2 by one or several amino acid residues substitution and/or missing and/or Add the obtained protein with identical function；

D) with sequence 2 shown in homology of the amino acid sequence with 75% or more than 75% and the egg with identical function White matter.

In order to which the protein in making a) is easy to purifying, the amino terminal of protein that can be in sequence table shown in sequence 2 or The upper label as shown in Table 1 of carboxyl terminal connection.

The sequence of table 1, label

Label	Residue	Sequence
			Poly-Arg	5-6 (being usually 5)	RRRRR
Poly-His	2-10 (being usually 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

It is above-mentioned c) in protein, the substitution of one or several amino acid residues and/or missing and/or be added to not More than the substitution and/or missing and/or addition of 10 amino acid residues.

It is above-mentioned c) in protein can be artificial synthesized, also can first synthesize its encoding gene, then carry out biological expression and obtain.

It is above-mentioned c) in the encoding gene of protein can be one or several by will be lacked in the DNA sequence dna shown in sequence 1 The codon of amino acid residue, and/or the missense mutation of one or several base-pairs is carried out, and/or at its 5 ' end and/or 3 ' ends The coded sequence for connecting the label shown in table 1 obtains.

It is above-mentioned d) in, " homology " include with the present invention sequence 2 shown in amino acid sequence there is 75% or higher, or 80% or higher, or 85% or higher, or 90% or higher, or 95% or more high homology amino acid sequence.

The present invention provides application of the LHAP1 albumen in photosynthesis of plant is regulated and controled.

In order to solve the above-mentioned technical problem, present invention also offers the new application with the relevant biomaterial of LHAP1 albumen.

The present invention provides the application with the relevant biomaterial of LHAP1 albumen in photosynthesis of plant is regulated and controled.

Any of the biomaterial is following A 1) to A12)：

A1 the nucleic acid molecules of LHAP1 albumen) are encoded；

A2 A1) is contained) expression cassettes of the nucleic acid molecules；

A3 A1) is contained) recombinant vectors of the nucleic acid molecules；

A4 A2) is contained) recombinant vector of the expression cassette；

A5 A1) is contained) recombinant microorganisms of the nucleic acid molecules；

A6 A2) is contained) recombinant microorganism of the expression cassette；

A7 A3) is contained) recombinant microorganism of the recombinant vector；

A8 A4) is contained) recombinant microorganism of the recombinant vector；

A9 A1) is contained) the transgenic plant cells systems of the nucleic acid molecules；

A10 A2) is contained) the transgenic plant cells system of the expression cassette；

A11 A3) is contained) the transgenic plant cells system of the recombinant vector；

A12 A4) is contained) the transgenic plant cells system of the recombinant vector.

In above application, A1) nucleic acid molecules for it is following 1) or 2) or 3) shown in gene：

1) its coded sequence is the cDNA molecules or DNA molecular of sequence 1 in sequence table；

2) nucleotide sequence with 1) limiting has 75% or more than 75% homogeneity, and encodes LHAP1 protein CDNA molecules or genomic DNA molecule；

1) or 2) 3) and the cDNA molecules of LHAP1 albumen are encoded with the nucleotide sequence hybridization limited under strict conditions Or genomic DNA molecule.

Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules also may be used To be RNA, such as mRNA or hnRNA.

Those of ordinary skill in the art can easily use known method, such as the side of orthogenesis and point mutation Method, is mutated the nucleotide sequence of the coding LHAP1 protein of the present invention.Those are by manually modified, with coding The nucleotide sequence of LHAP1 protein has the nucleotide of 75% or higher homogeneity, as long as coding LHAP1 protein and tool There is identical function, be the nucleotide sequence derived from the present invention and be equal to the sequence of the present invention.

Term " homogeneity " used herein refers to the sequence similarity with native sequence nucleic acid." homogeneity " includes and this hair The nucleotide sequence of the protein of amino acid sequence composition shown in bright coded sequence 2 has 75% or a higher, or 85% or Higher, or 90% or higher, or 95% or higher homogeneity nucleotide sequence.Homogeneity can with the naked eye or computer software Evaluated.Using computer software, homogeneity between two or more sequences can use percentage (%) to represent, it can be with For evaluating the homogeneity between correlated series.

Above-mentioned 75% or more than 75% homogeneity, can be 80%, 85%, 90% or more than 95% homogeneity.

In above application, A2) described in the nucleic acid molecules containing coding LHAP1 protein expression cassette (LHAP1 gene tables Up to box), it is the DNA for referring to express LHAP1 protein in host cell, which not only may include to start LHAP1 transcriptions Promoter, may also include the terminator for terminating LHAP1 transcriptions.Further, the expression cassette may also include enhancer sequence.

The recombinant vector of the LHAP1 expression casettes can be contained with existing expression vector establishment.The plant expression Carrier includes double base agrobacterium vector and the carrier available for plant micropellet bombardment etc..As pAHC25, pBin438, PCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or PCAMBIA1391-Xb (CAMBIA companies) etc..The plant expression vector can also include 3 ' end non-translational regions of foreign gene Domain, i.e., comprising polyadenylation signals and the DNA fragmentation of any other participation mRNA processing or gene expression.The polyadenylic acid letter Number bootable polyadenylic acid is added to 3 ' ends of mRNA precursor, as Agrobacterium crown gall nodule induces (Ti) plasmid gene (such as nopaline Synthase gene Nos), plant gene (such as soybean storage protein genes) 3 ' end transcription non-translational region be respectively provided with similar functions. During using gene constructed plant expression vector of the invention, enhancer, including translational enhancer or transcriptional enhancer also can be used, These enhancer regions can be ATG initiation codon or neighboring region initiation codon etc., but must be read with coded sequence Frame is identical, to ensure the correct translation of whole sequence.The source of the translation control signal and initiation codon be it is extensive, It can be natural or synthesis.Translation initiation region can come from transcription initiation region or structural gene.In order to just In transgenic plant cells or plant are identified and screened, plant expression vector used can be processed, can as added The coding expressed in plant can produce the enzyme of color change or gene (gus gene, the luciferase genes of luminophor Deng), the marker gene of antibiotic (as assigned the nptII genes to kanamycins and associated antibiotic resistance, assigned to herbicide The bar genes of phosphinothricin resistance, assign the hph genes to antibiotic hygromycin resistance, and assign to methotrexate resistance Dhfr genes, assign the EPSPS genes to glyphosate) or (such as anti-herbicide base such as anti-chemical reagent marker gene Cause), provide metabolism mannose ability mannose-6-phosphate isomerase gene., can not from the security consideration of genetically modified plants Add any selected marker, transformed plant is directly screened with adverse circumstance.

In above application, the carrier can be plasmid, sticking grain, bacteriophage or viral vector.

In above application, the microorganism can be yeast, bacterium, algae or fungi, such as Agrobacterium.

In above application, the transgenic plant cells system does not include propagating materials.

In above application, the regulation and control photosynthesis of plant is embodied in 1) -4) in it is any：

1) photochromic fibroin LHCII contents are caught in regulation and control；

2) regulate and control or influence to catch the transhipment of photochromic fibroin LHCII；

3) regulate and control or influence to catch the accumulation of photochromic fibroin LHCII steady-state levels in chloroplaset；

4) interact with Tic110 albumen and/or Tic20 albumen and/or LTD albumen.

In above application, the regulation and control catch photochromic fibroin LHCII contents as regulation and control Lhcb5 albumen and/or Lhcb6 albumen Content.

It is described to be regulated to improve in above application.

Above-mentioned LHAP1 protein or above-mentioned relevant biological material are in the genetically modified plants that photochemical vitality improves are cultivated Application fall within protection scope of the present invention.

In order to solve the above-mentioned technical problem, present invention also offers a kind of transgenosis plant cultivated photochemical vitality and improved The method of thing.

The method provided by the invention for cultivating the genetically modified plants that photochemical vitality improves includes improving in recipient plant The expression quantity and/or activity of LHAP1 protein, the step of obtaining genetically modified plants；The photosynthesis of the genetically modified plants is lived Property is higher than the recipient plant.

In the above method, the photochemical vitality of the genetically modified plants is embodied in transgenosis higher than the recipient plant and plants The photochromic fibroin LHCII contents of catching of thing are higher than recipient plant；It is described catch photochromic fibroin LHCII for Lhcb5 albumen and/or Lhcb6 albumen.

In the above method, it is described improve recipient plant in LHAP1 protein expression quantity and/or activity method be by LHAP1 protein is overexpressed in body plant；The method of the overexpression is that the encoding gene of LHAP1 protein is imported acceptor to plant Thing；The nucleotide sequence of the encoding gene of the LHAP1 protein is the DNA molecular shown in sequence 1.

In a specific embodiment of the present invention, the encoding gene of the LHAP1 protein imports acceptor by recombinant vector In plant, the recombinant vector is the BamHI and KpnI that the DNA molecular shown in sequence in sequence table 1 is inserted into pSN1301 carriers Between restriction enzyme site, and keep the constant obtained carrier of other sequences of pSN1301 carriers.

In the above method, the genetically modified plants are interpreted as not only including and obtain the LHAP1 genetic transformation purpose plant The first generation genetically modified plants arrived, also including its filial generation.For genetically modified plants, the gene can be bred in the species, The gene transfer can be entered to other kinds of same species with traditional breeding method, particularly including in commercial variety.Described turn Gene plant includes seed, callus, intact plant and cell.

In the above method, the recipient plant is monocotyledon or dicotyledon；The dicotyledon can be to intend Southern mustard, the arabidopsis are specially Arabidopsis Mutants plant (lhap1).

Present invention finds the transmembrane protein LHAP1 for being positioned at chloroplaset, and it was found that the deletion mutant of LHAP1 genes It is yellowish green that plant (lhap1) shows leaf color, and photosynthetic efficiency reduces.The present invention passes through the separation to LHAP1 and the mirror of gene function Setting analysis, establishes regulating and controlling effects of the LHAP1 in plant catches photochromic fibroin LHCII transport processes, can in actual production LHCII protein contents are regulated and controled by transgenic approach using the gene.

Brief description of the drawings

Fig. 1 is the phenotypic map of lhap1 mutant plants.

Fig. 2 is the proof diagram of lhap1 Mutants homozygous.

Fig. 3 is the Subcellular Localization figure of LHAP1 albumen.

Fig. 4 is the protein immunoblot figure that photopigment protein content is caught in lhap1 mutant.

Fig. 5 is the result figure of lhap1 mutant complementations.

Fig. 6 is the soluble segmentation of LHAP1 albumen and the double miscellaneous egg folding mutually mappings of LTD protein films systemic yeast.

Fig. 7 mutually maps for LHAP1 full length proteins and the double foreign proteins of Tic110, Tic20, Tic21 protein yeast.

Fig. 8 is the figure of LHAP1 albumen and the co-immunoprecipitation of LTD albumen.

Fig. 9 be complementary plant LHCII in Lhcb5 and Lhcb6 component proteins recovery situation.

Embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples, is commercially available unless otherwise specified.

The acquisition of embodiment 1, LHAP1 genes

First, the acquisition of mutant and phenotype

1st, the acquisition of mutant

By wildtype Arabidopsis thaliana and mutant seeds (the T-DNA insertion mutation bodies ordered from NASC germplasm resource banks, kind Son is marked as SALK_031802C) low temperature vernalization (4 DEG C of lucifuges processing after immersion) processing is carried out, handle after 72h with 10% chlorine Sour sodium sterilizes 10min, and sterile water wash 4 times, is seeded on the MS culture mediums containing 2% sucrose and 0.8% agar, is placed in temperature For 22 DEG C, light intensity 100umolm^-2s^-1, the photoperiod be 12h/12h (light dark) condition of culture under cultivated, obtain wild Type Arabidopsis thaliana Seedlings (WT) and mutant plants (lhap1).

It turns out that：Compared with WT lines, mutant plants (lhap1) are sprouted compared with wild type evening, slow-growing, battalion Support Later growth leaf color to turn yellow substantially, and grow and easily coerced, in light intensity increase, temperature rise, leaf color becomes when slight arid Yellow phenotype aggravates (Fig. 1).

2nd, the verification of mutant and the acquisition of Mutants homozygous

Pass through the Bar gene pairs wild-type Arabidopsis plants (WT) and mutant plants (lhap1) carried in T-DNA elements PCR amplification verification is carried out, confirms to have T-DNA to be inserted into really in mutant plants (lhap1) and screens Mutants homozygous plant. The primer sequence of PCR verifications is as follows：

LP:5'-GATCCCGCCAATGTTATCTCC-3'；

RP:5'-GCATAGCCAAGTCCAGCAAGT-3'；

LB:5'-ATTTTGCCGATTTCGGAAC-3'。

If primer LP and RP amplify the band that size is 886bp, and primer RP and LB amplify the bar that size is 675bp Band for Heterozygous mutants plant；

If primer LP and RP amplification are without band, and primer RP and LB amplify dashing forward for homozygosis for the band that size is 675bp Variation plant.

If primer LP and RP amplify the band that size is 886bp, and primer RP and LB also expand no band to be wild Type plant (Fig. 2).

2nd, the acquisition of LHAP1 genes

The genomic DNA of arabidopsis (Col-0 is environmental, purchased from arabidopsis Biological Resource Center) is extracted, with the base of acquisition Because group DNA is template, PCR amplification is carried out using primer LHAP1S and LHAP1A, obtains PCR product, and it is pure that PCR product is cut glue T-easy carriers are connected after change, are transferred to bacillus coli DH 5 alpha, screening positive clone carries out PCR digestions and sequencing.Primer sequence is such as Under：

LHAP1S：5’-CCGGAATTCATGGAGCTTCCGTTACTCTCGTAT-3’；

LHAP1A：5’-CGGGATCCTTAAATCAACTTATCCGTGGCCTC-3’.

Sequencing result shows：The nucleotide sequence of PCR product is as shown in sequence 1 in sequence table, by the gene shown in sequence 1 LHAP1 genes are named as, the amino acid sequence of the albumen of LHAP1 gene codes is as shown in sequence 2 in sequence table.

3rd, the positioning of LHAP1 albumen

1st, the structure of recombinant vector PBSK-LHAP1

(1) using the LHAP1 genes shown in sequence 1 as template, PCR expansions are carried out using primer LHAP1GFPS and LHAP1GFPA Increase, obtain PCR product, be LHAP1 genes.Primer sequence is as follows：

LHAP1GFPS：CCGGAATTCATGGAGCTTCCGTTACTCTCGTAT；

LHAP1GFPA：CGGGATCCTTAAATCAACTTATCCGTGGCCTC.

(2) the LHAP1 genes and PBSK carriers obtained with EcoRI and KpnI double digestions step (1) (is purchased from Xin Chengxingchuan sections Skill Development Co., Ltd, catalog number Biovector105802).Through connecting, converting, identifying, recombinant vector is obtained PBSK-LHAP1。

2nd, protoplast transient expression experiment

The young plant of selection 3-4 weeks, chooses the 5th, 6,7 true leaf, is cut into the center section of blade with sharp blade The slice of 0.5-1mm, is put into enzymolysis liquid and digests, and blade 3-4h is digested in dark, and centrifugation, obtains protoplast, will with PEG methods The recombinant vector PBSK-LHAP1 conversion protoplasts that step 1 obtains, cross under noctilucence and cultivate.

3rd, the observation of laser scanning co-focusing microscope

The expression of GFP in mesophyll cell, observation are observed with laser scanning co-focusing microscope (LSM510META, Zeiss) When object lens magnification be 40 times, a length of 488nm of excitation light wave, band logical BP 505-530nm, long logical LP 560nm.

The results are shown in Figure 3：It can be seen from the figure that LHAP1 albumen is positioned in chloroplaset.

Embodiment 2, the acquisition of complementary plant and photosynthetic function analysis

First, the acquisition of complementary plant

1st, the structure of complementing vector

DNA molecular insertion pSN1301 carriers shown in sequence in sequence table 1 (are purchased from BioVector plasmid vector bacterial strains Cytogene collection, product article No. are Biovector105802) BamHI and KpnI restriction enzyme sites between, and keep The other sequences of pSN1301 carriers are constant, obtain recombinant vector.

2nd, the acquisition of recombinant bacterium

The recombinant vector that step 1 is obtained is transformed into EHA105 Agrobacteriums (purchased from Beijing village ally border biological gene science and technology Co., Ltd, catalog number ZC142) in, obtain recombinant bacterium.

3rd, convert

The Mutants homozygous plant that the step of infecting embodiment 1 with the recombinant bacterium of step 2 using inflorescence titration one obtains. Comprise the following steps that：

(1) Agrobacterium for containing purposeful plasmid (recombinant vector) is shaken into bacterium to OD₆₀₀=1.0 or so.

(2) 4 DEG C, 5000g is centrifuged 10 minutes, abandons supernatant, collects thalline.

(3) infect liquid (the 1/2MS fluid nutrient mediums containing sucrose, sucrose quality fraction 5%) with 5mL thalline suspends Get up, the Silvet surfactants for adding 4/10,000 volume (are purchased from Beijing Xin Chengxingchuan developments in science and technology Co., Ltd, product Catalog number (Cat.No.) is SL77080596), mix, the bacterium solution after being handled.

(4) with liquid-transfering gun absorption handle after bacterium solution, be added drop-wise on the titbit do not bloomed and axillary bud at.

(5) material is placed on dark place two days after infecting.

(6) material is gone under normal growth light after dark treatment, continued growth.

(7) infect weekly once, continuously infect 3 times, sowing after maturation.

4th, the acquisition of complementary plant and PCR identifications

(1) after receiving seed, positive seedling screening is carried out on the MS culture medium flat plates of addition hygromycin.And carry out PCR and test (primer of PCR verifications is as follows for card：LP：5'-GATCCCGCCAATGTTATCTCC-3'；RP：5'- GCATAGCCAAGTCCAGCAAGT-3'；LB：5'-ATTTTGCCGATTTCGGAAC-3').Comprise the following steps that：Primer LP and RP amplifies the band that size is 886bp, primer RP and LB amplify the band that size is 675bp for Heterozygous mutants；Draw Thing LP and RP amplify the band that size is 886bp, and primer RP and LB amplification are Mutants homozygous without band.

(2) Heterozygous mutants verified, single plant sowing.Per strain number about 100, the MS trainings of addition hygromycin are seeded in Support on base tablet.If all growing positive seedling, the homozygosis that the Heterozygous mutants of previous generation obtain after being infected for Agrobacterium is proved Body.

(3) homozygote after Agrobacterium obtained in the previous step is infected carries out PCR verifications, the PCR in the same step of primer (1) The primer of verification, primer LP and RP are expanded without band, primer RP and LB amplify the band that size is 675bp to be positive complementary Seedling, is named as complementary plant.

2nd, photosynthetic function is analyzed

1st, photosystem albumen carries out immunoblotting assay

(1) extraction of holoprotein

Take wildtype Arabidopsis thaliana seedling (WT), mutant plants (lhap1) and the complementary plant of growth six weeks or so (lhap1-com) each 50mg of blade, extract holoprotein, per 50mg add 200 μ L buffer E (Tris of 0.1514g/ml, The SDS of 0.01g/ml, 10% glycerine, the Na of 0.095g/ml₂S₂O₅, pH 8.8) and homogenate is ground into, 13000g room temperatures centrifuge 10 points Clock, Aspirate supernatant, takes 15 μ L of supernatant liquid to quantify.

(2) holoprotein quantifies

Using BioRad Dc Protein Assay kits (Bio-Rad, Hercules, CA, USA) respectively to step (1) holoprotein in the supernatant obtained is quantified.Comprise the following steps that：

1) solution A is prepared '：The S solution of 20 μ L adds 1ml solution As, is uniformly mixed；

2) BSA concentration gradients are established：No. 1-8 pipe is designated as from 0mg/ml to 5mg/ml；Sample to be tested is denoted as to No. 9 respectively (907), No. 10 (lhap1) and No. 11 (lhap1-com) respectively take 10 μ L.

3) sample preparation：It is separately added into the solution A that 50 μ L are uniformly mixed in 1 to No. 11 small centrifuge tube into step (2) respectively ' and 400 μ L solution Bs, react 15 minutes, measure OD₆₅₀Value.

4) respectively using the protein concentration in 2-8 pipes as transverse axis, using corresponding OD values as the longitudinal axis, establish one and pass through origin Standard curve；By the OD of the sample of 9 to No. 11 centrifuge tubes₆₅₀Value is substituted into calibration curve equation, and calculates its corresponding egg White concentration (unit mg/ml).

As a result as shown in figures 4 and 9, shown by carrying out immunoblotting assay to photosystem albumen：Mutant plants (lhap1) the LHCII each components albumen (Lhcb1, Lhcb2, Lhcb3, Lhcb4, Lhcb5 and Lhcb6) in has in various degree Reduce, wherein Lhcb5 and Lhcb6 protein contents substantially reduce, and the change of other albumen is not notable.And complementary plant (lhap1- Com Lhcb5 and Lhcb6 protein contents have recovered in).Illustrate the work(that there are LHAP1 regulation and control to catch photochromic fibroin LHCII contents Energy.

2nd, Phenotypic examination

Observation is in the wild of vegetative growth phase (young plant of surrounding) and generative growth phase (young plants of seven weeks) respectively The growing state of type Arabidopsis thaliana Seedlings (WT), mutant plants (lhap1) and complementary plant (lhap1-com).

The results are shown in Figure 5.As can be seen from the figure：The leaf color of complementary plant (lhap1-com) has been recovered to wild type Green, illustrate that photosynthetic function is not affected, the complementation plant have and the identical growth and development of WT lines State.

The interaction of the double miscellaneous verification LHAP1 and LHCII transport proteins LTD of embodiment 3, yeast

The present embodiment finds that LHAP1 and LHCII is transported by double miscellaneous and other protein-interactings experiments of soluble yeast Stronger interaction occurs for albumen LTD.

1st, soluble yeast double cross

Yeast two-hybrid detecting system Matchmaker Gold Yeast Two-Hybrid are purchased from Clontech companies, turn Change method is fully according to operation manual.Comprise the following steps that：54 amino acid are before the N-terminal of LHAP1 is predicted according to ChlorolP LHAP1, is removed the amino acid (Aa55-382) after transit peptides and is divided into following six section by transit peptides：LHPA1-1C ends (amino Sour 55-110), LHPA1-2C ends (amino acid/11 34-147), LHPA1-3C ends (amino acid/11 71-190), LHPA1-4C end (amino acid 214-253), LHPA1-5C ends (amino acid 277-313) and LHPA1-6C ends (amino acid 360-382) are held, is led to Cross PCR amplification and obtain the coded sequence of above-mentioned six differences LHPA1 fragments respectively, and be cloned into Bait carriers pGBK respectively On T7, as BD；By in LTD gene clonings to PREY carriers pGADT7, as AD.

Used primer difference is as follows during carrier construction：

LHAP1Y2H1S:5'-GATCGAATTCGCTTCCGCTGAACGGAGCAG-3'；

LHAP1Y2H1A:5'-GATCCTGCAGTTAGATTTTGTCCCAGATCG-3'；

LHAP1Y2H2S:5'-GATCGAATTCTGTTCAGTGACTGGAATTG-3'；

LHAP1Y2H2A:5'-GATCCTGCAGTTAAGGATCAAATCCACC-3'；

LHAP1Y2H3S:5'-GATCGAATTCGACGATGAAGTTGTGAAG-3'；

LHAP1Y2H3A:5'-GATCCTGCAGTTATTCATCTTCCACATC-3'；

LHAP1Y2H4S:5'-GATCGAATTCGGAGAAGAGCTCTTTTAC-3'；

LHAP1Y2H4A:5'-GATCCTGCAGTTATGGAGGAAACACTCC-3'；

LHAP1Y2H5S:5'-GATCGAATTCGCTGCGTCTCCAAAAGAC-3'；

LHAP1Y2H5A:5'-GATCCTGCAGTTACTTCTTCATCTGTCTC-3'；

LHAP1Y2H6S:5'-GATCGAATTCCACGATCACCGGAGAAGG-3'；

LHAP1Y2H6A:5'-GATCCTGCAGTTAAATCAACTTATCCGTGG-3'。

Converted after structure good vector by the step on handbook, after AD and BD cotransformations Yeast Cultivation to logarithmic phase, 1 is done with 5 μ L ratios:10 be serially diluted after point on culture medium, 30 DEG C grow 3 days.By being attached with 40 μ g/mLX-alpha- Upgrowth situation on the four scarce culture medium SD-His-Leu-Trp-Ade of Gal chromogenic substrates and 70ng/mL Aureobasidin A Determine positive interaction.

The results are shown in Figure 6, fragment 2 (LHPA1-2C ends (amino acid/11 34-147)) and (the LHPA1-4C ends of fragment 4 (amino acid 214-253)) 4 there is interaction with LTD albumen, and the interaction of fragment 2 and LTD albumen is stronger, the prior art indicate that LTD Transhipment (Ouyang, et.al., LTD is essential for sorting of LHCP of the controllable LHCII albumen of albumen to the chloroplast SRP pathway.Nature Commun.2(2011):277.) LHPA1 of the present invention, is illustrated Albumen can also influence or regulate and control the transhipment of LHCII albumen.

2nd, membranous system yeast two-hybrid

Yeast two-hybrid system DUALmembrane kit 2 are purchased from Clontech companies, and method for transformation is fully according to operation Handbook.Comprise the following steps that：

(1) encoding gene for the LHPA1 albumen for removing signal peptide is building up in pNCW carriers, obtains pNCW-LHAP1 matter Grain, as Bait.The primer is LHAP1NCS and LHAP1NCA, and primer sequence is as follows：

LHAP1NCS：5'-GACTCTGCAGAGCTTCCGCTGAACGGAGCAG-3'；

LHAP1NCA：5'-AGTCCCGCGGTTAAATCAACTTATCCGTGG-3'.

By DNA molecular insertion pDSL-Nx carriers (the Clontech Laboratories, Inc. shown in sequence 4 (Matchmaker^TMGoldYeast Two-Hybrid System)) in, obtain pDSLNx-Tic21 plasmids；

By in the DNA molecular insertion pDSL-Nx carriers shown in sequence 5, pDSLNx-Tic20 plasmids are obtained；

By in the DNA molecular insertion pDSL-Nx carriers shown in sequence 6, pDSLNx-Tic110 plasmids are obtained；

PDSLNx-Tic110 plasmids, pDSLNx-Tic20 plasmids and pDSLNx-Tic21 plasmids are respectively as Prey.

(2) 20ml is taken to be grown on the yeast strain NMY32 cultures (A546=0.6~1.0) of complete medium YPAD, 700g centrifugations 5min collects thalline (yeast cells), is suspended in spare in 1ml aqua sterilisas.

(3) take the 1 μ L pNCW-LHAP1 plasmids built respectively with pDSLNx-Tic110 plasmids, pDSLNx-Tic20 Plasmid, pDSLNx-Tic21 plasmids are in 300 μ l conversion premixed liquids (270 μ L 50%PEG4000,5 μ L 5mol/L LiOAc, 25 μ L 2g/L salmon essences genomic DNA) in, quick be vortexed mixes, and adds the yeast cells of 100 μ L above-mentioned steps (2), gently mixes Even 1min.42 DEG C of water-bath 45min, middle jog once in a while.700g centrifugations 5min collects transformed cells, is suspended in 100 μ L sterilizing lifes Manage brine (0.9%NaCl).

(4) 50 μ L transformed cells are taken to be spread evenly across SD-Leu-Trp tablets, 30 DEG C are cultivated 2 days.Chosen from every group of conversion Monoclonal is in 10ml leucines, tryptophan deficiency fluid nutrient medium, after growing to logarithmic phase, successively dilute 10 times, 100 Again, 1000 times, take 5 μ l to be grown on SD-His-Leu-Trp tablets, bacterium colony phenotype is observed after 2 days.

(5) it is analysis galactosidase activity, by every group of transformed cells again with Truncate toothpick in SD-Leu-Trp tablets Upper line culture, after growing 2 days, covers tablet 10min with the Whatman filter paper of sterilizing, the filter paper with cell is transferred to liquid The quick-frozen 5min of nitrogen, then lysis at room temperature, after multigelation 3 times, directly topple over the Z buffer solutions of 0.5% agaroses of 10ml on filter paper (60mmol/L Na₂PO₄, 40mmol/LNaH₂PO₄, 10mmol/L KCl, 1mmol/L MgSO₄, 0.1g/L X-gal), solidification Afterwards, 30 DEG C of incubators are inverted in, colony colour is observed in 1~23h.

The results are shown in Figure 7.With Tic110 albumen and Tic20 albumen interaction can occur for LHAP1 albumen, the prior art indicate that Transhipment (Ouyang, et.al., the LTD of Tic110 albumen and the controllable LHCII albumen of Tic20 albumen from nucleus to chloroplaset is essential for sorting of LHCP to the chloroplast SRP pathway.Nature Commun.2(2011):277.8.；Schleiff,E.&Becker,T.Common ground for protein translocation:access control for mitochondria and chloroplasts.Nat.Rev.Mol.Cell Biol.12,48–59(2011).；Li,H.M.&Chiu,C.C.Protein Transport into chloroplasts.Annu.Rev.Plant Biol.61,157-180 (2010)), illustrate the present invention LHAP1 albumen can influence transhipment of the LHCII albumen from nucleus to chloroplaset.

The application of embodiment 4, LHAP1 albumen in the regulatory factor transported as LHCII

By respectively with Myc-LTD and Myc-Tic21 cotransformation tobaccos, detecting GFP-LHAP1 fusion proteins with setting egg(s) There is coexpression situation in tobacco in vain.Comprise the following steps that：

1st, the structure of recombinant vector

Respectively using the cDNA of LTD, Tic21 and LHAP1 as template, PCR amplification is carried out using following primer, and will amplification Product is connected into pSN1301 carriers, respectively obtains recombinant vector pSN1301-LTD, pSN1301-Tic21 and pSN1301- LHAP1。

The primer of LTD is following (restriction enzyme site is KpnI and SacI)：

LTDMycS:5’-GATCGGTACCATGGCTTCTTCTTCAATCTC-3’；

LTDMycA:5’-GATCGAGCTCTCACAGGTCCTCCTCTGAGATCAGCTTCTGCTCCTCAGCCTTTTAGGT CG-3’；

The primer of Tic21 is following (restriction enzyme site is KpnI and BamH)：

Tic21MycS:5’-GACGGATCCATGCAATCACTACTCTTGCC-3’；

Tic21MycA:5’-GATCGGTACCTCACAGGTCCTCCTCTGAGATCAGCTTCTGCTCCTCAGCAACCTTA GGAAC-3’。

The primer of LHAP1 is following (restriction enzyme site is KpnI and BamHI)：

LHAP1GFPS:5’-CGGGGTACCATGGAGCTTCCGTTACTCTC-3’；

LHAP1A:5’-CGCGGATCCAATCAACTTATCCGTGGC-3’。

Sequence verification is carried out to above-mentioned recombinant vector respectively, sequencing result shows：Recombinant vector pSN1301-LTD is by sequence The carrier that the restriction enzyme site of DNA molecular insertion pSN1301 carriers shown in row 3 obtains between KpnI and SacI restriction enzyme sites； PSN1301-Tic21 be by shown in sequence 4 DNA molecular insertion pSN1301 carriers restriction enzyme site be KpnI and BamH digestions The carrier obtained between site, pSN1301-LHAP1 are the restriction enzyme site that the DNA molecular shown in sequence 1 is inserted into pSN1301 carriers The carrier obtained between KpnI and BamHI restriction enzyme sites.And correct plasmid is sequenced in extraction, tobacco is infected in preparation.

2nd, the structure of recombinant bacterium

Recombinant vector pSN1301-LTD, pSN1301-Tic21 and pSN1301-LHAP1 are imported into Agrobacterium respectively EHA105 (is purchased from border biological gene Science and Technology Ltd. of Beijing village ally, catalog number is：ZC142 in), weight is respectively obtained Group bacterium LTD, recombinant bacterium Tic21 and recombinant bacterium LHAP1.

3rd, infect

1) respectively prepared by step 2 recombinant bacterium and P19 bacterial strains (be purchased from Beijing Xin Chengxingchuan developments in science and technology Co., Ltd, Catalog number is MLCC7715) it is connected in LB culture mediums, 28 DEG C of overnight incubations.P19 bacterial strains need be inoculated with for 1 to 2 day in advance.

2) room temperature, 5000rpm centrifugation 15min, collects thalline, with the inducing culture of 10mL (10mM MES (pH 5.7), 50mM MgCl₂, 100uM acetosyringones, acetosyringone needs first to be configured to the mother liquor of 100mM with DMSO) thalline is resuspended sinks Form sediment, respectively obtain LTD bacterium solutions, Tic21 bacterium solutions, LHAP1 bacterium solutions and P19 bacterium solutions.

By LTD bacterium solutions, LHAP1 bacterium solutions and P19 bacterium solutions according to 1:1:1 volume ratio mixes, and obtains mixed bacteria liquid A.

By Tic21 bacterium solutions, LHAP1 bacterium solutions and P19 bacterium solutions according to 1:1:1 volume ratio mixes, and obtains mixed bacteria liquid B.

3) cleaned once with inducing culture.

4) with inducing culture be resuspended thalline to OD values between 0.5-0.6.28 DEG C of culture mixed-culture mediums are no less than 3 Hour.

5) needleless injector of 1mL is used, is gently expelled in the tobacco leaf of healthy growth.

6) after injection finishes, blade is entangled with polybag at once, at 23 DEG C, when dark placement 24-48 is small.It is raw under light It is 2-3 days long.

3rd, the holoprotein of tobacco is extracted

The blade that step 2 is obtained carries out liquid nitrogen grinding, adds 1mL BN1 solution (Tris of the 50mM of PH8.0,0.5M Multitudinous sugar, the magnesium chloride of 1mM, 1% DM), 4 DEG C, 12000rpm centrifuge 10 minutes, suct it is clear, it is spare.

4th, cross pillar to hang GFP labels, Western blotting is done with Myc tag antibodies again after elution.By protein A/G Balanced with phosphate buffer, room temperature, 8000g are centrifuged 5 minutes.50 μ l proteinA/G, 15 μ l antibody and carried holoprotein are mixed Even, 4 DEG C of overnight incubations, wash pillar with NB1 and 0.5%NP40 mixed liquors, suct clearly, add sample-loading buffer, do western blot point Analysis.

The results are shown in Figure 8, and LHAP1 albumen can interact with LTD albumen.Therefore LHAP1 albumen participates in regulation and control The transhipment of LHCII albumen, can directly affect LHCII steady-state levels in chloroplaset as the regulatory factor of LHCII Protein transports Accumulation.

Sequence table

<110>Institute of Botany, Chinese Academy of Sciences

<120>The application of LHAP1 albumen and its encoding gene in photosynthesis of plant is regulated and controled

<160> 6

<210> 1

<211> 1149bp

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 1

atggagcttc cgttactctc gtatgctagc tccgcgtcgt tttcacggac aggcttatgc 60

tcttcttctt cttcctcctc aactagtatc tatgagtttc cggagagaag acggagttta 120

aaattgagat tcaatggtgg agaaaggtca cgaagcgtta tagcttccgc tgaacggagc 180

agtgaaggga ttgagaagac aacagacacc gtcggtggcg gaggaggagg aggagcaggc 240

agatttgctg gtactgccat ggaggttact acacttgatc gtggttttgc taactccacc 300

accgttgatt ttccgatctg ggacaaaatc ggcgccgtcg ttagacttac ttatggaatc 360

ggaatatatg gagcaatggc tgtagcagga agatttatat gttcagtgac tggaattgat 420

tcatctggtg gatttgatcc ttctcttgat gcactacttg ctggacttgg ctatgcaaca 480

ccaccaatca tggctcttct cttcatactc gacgatgaag ttgtgaagct atcaccgcat 540

gctcgggcca ttagagatgt ggaagatgaa gaactaagaa gctttttctt cggaatgtcc 600

ccatggcagt ttatactcat tgtcgcggcc agttcaatag gagaagagct cttttaccgt 660

gttgctgtac agggtgctct gtctgatata ttcttgaaag gaacacagtt gatgacagat 720

tctagaggca tggcatctct gaccggagtg tttcctccat ttgtcccatt tgctgaagtc 780

tttgcagctg taatcaccgc gactctcaca ggctctctct actttcttgc tgcgtctcca 840

aaagacccga catacatagt tgccccggtt ttaaggtcac ggcgagatga ttttaagaag 900

cttttgtcag cttggtatga gaagagacag atgaagaaga tttactctcc actccttgaa 960

ggactcttag ccctctatct cggtattgaa tgggttcaga cggataatat attagcaccg 1020

atgatgacgc atggtatata ctcggcggtc atattagggc atgggctgtg gaaaattcac 1080

gatcaccgga gaaggttacg ccggagaatc gaacacatta gatcggaggc cacggataag 1140

ttgatttaa 1149

<210> 2

<211> 382

<212> PRT

<213>Artificial sequence

<220>

<223>

<400> 2

Met Glu Leu Pro Leu Leu Ser Tyr Ala Ser Ser Ala Ser Phe Ser Arg

1 5 10 15

Thr Gly Leu Cys Ser Ser Ser Ser Ser Ser Ser Thr Ser Ile Tyr Glu

20 25 30

Phe Pro Glu Arg Arg Arg Ser Leu Lys Leu Arg Phe Asn Gly Gly Glu

35 40 45

Arg Ser Arg Ser Val Ile Ala Ser Ala Glu Arg Ser Ser Glu Gly Ile

50 55 60

Glu Lys Thr Thr Asp Thr Val Gly Gly Gly Gly Gly Gly Gly Ala Gly

65 70 75 80

Arg Phe Ala Gly Thr Ala Met Glu Val Thr Thr Leu Asp Arg Gly Phe

85 90 95

Ala Asn Ser Thr Thr Val Asp Phe Pro Ile Trp Asp Lys Ile Gly Ala

100 105 110

Val Val Arg Leu Thr Tyr Gly Ile Gly Ile Tyr Gly Ala Met Ala Val

115 120 125

Ala Gly Arg Phe Ile Cys Ser Val Thr Gly Ile Asp Ser Ser Gly Gly

130 135 140

Phe Asp Pro Ser Leu Asp Ala Leu Leu Ala Gly Leu Gly Tyr Ala Thr

145 150 155 160

Pro Pro Ile Met Ala Leu Leu Phe Ile Leu Asp Asp Glu Val Val Lys

165 170 175

Leu Ser Pro His Ala Arg Ala Ile Arg Asp Val Glu Asp Glu Glu Leu

180 185 190

Arg Ser Phe Phe Phe Gly Met Ser Pro Trp Gln Phe Ile Leu Ile Val

195 200 205

Ala Ala Ser Ser Ile Gly Glu Glu Leu Phe Tyr Arg Val Ala Val Gln

210 215 220

Gly Ala Leu Ser Asp Ile Phe Leu Lys Gly Thr Gln Leu Met Thr Asp

225 230 235 240

Ser Arg Gly Met Ala Ser Leu Thr Gly Val Phe Pro Pro Phe Val Pro

245 250 255

Phe Ala Glu Val Phe Ala Ala Val Ile Thr Ala Thr Leu Thr Gly Ser

260 265 270

Leu Tyr Phe Leu Ala Ala Ser Pro Lys Asp Pro Thr Tyr Ile Val Ala

275 280 285

Pro Val Leu Arg Ser Arg Arg Asp Asp Phe Lys Lys Leu Leu Ser Ala

290 295 300

Trp Tyr Glu Lys Arg Gln Met Lys Lys Ile Tyr Ser Pro Leu Leu Glu

305 310 315 320

Gly Leu Leu Ala Leu Tyr Leu Gly Ile Glu Trp Val Gln Thr Asp Asn

325 330 335

Ile Leu Ala Pro Met Met Thr His Gly Ile Tyr Ser Ala Val Ile Leu

340 345 350

Gly His Gly Leu Trp Lys Ile His Asp His Arg Arg Arg Leu Arg Arg

355 360 365

Arg Ile Glu His Ile Arg Ser Glu Ala Thr Asp Lys Leu Ile

370 375 380

<210> 3

<211> 528bp

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 3

atggcttctt cttcaatctc attctcctgt gcaccttctt tggccacctc actcttctcc 60

accacttctt cttccccaag gctgctctcc tctagatttc tcggaacccg aaacttaaag 120

cttcggatcc gacctgccag actaggaccc tccaatggtt caagaaccac ttgctggttc 180

aagttcggca agaatggtgt cgatgctgaa aatgccggaa tctatggcag ccagtctcga 240

gatgatttcg acagagacga cgtcgaacag tatttcaact acatgggtat gcttgcagta 300

gaaggaacct attcaaagat ggaagctctt cttaacctaa acattcaccc agttgatatc 360

ttgttgatgt tagccgctac agaaggtgac agacctaaga tcgaggagct tctcaaagcc 420

ggtgctgatt attcggtcaa ggacgctgat ggaagaaccg ctatcgacag agccaacagt 480

gaagagatcc gtgatttgat ccttggctac tcgactcaaa aggcttga 528

<210> 4

<211> 891bp

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 4

atgcaatcac tactcttgcc gccggcgagt tcctccggcg tatccgccgt cgcgctacgg 60

ccaggtttcc agcactcatt taaccaccaa agcctctcta ctcgctccct gccattgttt 120

aatccacttc tcttagctcc gaagaagaaa accaccatct cctcatatca atcgccaccg 180

tctctgtccg tctacggttt ccaaatcgga ggatctaaac ctagtttcac accatccacg 240

gtggcatttt catatccgac ttctccgtct tccgttcccg gtgataatga ggtcgacaaa 300

gcaaaactcg ctcaggttgc aaagagattg gagaagactt caaggtactt taagagacta 360

gggagtattg gtttctgggg gcagcttgtg tcaactgtgg ttgcagctgt gattctatcc 420

ttctccattg ttgtaactgg gaaacctact tcacctgcta ctttctatgc tactgctagt 480

gggattgctg ctgcgtttgt ctcggttttc tggtcgtttg ggtatattcg gctctccgag 540

aggctccgtc gaacttccat cgaccctgcc aaggcgccgc ctcgcgctga tgttgtgaaa 600

ggtttgagga gcgggattat ggtaaatatt ttgggaatgg gatcagcact actcgggatg 660

caagcaacag ttggattttt agttgcaaag gctttaacaa cttcagcaaa ccctttctac 720

caaggagtct ctcagggata cagtcccgtt cttgctcttg atgtcttcct agttcaggca 780

tcggcgaaca ccttactctc tcatttcctt ggtcttgttt gctcgttgga gctgttgcgg 840

tctgtgacag tgcccaattc ggaatctgtc gtagttccta aggttgcttg a 891

<210> 5

<211> 825bp

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 5

atgataactg gatacagcac gccaagtgca catgttctaa tgagctctcg ggcattcaag 60

tcatcatcat atagagctgc agcaggacag actcaacatt atcttgctcg aagttcattg 120

cctgtcgtaa agaactcgtg gggatcacca ccttcacctt tcaatgagct tccgagagtg 180

tcaagaggtg tgcctctgtc atatctctca gcctcgtctt ctctgcttct gaatggagaa 240

caaggtagtc tatctggtac attacctgtg ttacctgtcc gcagaaaaac tcttttgact 300

ccacgagcgt caaaagatgt accttctagc ttccgatttc ccccgatgac caagaagcca 360

caatggtggt ggagaacttt ggcttgcctg ccttacctaa tgccactgca tgaaacttgg 420

atgtatgcag aaaccgctta ccatctccac ccattcctag aagattttga attcttaacc 480

tacccatttc taggcgccat aggaagatta ccaagctggt tcctcatggc ttactttttt 540

gtagcttatc tagggatagt gcgaagaaaa gaatggcctc acttcttcag gttccatgta 600

gtgatgggta tgctgcttga aatcgcactc caggttatag ggaccgttag caagtggatg 660

cctcttggag tctattgggg taagtttggg atgcatttct ggactgctgt tgcgtttgct 720

tatctgttta ccgtccttga aagcatacgg tgtgcacttg cgggtatgta cgcagacatc 780

ccgtttgtct gtgatgctgc ctatatccag attccgtacg actaa 825

<210> 6

<211> 2622bp

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 6

ccggaggtag ctgctatcag tttgcataat tatgttgccg aattcgaaga tcctgcctct 60

gtgacgaaag atgatgtaga aaagatcgct gataggtacg gtgtcaacaa aggagacgaa 120

gcattccagg ctgagatttg tgatatttat tgccggtatg taacttccgt gcttccaact 180

gaaggacagt ctcttaaagg ggatgaagtg gcgaagatag tcaagttcaa aaatgcttta 240

gggatagacg aacctgatgc agctgccatg cacatggaga ttggtcgcag gatttttagg 300

caaaggcttg agactgggga gcgtgaaggt gatgcagaac agcgtcgggc atttatgagg 360

cttgtatatg tttcagctct tgtgtttgga gatgcttcat ccttccttct accttggaag 420

cgagtattga aggtcacaga tgctcaggtt gagattgcta ttcgtgaaaa tgcaaagcag 480

ctgtatgccg aacggttaaa attagttggt agagatatta acgtagaaaa ccttgtggac 540

cttagaaaat cacaactatc attcaagctc tctgatgagc ttgctgaaga cctgtttaga 600

gagcatacga gaaaagtagt cgtagagaac atttcatcgg cactcagcat actcaaatcc 660

cgcacacgag cagcgaagag tttggcatct gtcgtggaag agcttgaaaa agtactggag 720

tttaacaacc tgctagtttc cttgaaaagt cattcagagg cagatcaatt tgcacgcggg 780

gttggcccta tttctttgat aggtgatgag tctgattttg agaggagaat ggatgattta 840

aagctccttt atagagcata tgttacagat gctttatctg gtgggcgctt agaagaaaat 900

aagctcgtgg caatgagcca acttagaaac atactcggtc tgggaaaacg agaggctgaa 960

gctattagtg ttgatgttac gtccaagtct taccgtaaaa gacttgctaa cgctgtttct 1020

agtggtgacc ttgaagcaca agacagtaaa gcaaaatacc ttcaaaagct ctgcgaagag 1080

ctgcactttg atgcacagaa ggcaggcgca atccatgaag aaatctatcg gcagaagctt 1140

caacagtgtg ttactgatgg agagctgagc gatgacaatg ttgctgcttt attaaggtta 1200

agagttatgt tgtgtattcc ccagcaaact gttgatacag ctcatgcaga aatctgtgga 1260

accatatttg aaaaggttgt cagggatgcc atttcttctg gagtggatgg ttatgatgct 1320

gaaactcgca aatcagttag aaaggctgca catggtcttc ggttatccag agagactgcc 1380

atgtctattg ctagcaaagc tgtccgtagg gttttcacaa actatatcag acgagcaaga 1440

gcagccgaga accgtactga ttcagcaaag gagctcaaga agatgattgc tttcaacacg 1500

ttggttgtga ctgaaatggt ggctgatatc aagggagaat cttctgataa ggcacctgag 1560

gaggaccctg ttcaagagaa agaagaagat gatgaagatg aagaatgggg atcccttgaa 1620

tcgctcagaa agacaagacc cgacaaggaa ctcgctgaga aaatgggaaa gcctggccag 1680

actgagataa ctctcaaaga tgaccttccc gacagggaca gaatagatct ctacaaaaca 1740

tacttgctct actgtgtaac tggagaggta acaagaatcc cttttggcgc ccagatcaca 1800

acaaagagag acgattcaga gtacttgctt ctaaatcagc ttggtgggat tctcggattg 1860

agttcgaaag aaatagtcaa cattcacgta ggtttagccg agcaggcttt taggcaacaa 1920

gctgaagtga ttttagctga tgggcaattg acaaaggcta gagtagagca gctagacgag 1980

ttgcaaaaac aagttggttt gcctcagcca caagccgaga aggttatcaa gaatataacc 2040

accacaaaaa tggcaaacgc gatagagacc gctgttaacc aaggaagact gaacataaag 2100

cagatacggg agctcaagga ggcaaatgtc agcctggaca gcatgatcgc tgtgagtctg 2160

agagagaaat tattcaagaa gacagtgagt gacatcttct catcaggaac tggtgaattc 2220

gatgaaaccg aagtctacca gacaatccca tccgatctca gtattgatgt ggaaaaagcc 2280

aaaagagttg tccatgatct cgctcagagt agattatcga attcgctggt ccaagccgtg 2340

gcattactca ggcagagaaa ctctaaagga gtggtcttgt cgctgaatga tttgcttgca 2400

tgtgacaaag ctgtgccggc tgagccaatg tcatgggagg tctcagagga attatctgat 2460

ctatatgcta tttattcaaa gagtgatccc aaacccgcac cggaaaaagt tttgaggcta 2520

caatatctgc tgggaataga tgattcaact gcaactgccc tccgtgaaat ggaagatgga 2580

gcattatctt ctgctgcaga agagggcaat ttcgtctttt aa 2622

Claims

1. application of following protein a) or b) or c) or d) in photosynthesis of plant is regulated and controled：

A) amino acid sequence is the protein shown in sequence 2；

C) amino acid sequence shown in sequence 2 is passed through to the substitution and/or missing and/or addition of one or several amino acid residues The obtained protein with identical function；

D) with sequence 2 shown in homology of the amino acid sequence with 75% or more than 75% and the albumen with identical function Matter.

2. with application of the relevant biomaterial of protein described in claim 1 in photosynthesis of plant is regulated and controled；

Any of the biomaterial is following A 1) to A12)：

A1 the nucleic acid molecules of the protein described in claim 1) are encoded；

A2 A1) is contained) expression cassettes of the nucleic acid molecules；

A3 A1) is contained) recombinant vectors of the nucleic acid molecules；

A4 A2) is contained) recombinant vector of the expression cassette；

A6 A2) is contained) recombinant microorganism of the expression cassette；

A7 A3) is contained) recombinant microorganism of the recombinant vector；

A8 A4) is contained) recombinant microorganism of the recombinant vector；

3. application according to claim 2, it is characterised in that：

A1) nucleic acid molecules for it is following 1) or 2) or 3) shown in gene：

2) nucleotide sequence with 1) limiting has 75% or more than 75% homogeneity, and encodes the egg described in claim 1 The cDNA molecules or genomic DNA molecule of white matter；

1) or 2) 3) and the protein described in claim 1 is encoded with the nucleotide sequence hybridization limited under strict conditions CDNA molecules or genomic DNA molecule.

4. according to any application in claim 1-3, it is characterised in that：

The regulation and control photosynthesis of plant is embodied in 1) -4) in it is any：

1) photochromic fibroin LHCII contents are caught in regulation and control；

4) interact with Tic110 albumen and/or Tic20 albumen and/or LTD albumen.

5. application according to claim 4, it is characterised in that：The regulation and control catch photochromic fibroin LHCII contents as regulation and control The content of Lhcb5 albumen and/or Lhcb6 albumen.

6. the relevant biological material described in protein or Claims 2 or 3 described in claim 1 is cultivating photosynthesis Application in the genetically modified plants that activity improves.

7. a kind of method for cultivating the genetically modified plants that photochemical vitality improves, including improve claim 1 in recipient plant Described in protein expression quantity and/or activity, the step of obtaining genetically modified plants；The photosynthesis of the genetically modified plants Activity is higher than the recipient plant.

8. according to the method described in claim 7, it is characterized in that：The photochemical vitality of the genetically modified plants is higher than described The photochromic fibroin LHCII contents of catching that recipient plant is embodied in genetically modified plants are higher than recipient plant；

Or, described to catch photochromic fibroin LHCII be Lhcb5 albumen and/or Lhcb6 albumen.

9. the method according to claim 7 or 8, it is characterised in that：

The expression quantity of protein in the raising recipient plant described in claim 1 and/or the method for activity are in acceptor The protein described in claim 1 is overexpressed in plant；

Or, the method for the overexpression is that the encoding gene of the protein described in claim 1 is imported recipient plant；

Or, the nucleotide sequence of the encoding gene of the protein is the DNA molecular shown in sequence 1.

10. according to any method in claim 7-9, it is characterised in that：The recipient plant for monocotyledon or Dicotyledon.