CN105985418A - Application of growth-related protein GRP4 in regulation of plant growth - Google Patents
Application of growth-related protein GRP4 in regulation of plant growth Download PDFInfo
- Publication number
- CN105985418A CN105985418A CN201510050131.5A CN201510050131A CN105985418A CN 105985418 A CN105985418 A CN 105985418A CN 201510050131 A CN201510050131 A CN 201510050131A CN 105985418 A CN105985418 A CN 105985418A
- Authority
- CN
- China
- Prior art keywords
- plant
- sequence
- grp4
- gene
- growth
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses application of a growth-related protein GRP4 in regulation of plant growth. The growth-related protein GRP4 provided in the invention is a protein as shown in (a) or (b), wherein (a) refers to a protein composed of an amino acid sequence as shown in a sequence 7 in a sequence table, and b) refers to a protein which has same protein functions and is obtained by subjecting the amino acid sequence as shown in the sequence 7 in the sequence table to substitution and/or deletion and/or addition of one or more amino acid residues. Experimental results prove that the growth-related protein GRP4 and a coding gene thereof can promote vegetative growth and reproductive growth of plants and can be used for regulating the vegetative growth and reproductive growth of plants or cultivating transgenic plants.
Description
Technical field
The present invention relates to growth associated protein GRP4 application in regulating plant growth in biological technical field.
Background technology
Lodging problem and photoperiodical reaction sensitivity always perplex the subject matter of high-yield plant stable yields.When the reproductive growth of plant, underproduction rate can be higher in lodging generation.Different latitude interzone is introduced a fine variety and the florescence of plant, period of maturation can be caused to be advanced or delayed because of the change of the duration of day, and the yield of plant all can be caused to decline.Therefore, in the urgent need to using molecular breeding means, introducing or to the interior genetic manipulation at gene, the plant type of orientation adjustment plant and photoperiodical reaction sensitivity by exogenous gene, accelerate selection-breeding process resistant to lodging and Wide-adaptive plant.
Summary of the invention
The technical problem to be solved is how to promote the growth of plant.
For solving above-mentioned technical problem, present invention firstly provides growth associated protein application in regulating plant growth.
In the growth associated protein provided by the present invention application in regulating plant growth, the entitled GRP4 of described growth associated protein, for a) or b):
A) protein of sequence 7 during aminoacid sequence is sequence table；
B) protein with same protein function that the aminoacid sequence of sequence in sequence table 7 is obtained through the replacement of one or several amino acid residue and/or disappearance and/or interpolation.
Wherein, sequence 7 is made up of 472 aminoacid.
In order to the protein in making a) is easy to purification, in sequence table, label as shown in table 1 can be connected by amino terminal or the carboxyl terminal of the protein shown in sequence 7.
Table 1, the sequence of label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (usually 5) | RRRRR |
| Poly-His | 2-10 (usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
Above-mentioned b) in GRP4 can synthetic, it is possible to first synthesize its encoding gene, then carry out biological expression and obtain.Above-mentioned b) in the encoding gene of GRP4 can be by the codon by lacking one or several amino acid residue in the DNA sequence shown in sequence in sequence table 8, and/or carry out the missense mutation of one or several base pair, and/or connect the coded sequence of the label shown in table 1 at its 5 ' end and/or 3 ' ends and obtain.
In the application in regulating plant growth of the above-mentioned growth associated protein, described plant can be monocotyledon or dicotyledon.Described dicotyledon can be crucifer, such as arabidopsis (Arabidopsis thaliana).
For solving above-mentioned technical problem, present invention also offers the biomaterial relevant to described GRP4 application in regulating plant growth.
In the biomaterial relevant for GRP4 provided by the present invention and described application in regulating plant growth, the biomaterial relevant to described GRP4, for following A 1) to A20) in any one:
A1) nucleic acid molecules of described GRP4 is encoded；
A2) containing A1) expression cassette of described nucleic acid molecules；
A3) containing A1) recombinant vector of described nucleic acid molecules；
A4) containing A2) recombinant vector of described expression cassette；
A5) containing A1) recombinant microorganism of described nucleic acid molecules；
A6) containing A2) recombinant microorganism of described expression cassette；
A7) containing A3) recombinant microorganism of described recombinant vector；
A8) containing A4) recombinant microorganism of described recombinant vector；
A9) containing A1) the transgenic plant cells system of described nucleic acid molecules；
A10) containing A2) the transgenic plant cells system of described expression cassette；
A11) containing A3) the transgenic plant cells system of described recombinant vector；
A12) containing A4) the transgenic plant cells system of described recombinant vector；
A13) containing A1) Transgenic plant tissue of described nucleic acid molecules；
A14) containing A2) Transgenic plant tissue of described expression cassette；
A15) containing A3) Transgenic plant tissue of described recombinant vector；
A16) containing A4) Transgenic plant tissue of described recombinant vector；
A17) containing A1) the transgenic plant organ of described nucleic acid molecules；
A18) containing A2) the transgenic plant organ of described expression cassette；
A19) containing A3) the transgenic plant organ of described recombinant vector；
A20) containing A4) the transgenic plant organ of described recombinant vector.
In the application in regulating plant growth of the above-mentioned and described biomaterial relevant for GRP4, A1) described nucleic acid molecules is following a1) a2) or a3) shown in gene:
A1) the cDNA molecule of sequence 8 or DNA molecular during nucleotide sequence is sequence table；
A2) nucleotide sequence and a1) limited has 75% or more than 75% homogeneity, and the cDNA molecule of the protein that encoding amino acid sequence is sequence 7 or genomic DNA molecule；
A3) under strict conditions with a1) nucleotide sequence hybridization that limits, and the cDNA molecule of the protein that encoding amino acid sequence is sequence 7 or genomic DNA molecule.
Wherein, described nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；Described nucleic acid molecules can also be RNA, such as mRNA or hnRNA etc..
Wherein, sequence 8 is made up of 1419 nucleotide, the aminoacid sequence shown in coded sequence 7.
The method that those of ordinary skill in the art can use known method, such as orthogenesis and point mutation easily, the nucleotide sequence that the present invention encodes GRP4 suddenlys change.Those are through manually modified, there is the nucleotide sequence 75% with the GRP4 of isolated of the present invention or the nucleotide of higher homogeneity, as long as encoding GRP4 and there is GRP4 function, all it is derived from the nucleotide sequence of the present invention and is equal to the sequence of the present invention.
Term used herein " homogeneity " refers to the sequence similarity with native sequence nucleic acid." homogeneity " includes that the nucleotide sequence of the protein of the composition of the aminoacid sequence shown in coded sequence 7 with the present invention has 75% or higher, or 85% or higher, or 90% or higher, or the nucleotide sequence of 95% or higher homogeneity.Homogeneity can with the naked eye or computer software is evaluated.Using computer software, the homogeneity between two or more sequences can use percentage ratio (%) to represent, it can be used to the homogeneity evaluating between correlated series.
In the application in regulating plant growth of the above-mentioned biomaterial with described GRP4, described stringent condition is at 2 × SSC, in the solution of 0.1%SDS, hybridize at 68 DEG C and wash film 2 times, 5min every time, again in 0.5 × SSC, in the solution of 0.1%SDS, hybridize at 68 DEG C and wash film 2 times, each 15min；Or, 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS solution in, hybridize under the conditions of 65 DEG C and wash film.
Above-mentioned 75% or more than 75% homogeneity, can be the homogeneity of 80%, 85%, 90% or more than 95%.
In the application in regulating plant growth of the above-mentioned biomaterial with described GRP4, the expression cassette (GRP4 expression casette) of the nucleic acid molecules containing coding GRP4 described in B2), refer to express the DNA of GRP4 in host cell, this DNA not only can include the promoter starting GRP4 genetic transcription, may also include the terminator terminating GRP4 genetic transcription.Further, described expression cassette may also include enhancer sequence.The promoter that can be used for the present invention includes but not limited to: constitutive promoter, the promoter that tissue, organ and growth are special, and inducible promoter.The example of promoter includes but not limited to: the constitutive promoter 35S of cauliflower mosaic virus: from the wound-inducible promoter of Fructus Lycopersici esculenti, leucine aminopeptidase (" LAP ", Chao et al. (1999) Plant Physiol 120:979-992)；From chemical inducible promoter of Nicotiana tabacum L., pathogeny is correlated with 1 (PR1) (being induced by salicylic acid and BTH (diazosulfide-7-carbothioic acid S-methyl ester))；Fructus Lycopersici esculenti protease inhibitor II promoter (PIN2) or LAP promoter (all can use methyl jasmonate to induce)；Heat-shock promoters (United States Patent (USP) 5,187,267)；Tetracycline inducible promoter (United States Patent (USP) 5,057,422)；Seed specific promoters, such as Millet Seed specificity promoter pF128 (CN101063139B (Chinese patent 200710099169.7)), the special promoter of seed storage protein matter is (such as, phaseollin., napin, the promoter (Beachy et al. (1985) EMBO is J.4:3047-3053) of oleosin and Semen sojae atricolor beta conglycin).They can be used alone or be used in combination with other plant promoter.All references cited herein all quotes in full.Suitably transcription terminator includes but not limited to: Agrobacterium nopaline syntase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, Semen Pisi sativi rbcS E9 terminator and nopaline and octopine synthase terminator (see, e.g.: Odell et al. (I985)Nature 313:810；Rosenberg et al. (1987) Gene, 56:125；Guerineau et al. (1991) Mol.Gen.Genet, 262:141；Proudfoot(1991)Cell,64:671；Sanfacon et al. Genes Dev., 5:141；Mogen et al. (1990) Plant Cell, 2:1261；Munroe et al. (1990) Gene, 91:151；Ballad et al. (1989) Nucleic Acids Res.17:7891；Joshi et al. (1987) Nucleic Acid Res., 15:9627).
Available existing expression vector establishment contains the recombinant vector of described GRP4 expression casette.Described plant expression vector includes double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA company) etc..Described plant expression vector also can comprise 3 ' end untranslated regions of exogenous gene, i.e. comprises polyadenylation signals and any other participates in mRNA processing or the DNA fragmentation of gene expression.The bootable polyadenylic acid of described polyadenylation signals joins 3 ' ends of mRNA precursor, and the untranslated region transcribed such as Agrobacterium crown gall nodule induction (Ti) plasmid gene (such as rouge alkali synthetase gene Nos), plant gene (such as soybean storage protein genes) 3 ' end is respectively provided with similar functions.When using the gene constructed plant expression vector of the present invention, it be also possible to use enhancer, including translational enhancer or transcriptional enhancer, these enhancer regions can be ATG initiation codon or neighboring region start codon etc., but must be identical with the reading frame of coded sequence, to ensure the correct translation of whole sequence.The source of described translation control signal and start codon is widely, can be natural, it is also possible to be synthesis.Translation initiation region can come from transcription initiation region or structural gene.For the ease of transgenic plant cells or plant being identified and screening, plant expression vector used can be processed, enzyme or the gene (gus gene of luminophor of color change can be produced as added the coding can expressed in plant, luciferase genes etc.), the marker gene of antibiotic is (as given the nptII gene to kanamycin and associated antibiotic resistance, give the bar gene to herbicide phosphinothricin resistance, give the hph gene to antibiotic hygromycin resistance, with the dhfr gene given methotrexate resistance, give EPSPS gene to glyphosate) or anti-chemical reagent marker gene etc. (such as anti-herbicide gene), the mannose-6-phosphate isomerase gene of metabolism mannose ability is provided.From the security consideration of transgenic plant, any selected marker can be not added with, directly screen transformed plant with adverse circumstance.
In the application in regulating plant growth of the above-mentioned biomaterial with described GRP4, described carrier can be plasmid, stick grain, phage or viral vector.
In the application in regulating plant growth of the above-mentioned biomaterial with described GRP4, described microorganism can be yeast, antibacterial, algae or fungus, such as Agrobacterium.
In the application in regulating plant growth of the above-mentioned biomaterial with described GRP4, described transgenic plant cells system, Transgenic plant tissue and transgenic plant organ the most do not include propagating materials.
In an embodiment of the invention, the encoding gene (i.e. DNA molecular shown in sequence 8) of GRP4 is imported in Agrobacterium tumefaciems GV3101 by the recombinant vector of the expression cassette of the encoding gene containing GRP4.Described recombinant vector is the GRP4 albumen shown in recombinant vector pTF101.1-GRP4, pTF101.1-GRP4 expressed sequence 7 that the DNA fragmentation between Xba I and the Sac I recognition sequence replacing pTF101.1-GFP with the DNA molecular shown in sequence 8 obtains.DNA between the difference of described pTF101.1-GRP4 and pTF101.1-GFP is only that Xba I and the Sac I recognition sequence of pTF101.1-GFP replaces with the DNA molecular shown in sequence 8.
In the application in regulating plant growth of the above-mentioned biomaterial with described GRP4, described plant can be monocotyledon or dicotyledon.Described dicotyledon can be crucifer, such as arabidopsis (Arabidopsis thaliana).
For solving above-mentioned technical problem, present invention also offers a kind of method cultivating the transgenic plant that growth increases.
A kind of method cultivating the transgenic plant that growth increases provided by the present invention, obtains the step of transgenic plant including the encoding gene importing described GRP4 in recipient plant；Described transgenic plant grows increase compared with described recipient plant.
In the method for the transgenic plant that above-mentioned cultivation growth increases, the coded sequence of the encoding gene of described GRP4 is the DNA molecular of sequence 8 in sequence table.
In the method for the transgenic plant that above-mentioned cultivation growth increases, described plant can be monocotyledon or dicotyledon.Described dicotyledon can be crucifer, such as arabidopsis (Arabidopsis thaliana).
In an embodiment of the present invention, the encoding gene (i.e. DNA molecular shown in sequence 8) of described GRP4 is imported in purpose plant by the GRP4 gene recombinant vectors containing GRP4 expression casette.
In the method for the transgenic plant that above-mentioned cultivation growth increases, wherein said GRP4 gene can be modified the most as follows, then imports in receptor seed plant, to reach more preferable expression effect:
1) modify according to actual needs and optimize, so that gene efficient expression；Such as, the codon can being had a preference for according to recipient plant, while keeping the aminoacid sequence of GRP4 gene of the present invention, change its codon to meet plant-preference；During optimization, it is desirable that the coded sequence after optimization keeps certain G/C content, to be best implemented with the high level expression of quiding gene in plant, wherein G/C content can be 35%, more than 45%, more than 50% or more than about 60%；
2) gene order of neighbouring initial methionine is modified, so that translation is the most initial；Such as, known effective sequence in plant is utilized to modify；
3) promoter expressed with various plants is connected, and is beneficial to its expression in plant；Described promoter can include that the regulation of composing type, induction type, sequential, Growth adjustment, Chemical Regulation, tissue are preferably and tissue-specific promoter；The selection of promoter will change along with expression time and space requirement, and also depend on target kind；Such as tissue or the specific expressing promoter of organ, receptor is depending on what period grown as required；Although demonstrating and deriving from many promoteres of dicotyledon is operational in monocotyledon, vice versa, but it is desirable to select the expression that dicot promoters is in dicotyledon, the expression in monocotyledon of the monocotyledonous promoter；
4) it is connected with the transcription terminator being suitable for, it is also possible to improve the expression efficiency of gene of the present invention；Such as derive from the tml of CaMV, derive from the E9 of rbcS；Any known available terminator worked in plant can be attached with gene of the present invention；
5) enhancer sequence is introduced, such as intron sequences (such as deriving from Adhl and bronzel) and viral leader sequence (such as deriving from TMV, MCMV and AMV).
Described GRP4 gene recombinant vectors can be by using Ti-plasmids, plant virus carrying agent, directly delivered DNA, microinjection, the standard biologic technical method such as electroporation import plant cell (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp.411-463；Geiserson and Corey,1998,Plant Molecular Biology(2nd Edition).).
In the method for the transgenic plant that above-mentioned cultivation growth increases, described transgenic plant is interpreted as not only comprising the first generation transgenic plant obtained by described GRP4 gene transformation purpose plant, also includes its filial generation.For transgenic plant, this gene can be bred in these species, it is also possible to this gene is transitioned into other kind of same species by traditional breeding method, in commercial variety.Described transgenic plant includes seed, callus, whole plant and cell.
For solving above-mentioned technical problem, present invention also offers nucleic acid molecules total length or the primer pair of its fragment of GRP4 described in amplification coding.
For solving above-mentioned technical problem, present invention also offers described GRP4.
For solving above-mentioned technical problem, present invention also offers described biomaterial.
In the present invention, described growth is concretely nourished and grown and/or reproductive growth.Described nourishing and growing can be the growth of root system, the growth of stem, the growth of leaf and/or the growth of fruit pod.The growth of described root system specifically may be embodied on root length and/or lateral root number, and the growth of described stem specifically may be embodied on plant height, and really the growth of pod specifically may be embodied in the length of fruit pod.Described plant is seed plant, and described reproductive growth may be embodied in the length of flowering time and/or fruit pod.
In one embodiment of the invention, described regulating plant growth is for promoting arabidopsis growth.Described plant growing increase is embodied in the increase of described plant plant height, the increase of the total root length of described plant and/or the increase of described plant lateral roots number, the shortening of described flowering of plant time, the increase of described plant fruit pod length.
It is demonstrated experimentally that the growth associated protein GRP4 of the present invention and encoding gene thereof can promote nourishing and growing of plant: turning plant height is recipient plant 5.48 times of GRP4 gene plant, total root length is 3.58 times of recipient plant, and side radical mesh is 4.00 times of recipient plant.The growth associated protein GRP2 of the present invention and encoding gene thereof can promote the reproductive growth of plant: turn flowering time is recipient plant 0.73 times of GRP4 gene plant, really 4.04 times of a length of recipient plant of pod.It is demonstrated experimentally that the growth associated protein GRP4 of the present invention and nourishing and growing and reproductive growth or cultivation transgenic plant of encoding gene regulation and control plant thereof can be utilized.
Accompanying drawing explanation
Fig. 1 is recombinant vector pTF101.1-GRP1, pTF101.1-GRP2, pTF101.1-GRP3 and pTF101.1-GRP4 schematic diagram.Wherein, figure A is recombinant vector pTF101.1-GRP1 schematic diagram, and figure B is recombinant vector pTF101.1-GRP2 schematic diagram, and figure C is recombinant vector pTF101.1-GRP3 schematic diagram, and figure D is recombinant vector pTF101.1-GRP4 schematic diagram.
Fig. 2 is transgenic Arabidopsis plants qualification result in genomic level.Wherein, figure A is to turn the qualification result of GRP1 gene in GRP1 gene Arabidopsis plant, and swimming lane M is Direct-loadTMThe DNA molecular amount standard of Star Marker Plus (D2000Plus) (M121), swimming lane 1 is water, and swimming lane 2 is arabidopsis cpd, and swimming lane 3-5 is T3In generation, turns three strains of GRP1 gene Arabidopsis plant；Figure B is to turn the qualification result of GRP2 gene in GRP2 gene Arabidopsis plant, and swimming lane M is Direct-loadTMThe DNA molecular amount standard of Star Marker Plus (D2000Plus) (M121), swimming lane 1 is water, and swimming lane 2 is arabidopsis cpd, and swimming lane 3 and 4 is T3In generation, turns two strains of GRP2 gene transgenic plant；Figure C is to turn the qualification result of GRP3 gene in GRP3 gene Arabidopsis plant, and swimming lane M is Direct-loadTMThe DNA molecular amount standard of Star Marker Plus (D2000Plus) (M121), swimming lane 1 is water, and swimming lane 2 is arabidopsis cpd, and swimming lane 3-5 is T3In generation, turns three strains of GRP3 gene Arabidopsis plant；Figure D is to turn the qualification result of GRP4 gene in GRP4 gene Arabidopsis plant, and swimming lane M is Direct-loadTMThe DNA molecular amount standard of Star Marker Plus (D2000Plus) (M121), swimming lane 1 is water, and swimming lane 2 is arabidopsis cpd, and swimming lane 3-5 is T3In generation, turns three strains of GRP4 gene Arabidopsis plant.
Fig. 3 is the expression of the genes of interest utilizing semiquantitive PCR to identify in transgenic Arabidopsis plants.Wherein, figure A is to turn the detection of expression result of GRP1 gene in GRP1 gene Arabidopsis plant, and swimming lane from left to right is followed successively by water, arabidopsis cpd, T3In generation, turns GRP1 gene Arabidopsis plant；Figure B is to turn the detection of expression result of GRP2 gene in GRP2 gene Arabidopsis plant, and swimming lane from left to right is followed successively by water, arabidopsis cpd, T3In generation, turns GRP2 gene Arabidopsis plant；Figure C is to turn the detection of expression result of GRP3 gene in GRP3 gene Arabidopsis plant, and swimming lane from left to right is followed successively by water, arabidopsis cpd, T3In generation, turns GRP3 gene Arabidopsis plant；Figure D is to turn the detection of expression result of GRP4 gene in GRP4 gene Arabidopsis plant, and swimming lane from left to right is followed successively by water, arabidopsis cpd, T3In generation, turns GRP4 gene Arabidopsis plant.
Fig. 4 is the Phenotypic examination result of transgenic Arabidopsis plants.Wherein, A is the phenotype turning GRP1 gene Arabidopsis plant, and B is the phenotype turning GRP2 gene Arabidopsis plant, and C is the phenotype turning GRP3 gene Arabidopsis plant, and D is the phenotype turning GRP4 gene Arabidopsis plant.
Detailed description of the invention
Being further described in detail the present invention below in conjunction with detailed description of the invention, the embodiment be given is only for illustrating the present invention rather than in order to limit the scope of the present invention.Experimental technique in following embodiment, if no special instructions, is conventional method.Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
nullCarrier pTF101.1 in following embodiment is the Wang Kan laboratory present of Iowa State University of the U.S.，(Margie M.Paz,Juan Carlos Martinezm,Andrea B.Kalvig,Tina M.Fonger,Kan Wang.(2006)Improved cotyledonary node method using an alternative explant derived from mature seed for efficient Agrobacterium-mediated soybean transformation.Plant Cell Reports.Plant Cell Reports 25:206-213),The public can obtain from Institute of Crop Science, Chinese Academy of Agricultural Science (i.e. applicant)，This biomaterial only attach most importance to duplicate invention related experiment used by，Can not use as other purposes.
nullArabidopsis cpd mutant (Szekeres M in following embodiment,Nemeth K,KonczKalman Z,Mathur J,Kauschmann A,et al.(1996)Brassinosteroids rescue the deficiency of CYP90,a cytochrome P450,Controlling cell elongation and de-etiolation in arabidopsis.Cell 85:171-182.) public can obtain from Institute of Crop Science, Chinese Academy of Agricultural Science (i.e. applicant)，This biomaterial only attach most importance to duplicate invention related experiment used by，Can not use as other purposes.Arabidopsis cpd mutant hereinafter referred to as arabidopsis cpd.
Embodiment 1, utilize growth associated protein gene cultivate growth increase transgenic Arabidopsis plants
nullPresent embodiments provide four and derive from Semen sojae atricolor Williams 82 (Haun,W.J.,Hyten,D.L.,Xu,W.W.,Gerhardt,D.J.,Albert,T.J.,Richmond,T.,Jeddeloh,J.A.,Jia,G.F.,Springer,N.M.,Vance,C.P.&Stupar,R.M.(2011).The Composition and Origins of Genomic Variation among Individuals of the Soybean Reference Cultivar Williams 82.Plant Physiology 155,645-655. national genebank is numbered: I2A12645，Unified number: WDD00587) growth associated protein gene，It is growth associated protein GRP1 gene respectively、Growth associated protein GRP2 gene、Growth associated protein GRP3 gene and growth associated protein GRP4 gene.
Prepare the DNA molecular (i.e. growth associated protein GRP1 gene is called for short GRP1 gene) shown in sequence 2 in sequence table, the protein (i.e. growth associated protein GRP1 is called for short GRP1 albumen) shown in DNA molecular coded sequence 1 shown in sequence 2.
Prepare the DNA molecular (i.e. growth associated protein GRP2 gene is called for short GRP2 gene) shown in sequence 4 in sequence table, the protein (i.e. growth associated protein GRP2 is called for short GRP2 albumen) shown in DNA molecular coded sequence 3 shown in sequence 4.
Prepare the DNA molecular (i.e. growth associated protein GRP3 gene is called for short GRP3 gene) shown in sequence 6 in sequence table, the protein (i.e. growth associated protein GRP3 is called for short GRP3 albumen) shown in DNA molecular coded sequence 5 shown in sequence 6.
Prepare the DNA molecular (i.e. growth associated protein GRP4 gene is called for short GRP4 gene) shown in sequence 8 in sequence table, the protein (i.e. growth associated protein GRP4 is called for short GRP4 albumen) shown in DNA molecular coded sequence 7 shown in sequence 8.
1, recombinant vector and the structure of recombinational agrobacterium
The preparation of carrier pTF101.1-GFP: the fragment between Hind III and the EcoR I recognition sequence of carrier pTF101.1 is replaced with the DNA molecular (i.e. GFP expression cassette) shown in sequence 9 obtain the difference of recombinant vector pTF101.1-GFP, pTF101.1-GFP and pTF101.1 be only that Hind III and the EcoR I recognition sequence of pTF101.1 between DNA replace with the DNA molecular shown in sequence 9.In GFP expression cassette shown in sequence 9, the 25-859 position nucleotide of sequence 9 is the sequence of 35S promoter, and the sequence that 880-1596 position nucleotide is GFP gene of sequence 9, the 1640-1894 position nucleotide of sequence 9 is the sequence of NOS terminator.
Fragment between Xba I and the Sac I recognition sequence of pTF101.1-GFP is replaced with GRP1 gene (i.e. DNA molecular shown in sequence 2) and obtains recombinant vector pTF101.1-GRP1 (A in Fig. 1), GRP1 albumen shown in pTF101.1-GRP1 expressed sequence 1, the DNA between the difference of pTF101.1-GRP1 and pTF101.1-GFP is only that Xba I and the Sac I recognition sequence of pTF101.1-GFP replaces with the DNA molecular shown in sequence 2.Recombinant vector pTF101.1-GRP1 is imported in Agrobacterium tumefaciems GV3101 (Tian Gen biochemical technology company limited product), obtains the recombinational agrobacterium GV3101/pTF101.1-GRP1 containing recombinant vector pTF101.1-GRP1.
Fragment between Xba I and the Sac I recognition sequence of pTF101.1-GFP is replaced with GRP2 gene (i.e. DNA molecular shown in sequence 4) and obtains recombinant vector pTF101.1-GRP2 (B in Fig. 1), GRP2 albumen shown in pTF101.1-GRP2 expressed sequence 3, the DNA between the difference of pTF101.1-GRP2 and pTF101.1-GFP is only that Xba I and the Sac I recognition sequence of pTF101.1-GFP replaces with the DNA molecular shown in sequence 4.Recombinant vector pTF101.1-GRP2 is imported in Agrobacterium tumefaciems GV3101, obtains the recombinational agrobacterium GV3101/pTF101.1-GRP2 containing recombinant vector pTF101.1-GRP2.
Fragment between Xba I and the Sac I recognition sequence of pTF101.1-GFP is replaced with GRP3 gene (i.e. DNA molecular shown in sequence 6) and obtains recombinant vector pTF101.1-GRP3 (C in Fig. 1), GRP3 albumen shown in pTF101.1-GRP3 expressed sequence 5, the DNA between the difference of pTF101.1-GRP3 and pTF101.1-GFP is only that Xba I and the Sac I recognition sequence of pTF101.1-GFP replaces with the DNA molecular shown in sequence 6.Recombinant vector pTF101.1-GRP3 is imported in Agrobacterium tumefaciems GV3101, obtains the recombinational agrobacterium GV3101/pTF101.1-GRP3 containing recombinant vector pTF101.1-GRP3.
Fragment between Xba I and the Sac I recognition sequence of pTF101.1-GFP is replaced with GRP4 gene (i.e. DNA molecular shown in sequence 8) and obtains recombinant vector pTF101.1-GRP4 (D in Fig. 1), GRP4 albumen shown in pTF101.1-GRP4 expressed sequence 7, the DNA between the difference of pTF101.1-GRP4 and pTF101.1-GFP is only that Xba I and the Sac I recognition sequence of pTF101.1-GFP replaces with the DNA molecular shown in sequence 8.Recombinant vector pTF101.1-GRP4 is imported in Agrobacterium tumefaciems GV3101, obtains the recombinational agrobacterium GV3101/pTF101.1-GRP4 containing recombinant vector pTF101.1-GRP4.
2, the structure of transgenic arabidopsis
It (should the LB culture medium containing antibiotic be to add the fluid medium that spectinomycin, kanamycin, chloromycetin and rifampicin obtain in LB culture medium that the recombinational agrobacterium GV3101/pTF101.1-GRP1 of step 1 is inoculated in the LB culture medium containing antibiotic, wherein, the concentration of spectinomycin is 50mg/L, the concentration of kanamycin is 50mg/L, the concentration of chloromycetin is 25mg/L, the concentration of rifampicin is 20mg/L) on, at 28 DEG C, 250rpm shaken cultivation is to OD600Value is 0.6-0.8, collects bacterium solution and is placed in centrifuge tube, is centrifuged 5min and collects thalline, with the resuspended thalline of MS fluid medium, obtain GV3101/pTF101.1-GRP1 suspension, the OD of GV3101/pTF101.1-GRP1 suspension under 5000rpm600Value is about 0.6, adds Silwet L-77 (Five continents, Beijing unit industry science and trade Products, article No. is SL77080596), obtain GV3101/pTF101.1-GRP1 and infect liquid in GV3101/pTF101.1-GRP1 suspension.
Employing is stained with colored dip method (Clough SJ, Bent AF (1998) Floral dip:a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.Plant Journal 16:735-743.) GV3101/pTF101.1-GRP1 and is infected liquid arabidopsis thaliana transformation cpd results T1In generation, turns GRP1 gene seed.By T1In generation, turns GRP1 gene seed at MS culture medium (Bastar concentration in MS culture medium is 10mg/L) the enterprising row filter containing Bastar (Japan Mingzhi company), obtains T1In generation, turns GRP1 gene Arabidopsis thaliana Seedlings.By T1Generation turn GRP1 gene Arabidopsis thaliana Seedlings temperature be 22 DEG C, the photoperiod be that 16h illumination and the dark long-day phjytotron of 8h are cultivated, obtain T2In generation, turns GRP1 gene arabidopsis seed.By T2In generation, turns GRP1 gene arabidopsis seed at MS culture medium (Bastar concentration in MS culture medium is 10mg/L) the enterprising row filter containing Bastar (Japan Mingzhi company), obtains T2In generation, turns GRP1 gene Arabidopsis thaliana Seedlings.By T2Generation turn GRP1 gene Arabidopsis thaliana Seedlings temperature be 22 DEG C, the photoperiod be that 16h illumination and the dark long-day phjytotron of 8h are cultivated, obtain T3In generation, turns GRP1 gene arabidopsis seed.
According to the method described above, above-mentioned recombinational agrobacterium GV3101/pTF101.1-GRP1 is replaced with recombinational agrobacterium GV3101/pTF101.1-GRP2, recombinational agrobacterium GV3101/pTF101.1-GRP3 and recombinational agrobacterium GV3101/pTF101.1-GRP4 respectively, other steps are the most constant, respectively obtain T3In generation, turns GRP2 gene arabidopsis seed, T3In generation, turns GRP3 gene arabidopsis seed and T3In generation, turns GRP4 gene arabidopsis seed.
By T3In generation, turns GRP1 gene arabidopsis seed, T3In generation, turns GRP2 gene arabidopsis seed, T3In generation, turns GRP3 gene arabidopsis seed, T3In generation, turns GRP4 gene arabidopsis seed and arabidopsis cpd planting seed in compost, temperature be 22 DEG C, the photoperiod be that 16h illumination and the dark long-day phjytotron of 8h are cultivated, respectively obtain T3In generation, turns GRP1 gene Arabidopsis plant, T3In generation, turns GRP2 gene Arabidopsis plant, T3In generation, turns GRP3 gene Arabidopsis plant, T3In generation, turns GRP4 gene Arabidopsis plant and arabidopsis cpd plant.
3, the qualification of transgenic arabidopsis
3.1, the transgenic Arabidopsis plants of authentication step 2 in genomic level, concrete grammar is as follows:
With the arabidopsis cpd plant of step 2 and water for comparison, the T of authentication step 2 respectively3In generation, turns 3 strains (1-1,1-2 and 1-3), T of GRP1 gene Arabidopsis plant3In generation, turns GRP2 gene Arabidopsis plant 2 strains (2-1 and 2-2), T3In generation, turns 3 strains (3-1,3-2 and 3-3) of GRP3 gene Arabidopsis plant and T3In generation, turns 3 strains (4-1,4-2 and 4-3) of GRP4 gene Arabidopsis plant.Identify T3In generation, turns the primer of GRP1 gene Arabidopsis plant to for ATGGCATCTTTCATCATCATACCAC and TCATGGCGATTTACTTAGTCTGGAC.Identify T3In generation, turns the primer of GRP2 gene Arabidopsis plant to for ATGGCATCTTTCATCTTCACACCTG and TCATGGCGATTTACTTAGTTTGGAC.Identify T3In generation, turns the primer of GRP3 gene Arabidopsis plant to for ATGGCTTCTTTGCCAGCTTTGCCAA and CTAGTCTCTACGCTGCACAATAATT.Identify T3In generation, turns the primer of GRP4 gene Arabidopsis plant to for ATGGCTTCTTTGCCAACACTTCTCT and CTAATGTCTACGCTGCACAATAATA.
Experimental result is shown in that Fig. 2, result show, the T of step 23In generation, turns the purpose band (A swimming lane 3,4 and 5 in Fig. 2) all having size to be 1437bp in the PCR primer of GRP1 three strains of gene Arabidopsis plant, and without purpose band (A swimming lane 1 and 2 in Fig. 2) in compareing, the T of step 2 is described3Generation turns in GRP1 gene Arabidopsis plant all contains GRP1 gene；The T of step 23In generation, turns the purpose band (B swimming lane 3 and 4 in Fig. 2) all having size to be 1440bp in two strain PCR primer of GRP2 gene Arabidopsis plant, and without purpose band (B swimming lane 1 and 2 in Fig. 2) in compareing, the T of step 2 is described3Generation turns in GRP2 gene Arabidopsis plant all contains GRP2 gene；The T of step 23In generation, turns the purpose band (C swimming lane 3,4 and 5 in Fig. 2) all having size to be 1425bp in three strain PCR primer of GRP3 gene Arabidopsis plant, and without purpose band (C swimming lane 1 and 2 in Fig. 2) in compareing, the T of step 2 is described3Generation turns in GRP3 gene Arabidopsis plant all contains GRP3 gene；The T of step 23In generation, turns the purpose band (D swimming lane 3,4 and 5 in Fig. 2) all having size to be 1419bp in three strain PCR primer of GRP4 gene Arabidopsis plant, and without purpose band (D swimming lane 1 and 2 in Fig. 2) in compareing, the T of step 2 is described3Generation turns in GRP4 gene Arabidopsis plant all contains GRP4 gene.
3.2, utilizing the expression of genes of interest in the transgenic Arabidopsis plants of semiquantitive PCR authentication step 2, concrete grammar is as follows:
With the arabidopsis cpd plant of step 2 and water for comparison, the T of authentication step 2 respectively3In generation, turns GRP1 gene Arabidopsis plant strain 1-1, T3In generation, turns GRP2 gene Arabidopsis plant strain 2-1, T3In generation, turns GRP3 gene Arabidopsis plant strain 3-1 and T3In generation, turns the expression of genes of interest in GRP4 gene Arabidopsis plant strain 4-1, and internal reference is the ACTIN2 of arabidopsis, and the primer of internal reference is actctcccgctatgtatgtcgc and agaaaccctcgtagattggcac.Identify T3In generation, turns the primer of GRP1 gene Arabidopsis plant to for GCATCTTTCATCATCATACCACTCC and CAACAAAGGGGAGTCCGAGC.Identify T3In generation, turns the primer of GRP2 gene Arabidopsis plant to for ATGGCATCTTTCATCTTCACACCTG and CGAAGGGGAGCCCGAGTGTAC.Identify T3In generation, turns the primer of GRP3 gene Arabidopsis plant to for ATGGCTTCTTTGCCAGCTTTGC and CGGCGGAGGAAGAGGAGGAG.Identify T3In generation, turns the primer of GRP4 gene Arabidopsis plant to for ATGGCTTCTTTGCCAACACTTCTCT and GAACACGCGGCGGAGGTATAAG.
Experimental result is shown in that Fig. 3, result show, the T of step 23In generation, turns containing purpose band (an A swimming lane left side 3 in Fig. 3) in the PCR primer of GRP1 gene Arabidopsis plant strain 1-1, and without purpose band (A swimming lane left 1 and a left side 2 in Fig. 3) in compareing, the T of step 2 is described3In generation, turns the expression having GRP1 gene in GRP1 gene Arabidopsis plant strain 1-1；The T of step 23In generation, turns containing purpose band (a B swimming lane left side 3 in Fig. 3) in the PCR primer of GRP2 gene Arabidopsis plant strain 2-1, and without purpose band (B swimming lane left 1 and a left side 2 in Fig. 3) in compareing, the T of step 2 is described3In generation, turns the expression having GRP2 gene in GRP2 gene Arabidopsis plant strain 2-1；The T of step 23In generation, turns containing purpose band (a C swimming lane left side 3 in Fig. 3) in the PCR primer of GRP3 gene Arabidopsis plant strain 3-1, and without purpose band (C swimming lane left 1 and a left side 2 in Fig. 3) in compareing, the T of step 2 is described3In generation, turns the expression having GRP3 gene in GRP3 gene Arabidopsis plant strain 3-1；The T of step 23In generation, turns containing purpose band (a D swimming lane left side 3 in Fig. 3) in the PCR primer of GRP4 gene Arabidopsis plant strain 4-1, and without purpose band (D swimming lane left 1 and a left side 2 in Fig. 3) in compareing, the T of step 2 is described3In generation, turns the expression having GRP4 gene in GRP4 gene Arabidopsis plant strain 4-1.
4, the Phenotypic examination of transgenic arabidopsis
In triplicate, that repeats specifically comprises the following steps that every time in experiment
By the T of step 23In generation, turns the planting seed of GRP1 three strains of gene arabidopsis in compost, and each strain randomly selects 20 strains and grows to the Arabidopsis plant of 13 days, and total root length and side radical mesh to each Arabidopsis plant carry out statistics and obtain T3In generation, turns total root length and the side radical mesh statistical result of GRP1 gene arabidopsis.
According to the method described above, by T3In generation, turns three strains of GRP1 gene arabidopsis and replaces with T3In generation, turns GRP2 gene arabidopsis two strains, T3In generation, turns GRP3 gene arabidopsis three strains, T3In generation, turns three strains of GRP4 gene arabidopsis and arabidopsis cpd, and other steps are the most constant, respectively obtain T3In generation, turns total root length and side radical mesh statistical result, the T of GRP2 gene arabidopsis3In generation, turns total root length and side radical mesh statistical result, the T of GRP3 gene arabidopsis3In generation, turns total root length of GRP4 gene arabidopsis and side radical mesh statistical result and total root length of arabidopsis cpd and side radical mesh statistical result.
By the T of step 23In generation, turns the planting seed of GRP1 three strains of gene arabidopsis in compost, and each strain randomly selects 20 strains and grows to the Arabidopsis plant of 55 days, and plant height and fruit pod length to each Arabidopsis plant carry out statistics and obtain T3In generation, turns plant height and the fruit pod length statistical result of GRP1 gene arabidopsis, to the just natural law (i.e. flowering time) of flower, each Arabidopsis plant is also carried out statistics from sprouting simultaneously and obtains T3In generation, turns the flowering time of GRP1 gene arabidopsis.
According to the method described above, by T3In generation, turns three strains of GRP1 gene arabidopsis and replaces with T3In generation, turns GRP2 gene arabidopsis two strains, T3In generation, turns GRP3 gene arabidopsis three strains, T3In generation, turns three strains of GRP4 gene arabidopsis and arabidopsis cpd, and other steps are the most constant, respectively obtain T3In generation, turns the plant height of GRP2 gene arabidopsis, really pod length and the statistical result of flowering time, T3In generation, turns the plant height of GRP3 gene arabidopsis, really pod length and the statistical result of flowering time, T3In generation, turns the plant height of GRP4 gene arabidopsis, really pod length and the statistical result of flowering time and the plant height of arabidopsis cpd, really pod length and the statistical result of flowering time.
T3In generation, turns GRP1 gene Arabidopsis plant strain 1-1, T3In generation, turns GRP2 gene Arabidopsis plant strain 2-1, T3In generation, turns GRP3 gene Arabidopsis plant strain 3-1, T3In generation, turns the phenotype of GRP4 gene Arabidopsis plant strain 4-1 and arabidopsis cpd plant as shown in Figure 4.T3In generation, turns GRP1 gene Arabidopsis plant, T3In generation, turns GRP2 gene Arabidopsis plant, T3In generation, turns GRP3 gene Arabidopsis plant, T3In generation, turns GRP4 gene Arabidopsis plant and the plant height of arabidopsis cpd plant, total root length, side radical mesh, flowering time and fruit pod length are as shown in table 2.
Table 2, the phenotype of transgenic arabidopsis
| Plant height (cm) | Total root length (cm) | Side radical mesh (individual) | Flowering time (my god) | Really pod length (cm) | |
| Turn GRP1 gene plant | 10.39±3.21 | 1.70±0.39 | 16±4 | 38±2 | 0.74±0.19 |
| Turn GRP2 gene plant | 15.15±3.26 | 1.43±0.29 | 9±4 | 34±2 | 0.93±0.10 |
| Turn GRP3 gene plant | 16.33±4.00 | 1.20±0.16 | 7±2 | 33±2 | 0.94±0.11 |
| Turn GRP4 gene plant | 10.30±6.73 | 1.61±0.26 | 12±5 | 35±2 | 0.93±0.10 |
| Arabidopsis cpd | 1.88±0.77 | 0.45±0.12 | 3±2 | 48±1 | 0.23±0.05 |
Result shows, the encoding gene of growth associated protein GRP1, GRP2, GRP3 and GRP4 and correspondence thereof all can promote nourishing and growing of arabidopsis: turns plant height is arabidopsis cpd 5.53 times of GRP1 gene Arabidopsis plant, total root length is 3.78 times of arabidopsis cpd, and side radical mesh is 5.33 times of arabidopsis cpd；Turning plant height is arabidopsis cpd 8.09 times of GRP2 gene Arabidopsis plant, total root length is 3.18 times of arabidopsis cpd, and side radical mesh is 3 times of arabidopsis cpd；Turning plant height is arabidopsis cpd 8.69 times of GRP3 gene Arabidopsis plant, total root length is 2.67 times of arabidopsis cpd, and side radical mesh is 2.33 times of arabidopsis cpd；Turning plant height is arabidopsis cpd 5.48 times of GRP4 gene Arabidopsis plant, total root length is 3.58 times of arabidopsis cpd, and side radical mesh is 4.00 times of arabidopsis cpd.
The encoding gene of growth associated protein GRP1, GRP2, GRP3 and GRP4 and correspondence thereof all can promote the reproductive growth of arabidopsis: turns flowering time is arabidopsis cpd 0.79 times of GRP1 gene Arabidopsis plant, really 3.22 times of pod a length of arabidopsis cpd；Turn flowering time is arabidopsis cpd 0.71 times of GRP2 gene Arabidopsis plant, really 4.04 times of pod a length of arabidopsis cpd；The flowering time turning GRP3 gene Arabidopsis plant is 0.69 times for arabidopsis cpd, really 4.09 times of pod a length of arabidopsis cpd；The flowering time turning GRP4 gene Arabidopsis plant is 0.73 times for arabidopsis cpd, really 4.04 times of pod a length of arabidopsis cpd.
Experiment proves, the encoding gene of growth associated protein GRP1, GRP2, GRP3 and GRP4 and correspondence thereof all can promote nourishing and growing and reproductive growth of plant, it is possible to use nourishing and growing and reproductive growth or cultivate transgenic plant of the encoding gene of growth associated protein GRP1, GRP2, GRP3 and GRP4 and correspondence thereof regulation and control plant.
Claims (10)
1. growth associated protein GRP4 application in regulating plant growth；Described growth associated protein GRP4 is a)
Or b):
A) protein of sequence 7 during aminoacid sequence is sequence table；
B) aminoacid sequence of sequence in sequence table 7 is passed through replacement and/or the disappearance of one or several amino acid residue
And/or add the protein with same protein function obtained.
2. the biomaterial relevant to growth associated protein GRP4 described in claim 1 answering in regulating plant growth
With；
The described biomaterial relevant to growth associated protein GRP4 described in claim 1, for following A 1) to A20)
In any one:
A1) nucleic acid molecules of growth associated protein GRP4 described in coding claim 1；
A2) containing A1) expression cassette of described nucleic acid molecules；
A3) containing A1) recombinant vector of described nucleic acid molecules；
A4) containing A2) recombinant vector of described expression cassette；
A5) containing A1) recombinant microorganism of described nucleic acid molecules；
A6) containing A2) recombinant microorganism of described expression cassette；
A7) containing A3) recombinant microorganism of described recombinant vector；
A8) containing A4) recombinant microorganism of described recombinant vector；
A9) containing A1) the transgenic plant cells system of described nucleic acid molecules；
A10) containing A2) the transgenic plant cells system of described expression cassette；
A11) containing A3) the transgenic plant cells system of described recombinant vector；
A12) containing A4) the transgenic plant cells system of described recombinant vector；
A13) containing A1) Transgenic plant tissue of described nucleic acid molecules；
A14) containing A2) Transgenic plant tissue of described expression cassette；
A15) containing A3) Transgenic plant tissue of described recombinant vector；
A16) containing A4) Transgenic plant tissue of described recombinant vector；
A17) containing A1) the transgenic plant organ of described nucleic acid molecules；
A18) containing A2) the transgenic plant organ of described expression cassette；
A19) containing A3) the transgenic plant organ of described recombinant vector；
A20) containing A4) the transgenic plant organ of described recombinant vector.
Application the most according to claim 2, it is characterised in that: A1) described nucleic acid molecules is following a1) or
A2) gene shown in or a3):
A1) the cDNA molecule of sequence 8 or DNA molecular during nucleotide sequence is sequence table；
A2) nucleotide sequence and a1) limited has 75% or more than 75% homogeneity, and encoding amino acid sequence is
The cDNA molecule of the protein of sequence 7 or genomic DNA molecule；
A3) under strict conditions with a1) nucleotide sequence hybridization that limits, and encoding amino acid sequence is sequence 7
The cDNA molecule of protein or genomic DNA molecule.
4. according to the arbitrary described application of claim 1-3, it is characterised in that: described plant is monocotyledon or double
Cotyledon plant.
5. the method cultivating the transgenic plant that growth increases, including importing claim 1 in recipient plant
The encoding gene of described growth associated protein GRP4 obtains the step of transgenic plant；Described transgenic plant is subject to described
Body plant compares growth to be increased.
Method the most according to claim 5, it is characterised in that: growth associated protein GRP4 described in claim 1
The coded sequence of encoding gene be the DNA molecular of sequence 8 in sequence table.
7. according to the method described in claim 5 or 6, it is characterised in that: described plant is monocotyledon or Shuangzi
Leaf plant.
8. according to arbitrary described method in described application arbitrary in claim 1-4 or claim 5-7, its
Be characterised by: described in be grown to nourish and grow and/or reproductive growth.
9. the growth associated protein GRP4 described in claim 1.
10. the biomaterial described in Claims 2 or 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510050131.5A CN105985418B (en) | 2015-01-30 | 2015-01-30 | Application of the growth associated protein GRP4 in regulating plant growth |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510050131.5A CN105985418B (en) | 2015-01-30 | 2015-01-30 | Application of the growth associated protein GRP4 in regulating plant growth |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105985418A true CN105985418A (en) | 2016-10-05 |
| CN105985418B CN105985418B (en) | 2019-08-30 |
Family
ID=57036900
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510050131.5A Active CN105985418B (en) | 2015-01-30 | 2015-01-30 | Application of the growth associated protein GRP4 in regulating plant growth |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105985418B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109354618A (en) * | 2018-12-13 | 2019-02-19 | 中国农业科学院蔬菜花卉研究所 | Application of the G-protein α subunit in regulation germination of cucumber seeds, growth of seedling and plant low temperature resistivity |
| CN109536515A (en) * | 2019-01-02 | 2019-03-29 | 吉林农业大学 | A kind of bean plant glycine-rich protein gene and its application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101365786A (en) * | 2005-12-01 | 2009-02-11 | 克罗普迪塞恩股份有限公司 | Plants having improved growth characteristics and methods for making the same |
| CN103130885A (en) * | 2013-03-15 | 2013-06-05 | 中国农业大学 | Malus sieversii (Ledeb.) Roem-derived plant growth-related protein, and coding gene and application thereof |
| CN103667314A (en) * | 2013-12-09 | 2014-03-26 | 中国科学院遗传与发育生物学研究所 | Protein OsMKK4 originated from rice and application of biomaterial related to protein OsMKK4 in regulation and control of size of plant seed |
| CN103739686A (en) * | 2013-12-23 | 2014-04-23 | 中国农业科学院油料作物研究所 | Protein related to plant yield improvement and quality improvement, and encoding gene and application thereof |
-
2015
- 2015-01-30 CN CN201510050131.5A patent/CN105985418B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101365786A (en) * | 2005-12-01 | 2009-02-11 | 克罗普迪塞恩股份有限公司 | Plants having improved growth characteristics and methods for making the same |
| CN103130885A (en) * | 2013-03-15 | 2013-06-05 | 中国农业大学 | Malus sieversii (Ledeb.) Roem-derived plant growth-related protein, and coding gene and application thereof |
| CN103667314A (en) * | 2013-12-09 | 2014-03-26 | 中国科学院遗传与发育生物学研究所 | Protein OsMKK4 originated from rice and application of biomaterial related to protein OsMKK4 in regulation and control of size of plant seed |
| CN103739686A (en) * | 2013-12-23 | 2014-04-23 | 中国农业科学院油料作物研究所 | Protein related to plant yield improvement and quality improvement, and encoding gene and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| NCBI: "PREDICTED: cytochrome P450 90A1 [Glycine max]", 《GENBANK》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109354618A (en) * | 2018-12-13 | 2019-02-19 | 中国农业科学院蔬菜花卉研究所 | Application of the G-protein α subunit in regulation germination of cucumber seeds, growth of seedling and plant low temperature resistivity |
| CN109354618B (en) * | 2018-12-13 | 2020-09-15 | 中国农业科学院蔬菜花卉研究所 | Application of G protein alpha subunit in regulation and control of cucumber seed germination, seedling growth and plant low temperature resistance |
| CN109536515A (en) * | 2019-01-02 | 2019-03-29 | 吉林农业大学 | A kind of bean plant glycine-rich protein gene and its application |
| CN109536515B (en) * | 2019-01-02 | 2022-04-08 | 吉林农业大学 | Glycine protein-rich gene of soybean plant and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105985418B (en) | 2019-08-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105037521B (en) | A kind of and plant adversity resistance related protein TaWrky48 and its encoding gene and application | |
| CN107299100B (en) | Plant constitutive expression promoter and application thereof | |
| CN105859860A (en) | Application of disease resistance-related protein to regulation and control of plant disease resistance | |
| CN107653262B (en) | Application of the ZmCCT9 in regulation corn Characteristics in florescence | |
| CN112457380A (en) | Protein for regulating and controlling content of fruit shape and/or fruit juice of plant, related biological material and application thereof | |
| CN113025616B (en) | Rubber tree ubiquitin gene promoter proHbUBI2 and cloning and application thereof | |
| CN105061569B (en) | A kind of and relevant SiMYB107 albumen of stress resistance of plant and its relevant biological material and application | |
| CN105985417B (en) | Application of the growth associated protein GRP2 in regulating plant growth | |
| CN107602683B (en) | Transcription factor ZmNLP4 from corn and application thereof | |
| CN105820220B (en) | The application of resistance relevant protein and its encoding gene in regulation plant alkali resistance | |
| CN104744579B (en) | Applications of the resistance relevant protein GmL16 in regulating and controlling stress resistance of plant | |
| CN105585623B (en) | The disease-resistant breeding method for turning TaMYB-KW DNA triticum and relevant biological material and application | |
| CN105400814B (en) | A method of cultivating insect-resistant transgenic corn | |
| CN106367433B (en) | Plant is improved to the method and its application of gibberellin inhibitor sensitiveness | |
| CN106047833A (en) | OsCIPK31 and application of coding gene thereof in regulation of herbicide resistance of plants | |
| CN105985419B (en) | Application of the growth associated protein GRP1 in regulating plant growth | |
| CN105985418B (en) | Application of the growth associated protein GRP4 in regulating plant growth | |
| CN105713079A (en) | Application of protein and related biological material thereof in increasing plant yield | |
| CN106279386A (en) | A kind of Rice Panicle grown on top development associated protein and encoding gene thereof and application | |
| CN110627887B (en) | Application of SlTLFP8 protein and related biological material thereof in regulation and control of tomato drought resistance | |
| CN110684114B (en) | Application of plant stress tolerance associated protein TaBAKL in regulation and control of plant stress tolerance | |
| CN110684089B (en) | Application of plant stress tolerance related protein GmMYB118 in regulation and control of plant stress tolerance | |
| CN105985420B (en) | Application of the growth associated protein GRP3 in regulating plant growth | |
| US10047369B2 (en) | Citrus derived transcription and translation regulatory elements for tissue specific expression | |
| CN107739403B (en) | Protein related to plant flowering phase and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |