CN114807221B - Mutant, protein and expression vector of rice root elongation regulatory gene OsDRP1C and application thereof - Google Patents
Mutant, protein and expression vector of rice root elongation regulatory gene OsDRP1C and application thereof Download PDFInfo
- Publication number
- CN114807221B CN114807221B CN202210463032.XA CN202210463032A CN114807221B CN 114807221 B CN114807221 B CN 114807221B CN 202210463032 A CN202210463032 A CN 202210463032A CN 114807221 B CN114807221 B CN 114807221B
- Authority
- CN
- China
- Prior art keywords
- osdrp1c
- ala
- rice
- root
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Abstract
The invention relates to the technical field of rice breeding, and particularly discloses a mutant, protein and expression vector of a rice root elongation regulatory gene OsDRP1C and application thereof. The gene OsDRP1C is applied to the regulation and control of the growth of the rice root system, and the growth of the rice root system is regulated and controlled through missense mutation of one or more base pairs in the DNA sequence; the gene OsDRP1C in TIGR is numbered LOC_Os03g50520, and contains the nucleotide sequence shown in SEQ ID NO:1, and a nucleotide sequence shown in the specification. According to the invention, the gene OsDRP1C with the number of LOC_Os03g50520 in the TIGR is regulated, and the growth performance of the rice root system can be regulated by inhibiting or promoting the elongation of main root, adventitious root, lateral root and root hair cells of the rice through missense mutation of one or more base pairs in the DNA sequence.
Description
Technical Field
The invention relates to the technical field of rice breeding, in particular to a mutant, protein and expression vector of a rice root elongation regulatory gene OsDRP1C and application thereof.
Background
The root system of the rice is an important component of the rice, and is not only physically supported on the overground part, but also an important organ for absorbing nutrient components and moisture from the underground of the rice. The rice root system is fibrous root system, and can continuously generate adventitious roots from cells of a meristematic region of a stem node closest to a central column vascular, and finally, the root system structure is formed by a plurality of adventitious roots and lateral roots thereof. The root type is determined by several parameters such as length, quantity and space range, and the research discovers that the root length determines the genetic performance of other root system traits, is the most important trait in all root system traits, and 7 overground agronomic traits such as single plant yield are extremely obviously positively correlated with the root length. One of the main cytological bases for root elongation is the cell division of the meristem of the root tip, which defects in function or structure lead to the onset of short roots. Another major cytological basis for root elongation is elongation of cells in the elongation zone of the root tip, which is related to cell wall formation, cellulose synthesis, microtubule tissue formation, etc. Although root length plays an important role in plant yield and resistance, the root growth in soil increases the research difficulty, so that the genetic background and molecular mechanism of root elongation are hardly known, and the root length factor is not fully utilized in rice breeding and cultivation. Therefore, a series of genes for controlling the root length of the rice are isolated and cloned to facilitate the directional improvement of the properties of the root system of the rice, for example, the invention patent with the publication number of CN104031928B discloses a gene OsKASI related to the growth of the root system of the rice, wherein the gene OsKASI and the coded protein have mutation of some bases and amino acids, and the root system of the rice is expressed as a short root system.
Disclosure of Invention
The invention aims to solve the technical problem of providing a rice root elongation regulating gene OsDRP1C, which can inhibit or promote the elongation of a rice root system through missense mutation of one or more base pairs in a DNA sequence thereof and can create conditions for the root system improvement and cross breeding of rice or the development of transgenic plants.
In order to solve the problems, the technical scheme adopted by the invention is as follows:
the gene OsDRP1C is applied to regulating and controlling the elongation of the rice root system, and is used for regulating and controlling the elongation of the rice root system through missense mutation of one or more base pairs in a DNA sequence;
the gene OsDRP1C in TIGR is numbered LOC_Os03g50520, and contains the nucleotide sequence shown in SEQ ID NO:1, and a nucleotide sequence shown in the specification.
Compared with the prior art, the invention can realize the adjustment of the elongation performance of the root system of the rice by regulating and controlling the gene OsDRP1C with the number LOC_Os03g50520 in the TIGR and inhibiting or promoting the elongation of main root, adventitious root, lateral root and root hair cells of the rice through one or more base pair missense mutations in the DNA sequence.
A mutant of a rice root elongation regulatory gene OsDRP1C has the nucleotide sequence shown in SEQ ID NO:1, wherein the base at 2858bp of the DNA sequence is subjected to missense mutation, and thymine (T) is substituted by guanine (A). By inducing thymine (T) at 2858 of DNA sequence of gene OsDRP1C to be substituted by guanine (A), elongation of main root, adventitious root, lateral root and root hair cells of rice containing mutant of gene OsDRP1C can be inhibited, and growth of root of rice can be slowed down.
Protein encoded by a mutant of a rice root elongation regulatory gene OsDRP1C, wherein the amino acid sequence of the protein is shown in SEQ ID NO:2, and the tyrosine (Tyr) at position 233 of the amino acid sequence is mutated to a stop codon. The protein encoded by the mutant of the rice root elongation regulating gene OsDRP1C can inhibit the elongation of cells of the rice root system containing the protein and slow root growth.
An expression vector containing the rice root elongation regulatory gene OsDRP1C. The expression vector containing the rice root elongation modulation gene OsDRP1C can promote or inhibit the elongation of the root system of the rice containing the expression vector.
The expression vector of the rice root elongation regulating gene OsDRP1C is applied to the improvement of rice root traits. The expression vector is applied to the aspect of improving the root system characters of the rice, and can optimize the root system characters of the rice.
The application of the mutant of the rice root elongation regulating gene OsDRP1C in regulating the rice root traits. The mutant of the rice root elongation regulating gene OsDRP1C is applied to regulating the properties of the rice root system, so that the rice root system can be expressed as a short root system.
Drawings
FIG. 1 is a graph comparing phenotypes of Wild Type (WT) and Osdrp1c mutants in normal water for 7 days, a is a whole plant of 7-day-old mutants of Wild Type (WT) and Osdrp1c, bar=2.0 cm; b and c are observations of the principal roots of WT and Osdrp1c under the body view mirror, bar=1.0 mm;
FIG. 2 is a comparative graph of resin sections of main roots of Wild Type (WT) and Osdrp1c mutants grown normally in water for 7 days;
FIG. 3 is a map-based cloning and a gene structure diagram of an OsDRP1C gene, a is a fine localization result of the gene OsDRP1C, RM1350N is an SSR marker used for localization, in1, in2, in3 and In4 are newly developed polymorphic markers, OSJNBA0014G15 represents BAC cloning, and Rec represents recombinants; b is the structure and mutation site of the gene OsDRP1C, the intron is represented by a solid line, the untranslated region is represented by a hollow square, the exon is represented by a solid square, and the arrow indicates the mutation site;
FIG. 4 shows Wild Type (WT), osdrp1c mutant and two T strains 2 Transgenic lines (OV 1 And OV of 2 ) Is a phenotype map of (2);
FIG. 5 is a schematic diagram of the modified structure of the overexpression transformation vector pCAMBIA 1300.
Detailed Description
The invention will be further illustrated with reference to the following examples, which are to be understood as merely illustrative of the invention and not as limiting the scope of the invention.
Example 1
The embodiment provides the application of the gene OsDRP1C in regulating and controlling the elongation of the rice root system, wherein the elongation of the rice root system is regulated and controlled through missense mutation of one or more base pairs in the DNA sequence;
the gene OsDRP1C in TIGR is numbered LOC_Os03g50520, and contains the nucleotide sequence shown in SEQ ID NO:1, and a nucleotide sequence shown in the specification.
Compared with the prior art, the invention can inhibit or promote the elongation of main root, adventitious root, lateral root and root hair cells of rice by regulating gene OsDRP1C with the number LOC_Os03g50520 in TIGR and inhibiting or promoting the elongation performance of the root system of the rice by causing the defect of root tip meristem function or structure through one or more base pair missense mutations in the DNA sequence.
Example 2
The embodiment provides a mutant of a rice root elongation regulatory gene OsDRP1C and a protein encoded by the mutant, wherein the nucleotide sequence of the rice root elongation regulatory gene OsDRP1C is shown in SEQ ID NO:1, wherein the base at 2858bp of the DNA sequence is subjected to missense mutation, and thymine (T) is substituted by guanine (A); the amino acid sequence of the protein is shown in SEQ ID NO:2, and the tyrosine (Tyr) at position 233 of the amino acid sequence is mutated to a stop codon.
By inducing substitution of thymine (T) at 2858 of the DNA sequence of gene OsDRP1C with guanine (A) and correspondingly mutating tyrosine (Tyr) at 233 of the amino acid sequence of the encoded protein into a stop codon, the elongation of main root, adventitious root, lateral root and root hair cells of rice containing the mutant of gene OsDRP1C or the encoded protein thereof can be inhibited, and the growth of the root of rice can be slowed.
The embodiment also provides application of the mutant of the rice root elongation regulating gene OsDRP1C in regulating and controlling rice root traits. The mutant of the rice root elongation regulating gene OsDRP1C is applied to regulating the properties of the rice root system, so that the rice root system can be expressed as a short root system.
Example 3 phenotype and genetic analysis of mutants
A rice short root mutant Osdrp1c was selected from a Kasalath mutant pool of ethyl methylsulfonate-induced indica rice (Oryza Sativa L. Ssp indica). Root elongation of the 7-day-old Osdrp1c mutant was severely inhibited, and main root, adventitious root, lateral root and root hair were shortened (fig. 1). The inhibition of cell elongation of mutant Osdrp1c resulted in significantly shorter main root length than the wild type, wider cells in the mature and elongated regions of the mutant and slightly narrower cells in the meristematic region, resulting in thicker mutant root lines but slightly smaller root tips (fig. 2). Therefore, osDRP1C gene can be obtained by controlling rice rootThe length and width of the cells of the line are further regulated and controlled to further control the growth and development of the root system. The mutant Osdrp1c is used as a male parent and hybridized with the wild Kasalath to obtain a first-generation F1 plant which is completely consistent with the wild Kasalath, which shows that the Osdrp1c is recessive mutation. In F2 obtained by F1 self-pollination, the separation ratio of normal plants to short root plants is 379/131=2.89, and the chi-square detection result is 0.13<χ 2 0.05,1 =3.84, the ratio of normal plants to short root plants corresponds to 3 of a pair of genetic controls: 1, indicating that the mutant is a recessive single gene mutant.
Example 4 localization of OsDRP1C Gene
Short root mutant individuals were isolated from the filial generation F2 of the mutant Osdrp1c and Nipponbare, and the mutant genes were located by the gene Map-based Cloning method (Map-based Cloning). Initial mapping (30F 2 mutant individuals) mutant genes were mapped between chromosome 3 SSR markers RM1350N and RM 5813N. Then, the locating population was expanded, and 4 pairs of novel InDel molecular markers with polymorphism were developed In the interval, named as In1, in2, in3 and In4 respectively, and the sequences were as follows:
In1U-5’ACCTCCTCCTCCGCCAGCTCC 3’
In1L-5’AAATCTCCTCGCCCTTCTTCCC 3’
In2U-5’TGCCCACTGATTAGCCGTAG 3’
In2L-5’GGATAGAGATGCCCATAGATTTG 3’
In3U-5’GCGGTGTTTATCAGATTGGT 3’
In3L-5’TAAATAGATACTCCATCGGCTTA 3’
In4U-5’CGCCAATGGTGTGTAGGAGGA 3’
In4L-5’CCGTTATGCCGTCCACAGATG 3’
finally, the gene is locked between InDel markers In2 and In3 (specific physical positions on chromosome 3 are 28821343bp and 28952920bp respectively), recombinants are 3/1112 and 3/1112 respectively, and the recombination numbers are different. This interval has a size of 131.2kb (FIG. 3).
Example 5 Gene prediction and sequence analysis
According to the result of fine localization, osDRP1C gene was located on BAC clone OSJNBa0014G15 (fig. 3). According to the rice gene annotation information of TIGR (http:// www.tigr.org/tdb/e2k1/osa1 /), 19 predicted genes are integrated in the positioned chromosome segment, the candidate 19 genes are amplified by using Kasalath wild type and Osdrp1C mutant DNA templates, the amplified products are respectively sequenced, the sequencing result is compared and analyzed, and the 2858bp thymine (T) of the DNA sequence of the gene with the gene number LOC_Os03g50520 (Dynamin related protein) is replaced by guanine (A), thereby leading to the 233-bit tyrosine (Tyr) mutation of the coded amino acid sequence as a stop codon, and the gene is named as OsDRP1C.
Example 6OsDRP1C functional complementation experiment
According to CDS sequence information of the OsDRP1C gene, designing a primer for amplifying the complete CDS, wherein the primer sequence is as follows (enzyme cutting sites are underlined):
OsDRP1C-CDSU：5’TGAGCCGGAGACTACAGCGAC 3’
OsDRP1C-CDSL：5’AACCGATCATTTCCACGCGAC 3’；
OsDRP1C-OVU：5’AAAGAGCTCCTTTGCCCGAGATGGCGACGA3’
OsDRP1C-OVL：5’AAATCTAGAAACCGATCATTTCCACGCGAC3’；
extracting total RNA of leaves of rice kasalash by using an Shanghai worker RNA extraction kit (SK 1321), and carrying out reverse transcription by using Oligo (dt) -18 as a primer and using the extracted total RNA as a template to synthesize first-strand cDNA. Using this cDNA as template, osDRP1C-CDSU and OsDRP1C-CDSL as primers, full-length ORF was amplified using PrimeSTAR HS DNA Polymerase, PCR conditions: the reaction is carried out for 10s at 98 ℃, then the reaction is carried out in a circulating way (10 s at 98 ℃, 10s at 58 ℃ and 72 ℃ for 2 min), the circulating number is 30, and finally the extension is carried out for 10 min. The PCR product was recovered by agarose electrophoresis tapping, purified and ligated into pEASY-Blunt Simple Cloning Vector vector. E.coli DH5 alpha competent cells are transformed by thermal shock of the connection product, positive monoclonal sequencing is carried out after the connection product is cultured for 16 hours at 37 ℃, after sequencing identification sequences are correct, the recombinant vector is used as a template, osDRP1C-OVU and OsDRP1C-OVL are used as primers, full-length ORF is amplified by PrimeSTAR HS DNA Polymerase, and PCR conditions are as follows: the reaction is carried out for 10s at 98 ℃, then the reaction is carried out in a circulating way (10 s at 98 ℃, 10s at 58 ℃ and 72 ℃ for 2 min), the circulating number is 30, and finally the extension is carried out for 10 min. The PCR product was recovered by agarose electrophoresis and double digested with SacI and XbaI overnight at 37℃and ligated into the same double digested pCAMBIA1300 modified (35S) vector (FIG. 5), designated 35S-OsDRP1COVER. The ligation products were heat-shock transformed into E.coli DH 5. Alpha. Competent in the same manner, plated on LB plates containing kan resistance for 16h, picked up for single clone, double digested with shaking extract plasmid and shock transformed into Agrobacterium EHA105 after correct detection by agarose gel.
The plasmid with correct enzyme cutting detection is guided into a mutant Osdrp1c through an agrobacterium strain EHA105 mediated rice genetic transformation system, and is subjected to infection, co-culture, screening, callus with hygromycin resistance, differentiation, rooting and seedling hardening transplanting to obtain a transgenic plant. Agrobacterium (EHA 105) -mediated genetic transformation of rice was optimized based on the method reported by Hiei et al (1994). The root length of the isolated Osdrp1C mutant in the transgenic plant was restored to wild type (fig. 4), indicating that the phenotype of Osdrp1C was indeed caused by Osdrp1C mutation.
Although the present disclosure is described above, the scope of protection of the present disclosure is not limited thereto. Various changes and modifications may be made by one skilled in the art without departing from the spirit and scope of the disclosure, and these changes and modifications will fall within the scope of the invention.
Sequence listing
<110> university of Ningbo science and technology school
<120> mutant, protein and expression vector of rice root elongation regulatory gene OsDRP1C and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 5948
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
ggtactaaaa aaaatttttc cttcgatttc tctcgcctcc gcttctccac tctccggtag 60
atcccaccct ccaccgccgc cgccgccgcc gtgctccggt gagccgccgg tgagccggag 120
actacagcga cgtcgcgcag agccgttggg cgggtaggcg gttgggggct ttgcccgaga 180
tggcgacgat ggggagcctg atcgggctgg tgaaccggat ccagcgggcg tgcaccgtcc 240
tcggcgacca cgggggcggc ggcgaggggg gttccctctg ggaggcgctg ccctccgtcg 300
ccgtcgtcgg aggccaggta cgcgtgctcg ccaccaccct gcgtacctac ctctcagatc 360
caaagccatg gcggccagat ctggatatgg cgctcacccc ccttcggttt gcgtttgtga 420
tgcatccaga gttccgggaa gtcgtcggtg ctcgagagca tagtggggag ggacttcctg 480
cctcgtggat ccggtaatgc cgacgctgga tcgctcgttt ttttttcttt tttcgcgcgc 540
catttcgtct ggatcggctt ggtttgcgag ggattaatgc gcattctctc ggtttgatta 600
ggaatcgtga cgaggaggcc tcttgtgctg cagctgcaca agacggaggg tgggcaggag 660
tacgccgagt tcctccacgc cccgcggaag cgtttcactg actttggtaa gggatcattg 720
ccatatttgt gctttgcagt ccagcaggtt gatttgtgta ttcaatttca tttattagag 780
ttagtgttgt gcaaacttca aagttgtctt aattccaacg agtagacttt tccacgagag 840
atcagcaagg aggatgatac cgctttccct ggttatagtt tacttcactg aagtttgcct 900
atcaacctaa aaacaagaac atatacaatt agcatccaca cattgctata tgcagtgtga 960
actaaggaac taatgacgtt taggagtaga tctcacaagt cacaatcact gtaggatact 1020
agtgagtatc tgagcaaagt tatttcccgg ttcattacta gtgtcctaac atagctattg 1080
caagagatgt tcagttgaaa tatttaaatt ctttgtataa ttgcagctgc tgttaggaaa 1140
gagattgctg atgaaaccga tcgcattact ggaaaaacga aagctatatc aaatattccc 1200
atccatttga gtatatattc tccacatggt aagtcttgat gcttgttttg aacttttggt 1260
atgtgatgtg tactatgaat gtttcattca aacagaacct gcttcgctga ctcgctctca 1320
gctcccccaa atgcctgtaa actttaaatt gtatgttgtg gatgaaattt gggatcaata 1380
ggatgtagac tgataatttc tactattact tttacatttt taaatttgga ttcctttcag 1440
gatttatccc ttataattct tcaaaacttg agagctggca tatgtttcct ttaaaaaaaa 1500
tgtatatttg ctctgctctc cacctgttct tagttctgat gttggtctaa acccctccat 1560
tgtggtcctt tcagactaat cacaccaaac tgtatgaggc atctctgcag atttatatta 1620
gcacttcaaa atttcatgtt tgatattaat aatcgaccct gctttatatg caacaaaatt 1680
aagcatcaaa atattgacta tagaaacaat tcaaaaggtg tacataaaag gaatcattct 1740
ggaaatctat ttcttaaccc tgaggaacaa ataatcatat tatgataatt tgaaagtagt 1800
tacattgtgc ttgtgctgca gcatatgacc tgttatatag agacgttttg tgctcagcag 1860
atcctagtcc ttgtcataaa ttttttcact aatgtaattt tgcacccatt ttcttgcagt 1920
tgtaaacctg acacttattg atcttcctgg attgacgaag gttgctgtag gtatgttttc 1980
ttggatgctt ctagttttct atgcgtactc tttttatgtg attgtttgtg acacgaactt 2040
tttattaaca gaggggcaac aagaatctat tgtccaagat attgaaaaca tggttcggtc 2100
ttatgttgat aaggtaaaag aagtctgttg catgccatta gtgccatgtt tattttagct 2160
ccatgtgcta cattcactta atgagtactg tccaccctgc catatcaatt ctaagcttta 2220
ctattgttct tgtccaatgt ttatttgtgg tgacagtttt tttttctggg gtgggtagtg 2280
ggtactacga gtcaagtcta gaaacattat tcttttgttc tctggcctgt cttatggtca 2340
tgctaatata acttaatgta tttctatatg ctgcaaattc tgcttggtca tgttctgatt 2400
aaaactgttc atttttgttc ctacatttgt tctttttgga aacttcagcc aaattctatc 2460
atactggcca tatctccagc taatcaagat atagcaacat cagatgctat caagcttgct 2520
agggatgttg atccttcagg tacattttat attttcttca ctgtggcatt tcaaatattt 2580
ctcacatatg acaataattt tatgcatatt ttattttatt gccatacagc agtattgcag 2640
tgatctgtct tgttccattc ttatctgttg acaatttatt tcataatatt tttaggtgac 2700
agaacctttg gagtgttgac aaagcttgat ttgatggata agggtaccaa tgctgttgat 2760
gtatgtgact tgtcattttt tcttaactct tgtacgctat ggacacagca ctcattttca 2820
acgccatgta atcctaggta cttgaaggga ggcagtatcg tttgcaacac ccctgggtgg 2880
gaattgtcaa ccggtcacaa gctgatatca acaggaatgt cgacatgcta gcagcaagac 2940
gcaaagaaaa ggagtacttt gaaagtagcc cagattatgg tcacttggca cataaaatgg 3000
gtgcagagta ccttgctaag cttctgtctc aggtcagggc attttgctat tgtggtgtac 3060
tttccctctc cccaaaaaat aactggattg aaaaggctga ctgctgatac acttctattt 3120
acacattcag cacttagagg ctgtgatcag agcaaaaatt ccaagtatta tagccatgat 3180
taacaaaaca attgatgaaa ttgaagctga gttggatcgc cttggtaggc caattggagg 3240
tgatgctggg gtaagaaaaa ccgtactttg cttgttgtaa ctttctgcaa gtgttcaggt 3300
tcatgttgtt cgtgccacaa cctgcaacat tcatttgaat ggcaccctag cacattatct 3360
attcccaaac catgtctaca tcatgctgtc tcataaactt atcataatct acaggcacaa 3420
ctgtacacaa tattggacat gtgtcgtgcg tttgaccgag tttttaaaga gcacctagat 3480
ggcgggtaag atattttatt aggccctttt cttgagtgct gttgcttttt atgccatata 3540
tattgataaa tagtatccca tagatgaatg gcaaagaatc tacaggcatg ttaataacac 3600
tcaattattt tttgttctct tagtcggcca ggtggagatc gtatttatgg tgtctttgac 3660
caccaattac cagcagcact gaaaaagctt ccatttgata agcatctttc attgcaaaat 3720
gttcggaaag tcatttcaga ggctgatggt tatcaacccc acttgattgc ccctgagcaa 3780
gggtacagaa ggcttataga tagttcgctc cactacttca ggggtccagc ggaagcttca 3840
gttgatgcgg tatacttctc atcaatagat cttctttagg cacttttaat ttaattatta 3900
agcaagtagg atcctgttcc aatgactgat atatagactt acataaacta gccttttctt 3960
atccaatata tacattttcc ccctgtgttg aacaactaaa acatcatatg agaagattgc 4020
agaaccatga cgagcttctt gtcaaagtag tgaatataag agtgcttaag ttcatcaagt 4080
gctcaattgc ggaaagagag ggatactata gatttaattg gaatgtacca tttgtttatt 4140
caacaaagga aggcatttga ttccagtgct tttgggggca ttttcatatg tcaagccata 4200
ttgcactacg tctgttttgt tcactacatc tggttgatta tgttctcgta tctgctaggt 4260
tcatttggtc ttgaaggaac ttgttcgtag atcgattgca gcaacagagg tttgtgttga 4320
ttttcaattc tcagtgaacc tcagtagata ttactgatca ctcaatgaca ctcctgcatt 4380
gactgtttac attggttatc ttggatgcca caggagttga agcgtttccc aacacttcag 4440
acagatatag ctgctgcagc aaatgaaagc ctggaaagat ttcgtgagga tggtcgaaag 4500
acagttattc gtcttgttga gatggaggcc agctacctaa ctgtagaatt tttcagaaaa 4560
ctccctacag aaccagataa gggggctaat aataacactc cagccaatga cagatatcag 4620
gacaaccatt taagaagaat cggtaacaat tcaacattct attttgtttc tttaatggca 4680
attgattgag tcaactgttc taagacctca acacagaggt cacacgaagt acttaacaaa 4740
ctgacttaat aagcagaatc taagatgtaa catagggtac tagtgccatt cacgttctgc 4800
tgagtgctga cactagcaaa catgtcaaga tatgaccata tgtgaatttc gatgacaaca 4860
attatgcgaa ctaatttttt aaatcgacaa agtatattca tgacatcatc attgttttat 4920
tcagggtcaa atgtatcatc ttacattaac atggtttgtg agacattgag gaacaccatt 4980
ccaaaagctg tggtgcactg tcaagtgaag gaggcaaaaa gaaacttgct taaccgtttc 5040
tatgctcatg tgggaagcaa ggaggtatgt tttatactac cttagttcaa aactaaaaaa 5100
agataacgtg tttcatagtg attagaaagt tggctcataa ttaatatcga gtaaattgca 5160
ctctacttca aaatattaac catccatttc aaaatatatg tacactgtat ttgtggctaa 5220
atgaaaattt tcttgtttta tccttgtgtc gcattgattt gcacatttat attaacttgg 5280
acaccatttg ctttttattt ccataacgca gaagaaacag ctcagcgcga tgttggatga 5340
ggatcccgct ttgatggaga agagggattc cttagtcaag aggctagagc tgtacaaatc 5400
tgcccggaac gagatcgact cagtcgcgtg gaaatgatcg gttagcgaag tcacagctgg 5460
aagagataga catacatctg cgacacacag atcattgccg tagaatgctc taattccatt 5520
tacgtctgga ttcacatgga gatccgtaca ctattctttc tttctttttt ctttcatgcg 5580
agtgtccttt ctaccttgtc agacaagtat atttccttgg ccatcttggc ctttttgtat 5640
gatgttgatg atgatgagct ggtcctccgg gatcacactg atatgaatgc agatatatat 5700
attctttgtt gatttagcac ctccactgat atatcatgag agattttaga tgccttgttg 5760
ccaactgaaa ggatccgcat tcttggtaga gctacatttt ttgctaatgg aggcggctct 5820
tgaagtcgtc ccatggaaga tccttctcca ggtactcgat gttggtggga ttgaacgggc 5880
ccctcaccac gtccaccgtc tgtatgatcg ccctctccgg cagcacgctc atcgctggat 5940
ccgccgcc 5948
<210> 2
<211> 611
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Met Ala Thr Met Gly Ser Leu Ile Gly Leu Val Ala Ala Ile Gly Ala
1 5 10 15
Ala Cys Thr Val Leu Gly Ala His Gly Gly Gly Gly Gly Gly Gly Ser
20 25 30
Leu Thr Gly Ala Leu Pro Ser Val Ala Val Val Gly Gly Gly Ser Ser
35 40 45
Gly Leu Ser Ser Val Leu Gly Ser Ile Val Gly Ala Ala Pro Leu Pro
50 55 60
Ala Gly Ser Gly Ile Val Thr Ala Ala Pro Leu Val Leu Gly Leu His
65 70 75 80
Leu Thr Gly Gly Gly Gly Gly Thr Ala Gly Pro Leu His Ala Pro Ala
85 90 95
Leu Ala Pro Thr Ala Pro Ala Ala Val Ala Leu Gly Ile Ala Ala Gly
100 105 110
Thr Ala Ala Ile Thr Gly Leu Thr Leu Ala Ile Ser Ala Ile Pro Ile
115 120 125
His Leu Ser Ile Thr Ser Pro His Val Val Ala Leu Thr Leu Ile Ala
130 135 140
Leu Pro Gly Leu Thr Leu Val Ala Val Gly Gly Gly Gly Gly Ser Ile
145 150 155 160
Val Gly Ala Ile Gly Ala Met Val Ala Ser Thr Val Ala Leu Pro Ala
165 170 175
Ser Ile Ile Leu Ala Ile Ser Pro Ala Ala Gly Ala Ile Ala Thr Ser
180 185 190
Ala Ala Ile Leu Leu Ala Ala Ala Val Ala Pro Ser Gly Ala Ala Thr
195 200 205
Pro Gly Val Leu Thr Leu Leu Ala Leu Met Ala Leu Gly Thr Ala Ala
210 215 220
Val Ala Val Leu Gly Gly Ala Gly Thr Ala Leu Gly His Pro Thr Val
225 230 235 240
Gly Ile Val Ala Ala Ser Gly Ala Ala Ile Ala Ala Ala Val Ala Met
245 250 255
Leu Ala Ala Ala Ala Leu Gly Leu Gly Thr Pro Gly Ser Ser Pro Ala
260 265 270
Thr Gly His Leu Ala His Leu Met Gly Ala Gly Thr Leu Ala Leu Leu
275 280 285
Leu Ser Gly His Leu Gly Ala Val Ile Ala Ala Leu Ile Pro Ser Ile
290 295 300
Ile Ala Met Ile Ala Leu Thr Ile Ala Gly Ile Gly Ala Gly Leu Ala
305 310 315 320
Ala Leu Gly Ala Pro Ile Gly Gly Ala Ala Gly Ala Gly Leu Thr Thr
325 330 335
Ile Leu Ala Met Cys Ala Ala Pro Ala Ala Val Pro Leu Gly His Leu
340 345 350
Ala Gly Gly Ala Pro Gly Gly Ala Ala Ile Thr Gly Val Pro Ala His
355 360 365
Gly Leu Pro Ala Ala Leu Leu Leu Leu Pro Pro Ala Leu His Leu Ser
370 375 380
Leu Gly Ala Val Ala Leu Val Ile Ser Gly Ala Ala Gly Thr Gly Pro
385 390 395 400
His Leu Ile Ala Pro Gly Gly Gly Thr Ala Ala Leu Ile Ala Ser Ser
405 410 415
Leu His Thr Pro Ala Gly Pro Ala Gly Ala Ser Val Ala Ala Val His
420 425 430
Leu Val Leu Leu Gly Leu Val Ala Ala Ser Ile Ala Ala Thr Gly Gly
435 440 445
Leu Leu Ala Pro Pro Thr Leu Gly Thr Ala Ile Ala Ala Ala Ala Ala
450 455 460
Gly Ser Leu Gly Ala Pro Ala Gly Ala Gly Ala Leu Thr Val Ile Ala
465 470 475 480
Leu Val Gly Met Gly Ala Ser Thr Leu Thr Val Gly Pro Pro Ala Leu
485 490 495
Leu Pro Thr Gly Pro Ala Leu Gly Ala Ala Ala Ala Thr Pro Ala Ala
500 505 510
Ala Ala Thr Gly Ala Ala His Leu Ala Ala Ile Gly Ser Ala Val Ser
515 520 525
Ser Thr Ile Ala Met Val Cys Gly Thr Leu Ala Ala Thr Ile Pro Leu
530 535 540
Ala Val Val His Cys Gly Val Leu Gly Ala Leu Ala Ala Leu Leu Ala
545 550 555 560
Ala Pro Thr Ala His Val Gly Ser Leu Gly Leu Leu Gly Leu Ser Ala
565 570 575
Met Leu Ala Gly Ala Pro Ala Leu Met Gly Leu Ala Ala Ser Leu Val
580 585 590
Leu Ala Leu Gly Leu Thr Leu Ser Ala Ala Ala Gly Ile Ala Ser Val
595 600 605
Ala Thr Leu
610
Claims (5)
1. A rice root system elongation gene OsDRP1C mutant is characterized in that the number of the rice root system elongation gene OsDRP1C in TIGR is LOC_Os03g50520, the rice root system elongation gene OsDRP1C mutant contains a nucleotide sequence shown in SEQ ID No.1, the 2858bp basic group is subjected to missense mutation on the basis of the DNA shown in SEQ ID No.1, and thymine is replaced by guanine to form the rice root system elongation gene OsDRP1C mutant.
2. A protein encoded by the rice root elongation gene OsDRP1C mutant according to claim 1, characterized in that the amino acid sequence of the protein is a stop codon sequence of-TAA-mutated from the tyrosine codon sequence at position 233 on the basis of the sequence shown in SEQ ID No. 2.
3. An expression vector, which contains the sequence of the rice root elongation gene OsDRP1C mutant according to claim 1.
4. Use of the expression vector containing the sequence of the rice root elongation gene OsDRP1C mutant according to claim 3 in improving rice root traits.
5. An application of the rice root elongation gene OsDRP1C mutant according to claim 1 in regulation of rice root traits.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210463032.XA CN114807221B (en) | 2022-04-28 | 2022-04-28 | Mutant, protein and expression vector of rice root elongation regulatory gene OsDRP1C and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210463032.XA CN114807221B (en) | 2022-04-28 | 2022-04-28 | Mutant, protein and expression vector of rice root elongation regulatory gene OsDRP1C and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114807221A CN114807221A (en) | 2022-07-29 |
| CN114807221B true CN114807221B (en) | 2023-06-06 |
Family
ID=82509237
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210463032.XA Active CN114807221B (en) | 2022-04-28 | 2022-04-28 | Mutant, protein and expression vector of rice root elongation regulatory gene OsDRP1C and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114807221B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102858998A (en) * | 2009-11-25 | 2013-01-02 | 雀巢产品技术援助有限公司 | Novel genomic biomarkers for irritable bowel syndrome diagnosis |
| CN103898115A (en) * | 2014-04-01 | 2014-07-02 | 复旦大学 | Rice high-expression promoter related to development stage and application thereof |
| CN104031928A (en) * | 2014-05-19 | 2014-09-10 | 宁波大学 | Rice root elongation control gene OsKASI and encoded protein |
| CN104211809A (en) * | 2013-05-31 | 2014-12-17 | 中国农业科学院作物科学研究所 | Application of synthetic transcription factor VP64-linker-Os03g11370 to improve paddy rice grain properties |
| EP2957637A2 (en) * | 2009-04-29 | 2015-12-23 | BASF Plant Science Company GmbH | Plants having enhanced yield-related traits and a method for making the same |
| US11220694B1 (en) * | 2018-01-29 | 2022-01-11 | Inari Agriculture, Inc. | Rice cells and rice plants |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011079197A2 (en) * | 2009-12-23 | 2011-06-30 | Grassroots Biotechnology, Inc. | Regulatory polynucleotides and uses thereof |
| US20110197316A1 (en) * | 2010-02-08 | 2011-08-11 | Clemson University | Methods and compositions for transgenic plants with enhanced abiotic stress resistance and biomass production |
| WO2013012885A2 (en) * | 2011-07-19 | 2013-01-24 | Grassroots Biotechnology, Inc. | Regulatory polynucleotides and uses thereof |
| WO2014091255A1 (en) * | 2012-12-14 | 2014-06-19 | Isis Innovation Limited | Transgenic plants |
| CN103214581B (en) * | 2013-03-29 | 2014-12-10 | 中国农业科学院作物科学研究所 | Application of synthetic transcription factor VP64-Os03g57670 |
| US20150082475A1 (en) * | 2013-04-26 | 2015-03-19 | International Rice Research Institute | Root Growth, Nutrient Uptake, and Tolerance of Phosphorus Deficiency in Plants and Related Materials and Methods |
| CN104341514B (en) * | 2013-07-31 | 2017-11-07 | 中国农业科学院作物科学研究所 | The application of rice transcription factor Os03g05590.1 gene C DS sequences |
| CN105505981B (en) * | 2015-12-30 | 2018-12-25 | 中国农业科学院作物科学研究所 | A kind of resistance glyphosate genetically engineered soybean and the preparation method and application thereof |
| CN111826392B (en) * | 2020-07-28 | 2022-04-01 | 河南大学 | Application of rice gene LJS5-2 and homologous gene thereof in controlling growth of leaf pillow and leaf angle of rice |
| CN112280784B (en) * | 2020-10-30 | 2022-12-02 | 宁波大学科学技术学院 | Rice lateral root development control gene OsLRD2, encoding protein and application thereof |
-
2022
- 2022-04-28 CN CN202210463032.XA patent/CN114807221B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2957637A2 (en) * | 2009-04-29 | 2015-12-23 | BASF Plant Science Company GmbH | Plants having enhanced yield-related traits and a method for making the same |
| CN102858998A (en) * | 2009-11-25 | 2013-01-02 | 雀巢产品技术援助有限公司 | Novel genomic biomarkers for irritable bowel syndrome diagnosis |
| CN104211809A (en) * | 2013-05-31 | 2014-12-17 | 中国农业科学院作物科学研究所 | Application of synthetic transcription factor VP64-linker-Os03g11370 to improve paddy rice grain properties |
| CN103898115A (en) * | 2014-04-01 | 2014-07-02 | 复旦大学 | Rice high-expression promoter related to development stage and application thereof |
| CN104031928A (en) * | 2014-05-19 | 2014-09-10 | 宁波大学 | Rice root elongation control gene OsKASI and encoded protein |
| US11220694B1 (en) * | 2018-01-29 | 2022-01-11 | Inari Agriculture, Inc. | Rice cells and rice plants |
Non-Patent Citations (2)
| Title |
|---|
| Rice Brittleness Mutants: A Way to Open the ‘Black Box’ of Monocot Cell Wall Biosynthesis;Journal of Integrative Plant Biology(第02期);全文 * |
| 隐失波荧光显微镜及其在植物细胞生物学中的应用;范路生;薛轶群;王晓华;王钦丽;林金星;;电子显微学报(第01期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114807221A (en) | 2022-07-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107164347B (en) | Ideal plant type gene NPT1 for controlling rice stem thickness, tillering number, spike grain number, thousand grain weight and yield and its application | |
| US9663794B2 (en) | Heat-resistance rice gene OsZFP, screening marker and separation method thereof | |
| CN111172173B (en) | Method for reducing plant height of corn or delaying flowering | |
| CN113845578A (en) | MYB transcription factor for regulating and controlling plant procyanidine synthesis, and coding gene and application thereof | |
| CN109456396B (en) | Rice leaf senescence and panicle type regulation gene HK73, and protein, molecular marker and application encoded by gene HK73 | |
| CN114807221B (en) | Mutant, protein and expression vector of rice root elongation regulatory gene OsDRP1C and application thereof | |
| CN115894646B (en) | OsJDG1 gene and application thereof in regulation of rice grain type and thousand grain weight | |
| CN111621504A (en) | Stress-resistant gene BjuIBS of tumorous stem mustard and application thereof | |
| CN112280784B (en) | Rice lateral root development control gene OsLRD2, encoding protein and application thereof | |
| KR100360305B1 (en) | How to shorten the node spacing of flowering following the introduction of SPEL 2 to the warrior petpet obtained from Petunia | |
| CN114230648B (en) | Application of rice gene PANDA in improving plant yield | |
| CN111826391A (en) | Application of NHX2-GCD1 double genes or protein thereof | |
| CN102485896B (en) | Regulatory gene OsNAC2 of grain number of rice panicle, its expression system and application | |
| AU764930B2 (en) | Plant photoperiod sensitivity gene and use of the same | |
| US8461414B2 (en) | Gene having endoreduplication promoting activity | |
| CN108997486B (en) | Plant root development related protein and coding gene and application thereof | |
| CN109852624B (en) | Rice root elongation control gene OsNDPK4 and encoded protein | |
| EP1164193A1 (en) | Plant-signalling ligand like proteins | |
| CN102675437B (en) | Method for adjusting size of plant organs and inside asymmetry of floral organs | |
| CN101906154B (en) | Protein for adjusting green turning process of plant leave as well as coding gene and application thereof | |
| CN110950944A (en) | OsHCRF1 functional protein and application of coding gene thereof in rice breeding | |
| CN109628462B (en) | Rice root elongation control gene OsKSR7 and encoded protein | |
| CN115216487B (en) | Gene NSP1 for regulating rice yield formation and application thereof | |
| CN113549135B (en) | Limonium bicolor gene LbCPC and application thereof | |
| CN114516908B (en) | Rice grain shape regulatory protein HOS59, encoding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |