CN111621504A - Stress-resistant gene BjuIBS of tumorous stem mustard and application thereof - Google Patents

Abstract

The invention discloses a stress-resistant gene of tumorous stem mustardBjuIBSAnd the use thereof, saidBjuIBSThe nucleotide sequence of the gene is shown as SEQ ID NO.1, and the coded amino acid sequence is shown as SEQ ID NO. 2. The present invention has foundBjuIBSThe protein and the transgenic arabidopsis thaliana plant obtained by overexpression of the coding gene thereof have salt resistance and ABA resistance, the invention provides a high-efficiency stress-resistant gene for plant gene modification engineering, and lays an experimental base for promoting the development of functional genomics of tumorous stem mustardOn the basis, a theoretical basis is provided for cultivating new varieties of the stress-tolerant stable-yield tumorous stem mustard in actual production, and the method has important application value for agricultural production in China.

Description

Stress-resistant gene BjuIBS of tumorous stem mustard and application thereof

Technical Field

The invention belongs toIn particular to a stress-resistant gene of tumorous stem mustard in the technical field of plant genetic engineeringBjuIBSAnd applications thereof.

Background

Abiotic stresses such as drought, high salinity and the like are main stress factors influencing plant growth and crop yield, seriously influence the growth and development of plants, reduce crop yield and restrict the sustainable development of economy. Effective measures have long been sought to cultivate crops that are resistant to abiotic stresses and to grow under various adverse conditions. With the development of molecular biology, it becomes a feasible scheme to improve crop stress resistance genes by genetic engineering and culture new species with stress resistance.

Stem of Oncomelania (C. Turcz.) (Brassicajunceavar.tumidaTsen et Lee), also called broccoli head, is a brassica plant of cruciferae, is a main raw material of tuber mustard, and is one of the main economic crops in Chongqing, Sichuan, Zhejiang and other areas in China. For years, the research on the stem tumor mustard mainly focuses on the fields of genetic breeding, improved variety breeding, cultivation technology, quality safety and the like, and the research on biology is continuously reported only in recent years. Previous studies have shown that tumorous stem mustard has a strong resistance to abiotic stress, and a plurality of adversity stress related genes have been obtained from tumorous stem mustard at present. For example, patent CN104328127A discloses a tumorous stem mustard-derived stress-resistant geneBjEFh1Plant expression vector and application thereof, and stress-resistant geneBjEFh1The application of the plant protein in improving the stress tolerance of the plant, particularly improving the tolerance of the plant under high salt conditions. The invention patent CN103243108A discloses a calcium ion binding protein derived from tumorous stem mustard and a gene and application thereof,BjCBP1the gene is over-expressed under the promotion of CaMV35S promoter, and a large amount of BjCBP1 protein is synthesized, so that the stress tolerance of plants can be improved. However, the current effective candidate genes with stress resistance function are relatively scarce and a large blank still exists in the research on the tumorous stem mustard stress resistance gene. Therefore, the screening of the gene with excellent stress resistance function in the tumorous stem mustard can enrich the tumorous stem mustard stress resistance gene bank, can also provide germplasm resources for cultivating high-quality stress resistance varieties, and has important theoretical significance and application value.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide the stress-resistant gene of tumorous stem mustardBjuIBSProvides a new candidate gene for the genetic modification of breeding stress-resistant crop varieties.

In order to achieve the purpose, the invention adopts the following technical scheme: stress-resistant gene of tumorous stem mustardBjuIBSThe nucleotide sequence is shown as SEQ ID NO.1 or the nucleotide sequence with the same function is obtained by replacing, deleting or inserting one or more nucleotides in the nucleotide sequence shown as SEQ ID NO. 1.

The invention also provides the stress-resistant gene of the tumorous stem mustardBjuIBSThe coded protein has an amino acid sequence shown as SEQ ID NO.2 or an amino acid sequence with the same function obtained by replacing, deleting or inserting one or more amino acids in the amino acid sequence shown as SEQ ID NO. 2.

The invention also provides a stress-resistant gene containing the tumorous stem mustardBjuIBSThe plant expression vector of (1).

The invention also provides a stress-resistant gene containing the tumorous stem mustardBjuIBSThe host cell of (1).

Another object of the present invention is to provide the stress-resistant gene of tumorous stem mustardBjuIBSThe application in improving the stress resistance of plants. Further, the stress resistance is resistance to high salt or/and abscisic acid environments.

Another object of the present invention is to provide a method for increasing stress resistance of a plant, which comprises introducing the plant expression vector or the host cell into a plant cell to make a geneBjuIBSAnd (4) overexpression. Further, the plant is a monocotyledon or a dicotyledon. Preferably, the dicotyledonous plant is arabidopsis thaliana or stem tumor mustard and the like.

Compared with the prior art, the invention has the following beneficial effects:

1. the invention clones the stem tumor mustard for the first timeBjuIBSThe full-length gene sequence, the protein sequence coded by it, and the biological engineering technique for resisting the stress in stem mustardGeneBjuIBSThe transgenic gene is introduced into other plants, so that the plants can still have higher tolerance under the conditions of salt stress (NaCl) and abscisic acid (ABA). The research provides a high-efficiency stress-resistant gene for plant genetic modification engineering, lays an experimental foundation for promoting the development of functional genomics of the stem tumor mustard, also provides a theoretical foundation for cultivating new varieties of the stress-resistant stable-yield stem tumor mustard in actual production, and has important application value for agricultural production in China.

2. The invention is proved by experimentsBjuIBSOverexpression of plants showing resistance to salt and ABA treatment, genes are indicatedBjuIBSParticipating in the abiotic stress regulation process of plants. The method provides a foundation for artificially controlling the expression of stress-resistant and stress-tolerant related genes, and the high-quality stress-resistant crop variety cultured by the method can keep the crop yield under the abiotic stress conditions, and has great application value.

Drawings

FIG. 1 shows genes in an adverse environmentBjIBSThe level of transcription of (a); a is abscisic acid; b is sodium chloride.

FIG. 2 shows genesBjIBSSpatiotemporal expression at different tissue sites.

FIG. 3 shows genesBjIBSThe subcellular localization analysis of (a); the tobacco leaves under fluorescence are arranged from left to right in sequence; tobacco leaves under a blend of fluorescent and white light conditions; tobacco leaf under white light.

FIG. 4 shows the expression of transgenic Arabidopsis thalianaBjIBSQuantitative expression analysis of genes.

FIG. 5 is a graph showing the effect of transgenic Arabidopsis on abscisic acid resistance; a is Arabidopsis thaliana wild type on MS medium and MS medium containing 0.5 mu MABA, respectivelyCol-0AndBjuIBSphenotypic analysis of the over-expressed strain in the germination stage and the green turning stage; b is Arabidopsis thaliana wild type on MS medium and MS medium containing 0.5. mu.M ABA, respectivelyCol-0AndBjuIBSanalyzing the germination rate of the over-expressed strain in the germination stage; c is Arabidopsis thaliana wild type on MS medium and MS medium containing 0.5. mu.M ABA, respectivelyCol-0AndBjuIBSanalysis of the greening rate of the over-expressed strain at the greening stage.

FIG. 6 is a graph showing the effect of transgenic Arabidopsis thaliana on sodium chloride resistance; a is Arabidopsis thaliana wild type on MS medium and MS medium containing 200 mM NaClCol-0AndBjuIBSphenotypic analysis of the over-expressed strain in the germination stage and the green turning stage; b is Arabidopsis thaliana wild type on MS culture medium and MS culture medium containing 200 mM NaClCol-0AndBjuIBSanalyzing the germination rate of the over-expressed strain in the germination stage; c is Arabidopsis thaliana wild type on MS culture medium and MS culture medium containing 200 mM NaClCol-0AndBjuIBSanalysis of the greening rate of the over-expressed strain at the greening stage.

Detailed Description

The invention will be described in more detail below with reference to specific embodiments and the attached drawings, but the scope of the invention is not limited to the description. In the examples, the starting materials are all common commercial products unless otherwise specified. The experimental procedures described in the examples are not specifically described, i.e., they are carried out according to conventional molecular biological experimental procedures.

Example 1

To verify the geneBjIBSParticipating in the response of the stem tumor mustard to adversity stress, respectively applying stress treatment of 200 mM NaCl and 50 mu M ABA to the stem tumor mustard seedlings 7 days after germination, respectively sampling at 0 h, 3h, 6h, 12 h and 24 h after treatment, and detecting genes by fluorescent quantitative PCRBjIBSThe results are shown in FIG. 1.

The results show that the gene is prolonged with induction time compared to 0 h under 50. mu.M ABA and 200 mM NaCl treatmentBjIBSThe transcription level of (A) is also significantly induced, and especially the expression level reaches the maximum value at 3h, indicating that the geneBjIBSThe induction expression of NaCl and ABA indicates that the gene plays an important role in the process that the tumorous stem mustard responds to the adversity stress.

Example 2

To study the geneBjIBSSelecting root, unexpanded stem, expanded tumor stem, leaf, flower, inflorescence and seed pod of stem tumor mustard in space-time expression mode of different tissue parts, extracting RNA, reverse transcribing into cDNA, performing fluorescence quantitative PCR, and detecting geneBjIBSTissue expression pattern of (a). The results are shown in FIG. 2.

Results displayBjIBSExpression was observed in all tissues of tumorous stem mustard, with the highest expression in roots, relatively higher expression in unexpanded stems, leaves and seed pods, and the lowest expression in expanded tumorous stems. Due to the plasticity of root growth and development, it has important functions in the plant response to abiotic stress, andBjIBSthe high expression in the root indicates that the gene has very important function on the development or physiological function of the root, and also indicates that the gene has important function on the development or physiological function of the rootBjIBSAnd the function is played in the process of responding to the stress of plants.

Example 3 GFP fusion expression vector construction and subcellular localization analysis

(1) Construction ofpTF101-BjIBS-GFPExpression vector

Vector sequences based on pTF101-GFP andBjIBSthe full-length sequence of the gene (SEQ ID NO. 1), and design of the forward primer: (BjIBS-F1) and reverse primer(s) ((ii)BjIBS-R1). Taking the whole genome of the tumorous stem mustard as a template to carry outBjIBSAnd (3) carrying out PCR amplification on the gene fragment.

The primer sequences are as follows:

BjIBS-F1: 5'-CCCGGGATGAATAATCTGCCAGAGGACTG-3'

BjIBS-R1: 5'-GGATCCTTAGGGCAGTACTGGCCTAATCTC-3'

note: the bold sequence is the restriction site.

And (3) PCR reaction system: high fidelity Amplifier KOD FX (KFX-101, TOYOBO) 0.5. mu.L, 2xPCR buffer for KOD FX (Mg)²⁺Plus) 25. mu.L, forward primer (10. mu.M) 1. mu.L, reverse primer (10. mu.M) 1. mu.L, template (tumorigenic Arabidopsis DNA) 2. mu.L, dNTP (2.5mM) 4. mu.L, sterile ddH₂O make up to 50. mu.L.

And (3) PCR reaction conditions: pre-denaturation at 95 deg.C for 5 min; at 95 ℃ for 30 s; 56 ℃ for 30 s; 72 ℃, 1.5min, 30 cycles; 72 ℃ for 10 min.

And (3) carrying out agarose gel electrophoresis detection on the PCR amplification product, and recovering and purifying according to the steps of a gel recovery kit (9672, Takara) to obtain the target gene fragment.

By usingSmaI andBamHi is doubleThe pTF101-GFP expression vector was digested with an enzyme. The enzyme cutting system is as follows: 5 mu L of pTF 101-GFPvector;SmaI 0.5μL；BamHi0.5 mu L; buffer 10xK 2 uL; sterile ddH₂O is complemented to 20 mu L; react at 37 ℃ for 3 h. After completion of the digestion, the pTF101-GFP vector fragment was recovered according to the Takara agarose gel recovery kit.

The pTF101-BjIBS-GFP expression vector was constructed using T4 DNA Ligase (FL 101, Trans).

The connection reaction system is as follows:

purification PCR fragment (recovered)BjIBSFragment of interest) 50 ng; 100ng of linear vector (pTF101-GFP vector); 2 μ L of 5x T4 DNA Ligase Buffer; t4 DNA Ligase 0.5. mu.L; sterile ddH2O was made up to 10. mu.L. The reaction was carried out at 25 ℃ for 30 min. The recombinant reaction system is transformed into Escherichia coli DH5a according to the molecular cloning experimental instruction, spread on a screening culture plate containing spectinomycin resistance (75 mg/L), and sequenced by positive cloning to obtain the correct productBjIBSRecombinant expression vector of gene fragmentpTF101-BjIBS-GFP. Reporter gene GFP and target gene in recombinant expression vectorBjIBSAfter the 5' end of the promoter is fused, the promoter is positioned at the downstream of a constitutive promoter P35S to form fusion expression;BjIBSthe 3' end of the fusion gene is assembled with an NOS terminator, which can effectively terminate the transcription of the fusion gene. The reporter gene GFP can emit green fluorescence without auxiliary factors and substrates after being excited by blue light, and can detect the expression condition of a target gene when being used as the reporter gene.

(2) Subcellular localization analysis of BjIBS

The constructed recombinant expression vector pTF101-BjIBS-GFP is transferred into the agrobacterium strain GV3101 by a conventional freeze thawing method, and positive clones are screened by PCR. Agrobacterium injection buffer was prepared by using Agrobacterium strain containing pTF101-GFP plasmid as positive control and using methods such as Halin (Agrobacterium-mediated tobacco transient expression test condition optimization, molecular plant breeding, 2016, 14(1): 80-85). The tobacco normally grown in the light incubator with 8-10 leaves fully expanded was selected for injection and the injection buffer was slowly pushed into the back of the leaves using a syringe with the needle removed. Then, the transformed plant is placed back into the incubator again, and observed after being cultured for 36h-48 h.

Carefully shearing the transformed tobacco leaves with scissors, placing the tobacco leaves on a glass slide, adding 1 drop of distilled water, and preparing into tablets; then, the sample was placed on a fluorescence microscope and fluorescence observation was performed under blue light with an excitation light wavelength of 488-507 nm. The results are shown in FIG. 3, and show that the detection can be clearly detected in the cytoplasm and nucleus of plant cellsBjIBS-GFPFusion protein, descriptionBjIBSAnd exert biological functions in the cytoplasm and nucleus of the plant.

Example 3BjIBSGenetic transformation of overexpressing Arabidopsis

Genetic transformation of Arabidopsis thaliana

Genetic transformation of arabidopsis thaliana was performed by the floral dip method (Zhang x.,et al.nat Protoc. 2006, 1: 641-646). Will carry withpTF101-BjIBS-GFPAgrobacterium of the vector was introduced into Columbia Col type Arabidopsis thaliana. Selection of resistant Arabidopsis seedlings with herbicide (Basta) and amplification by conventional PCRBjIBSA target gene.

The PCR amplification primers are as follows:

BjIBS-F: 5'-ATGAATAATCTGCCAGAGGACTG-3'

BjIBS-R: 5'-TTAGGGCAGTACTGGCCTAATCTC-3'

the PCR detection result shows that the detection can not be detected in wild plants (WT)BjIBSThe presence of genes, only in transgenic lines (7-8，8-1，12-22And13-11) Obvious bands are amplified in the positive strains, which shows that in the 4 positive strains, the recombinant expression cassette is introduced into an arabidopsis genome.

Further, total RNA of wild-type and transgenic positive Arabidopsis leaves was extracted using Trizol reagent (Invitrogen;), residual DNA was removed using DNase I (Invitrogen;), and first strand cDNA was synthesized using cDNA reverse transcription reagent (6210A, Takara) according to the procedures described. Using Arabidopsis thalianaActinThe gene (AT 3G 53750) is used as an internal reference, and the transgenic positive strain and the wild type are analyzed by a semi-quantitative RT-PCR methodBjIBSThe level of expression of the gene.

Detection ofActinThe gene primers are as follows:

Actin-qF: 5'- GTCTGGATTGGAGGATCCAT -3'

Actin-qR:5'- CCGGTGAACAATCGACGGGC -3'

detection ofBjIBSThe gene primers are as follows:

BjIBS-qF：5'-CTTCTTCTCCCTCGTCCATAAC-3'

BjIBS-qR：5'-CTAGCAGCCATCATGTAGCA-3'

relative expression level adopted 2^−ΔΔCtMethods (Livak KJ, Schmittgen TD, 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2(-Delta Delta Delta C (T)) method 25, 402-. The results are shown in FIG. 4, in comparison with wild type plants (WT), in 4 representative transgenic lines ((WT))7-8，8-1，12-22And13-11) The gene of interestBjIBSAll significantly up-regulated expression, but could not be detected in wild type plants (WT)BjIBSIs shown to indicateBjIBSThe Arabidopsis genome has been introduced and successfully transcribed.

Example 4 phenotypic Observation and analysis of transgenic Arabidopsis

For wild type Arabidopsis thaliana plant and transgenic Arabidopsis thaliana plant respectively: (7-8，8-1，12-22And13-11) The phenotype on MS solid medium containing ABA and NaCl was analyzed, and the results are shown in FIGS. 5 and 6.

As can be seen from the figure, in the absence of ABA and NaCl treatment,BjIBSthe seed germination and cotyledon greening of the over-expression transgenic plant are basically normal, and the wild type is not obviously different. In significant contrast, under the conditions of 0.5. mu.M ABA and 200 mM NaCl treatment, both in the germination and greening stages,BjIBSoverexpression of transgenic plants7-8，8-1，12- 22And13-11shows higher tolerance to ABA and NaCl. The results show that heterologous overexpression in ArabidopsisBjIBSThe response of the plant to adversity stress is post-regulated.

Finally, the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all of them should be covered in the claims of the present invention.

SEQUENCE LISTING

<110> Changjiang university academy;

<120> stress-resistant gene BjuIBS of stem tumor mustard and application thereof

<160>10

<170>SIPOSequenceListing 1.0

<210>1

<211>771

<212>DNA

<213> tumorous stem mustard (Brassica juncea var. tubida Tsen et Lee)

<400>1

atgaataatc tgccagagga ctgcatcgct aagatccttt ccttgacttc gcctcgagac 60

gtttgccgat catcggctgt ctccaggtgc ttcagatccg ccgcagactc cgaccatgtc 120

tggaaccact tcttaccttc cgagttcccc gaggacttta gggcacctga gggtcttccc 180

accaagaaac acctcttctt ctccctcgtc cataaccctc tccttctcca cggctcccaa 240

ctgagctttt cgctggagag aagtactggt aacaagtgct acatgatggc tgctagggcc 300

ttgaatatta cttggggaca tgatcaaaga tactggcagt ggatctctct tcctgatgcc 360

aggttcaaag aagtggctgc gcttaaaatg gtatggtggc ttgacatcac tggaaaaatc 420

aacatatccc ttctctctga caacaccctc tacgccgctt accttgtctt taggtggaac 480

cttgatccct acggttttcg ccagcccgta gaggcatccc ttgttttggc tggcaccgag 540

catgatgatg tccagccttc catggtcagt ctcatgcaga atccggggag cgaacaaggt 600

cagcgcgctg agctgagaag cgacgactgg tacgaggtgc agttgggaca cttcttcaaa 660

aggagaggag atatgggtga aatagagatg agcctcaagg agacaaagag gccttttgag 720

aagaaaggtc ttatcgtcca tggaattgag attaggccag tactgcccta a 771

<210>2

<211>256

<212>PRT

<213> tumorous stem mustard (Brassica juncea var. tubida Tsen et Lee)

<400>2

MNNLPEDCIA KILSLTSPRD VCRSSAVSRC FRSAADSDHV WNHFLPSEFP EDFRAPEGLP 60

TKKHLFFSLV HNPLLLHGSQ LSFSLERSTG NKCYMMAARA LNITWGHDQR YWQWISLPDA 120

RFKEVAALKM VWWLDITGKI NISLLSDNTL YAAYLVFRWN LDPYGFRQPV EASLVLAGTE 180

HDDVQPSMVS LMQNPGSEQG QRAELRSDDW YEVQLGHFFK RRGDMGEIEM SLKETKRPFE 240

KKGLIVHGIE IRPVLP 256

<210>3

<211>29

<212>DNA

<213> Artificial sequence

<400>3

cccgggatga ataatctgcc agaggactg 29

<210>4

<211>30

<212>DNA

<213> Artificial sequence

<400>4

ggatccttag ggcagtactg gcctaatctc 30

<210>5

<211>23

<212>DNA

<213> Artificial sequence

<400>5

atgaataatc tgccagagga ctg 23

<210>6

<211>24

<212>DNA

<213> Artificial sequence

<400>6

ttagggcagt actggcctaa tctc 24

<210>7

<211>20

<212>DNA

<213> Artificial sequence

<400>7

gtctggattg gaggatccat 20

<210>8

<211>20

<212>DNA

<213> Artificial sequence

<400>8

ccggtgaaca atcgacgggc 20

<210>9

<211>22

<212>DNA

<213> Artificial sequence

<400>9

cttcttctcc ctcgtccata ac 22

<210>10

<211>20

<212>DNA

<213> Artificial sequence

<400>10

ctagcagcca tcatgtagca 20

Claims (9)

1. Stress-resistant gene of tumorous stem mustardBjuIBSThe nucleotide sequence is shown as SEQ ID NO.1 or the nucleotide sequence with the same function is obtained by replacing, deleting or inserting one or more nucleotides in the nucleotide sequence shown as SEQ ID NO. 1.

2. The tumorous stem mustard stress resistance gene of claim 1BjuIBSThe coded protein has an amino acid sequence shown as SEQ ID NO.2 or has an amino acid sequence shown as SEQ ID NO.2 and one or more amino acid sequencesAmino acid sequences with the same function obtained by amino acid substitution, deletion or insertion.

3. A stress-resistant gene comprising the tumorous stem mustard of claim 1BjuIBSThe plant expression vector of (1).

4. A stress-resistant gene comprising the tumorous stem mustard of claim 1BjuIBSThe host cell of (1).

5. The tumorous stem mustard stress resistance gene of claim 1BjuIBSThe application in improving the stress resistance of plants.

6. Use according to claim 5, wherein the stress resistance is resistance to high salt or/and abscisic acid environments.

7. A method for increasing stress resistance of a plant, which comprises introducing the plant expression vector of claim 3 or the host cell of claim 4 into a plant cell to make the geneBjuIBSAnd (4) overexpression.

8. The method of claim 7, wherein the plant is a monocot or a dicot.

9. The method of claim 8, wherein the dicotyledonous plant is Arabidopsis thaliana or Arabidopsis thaliana.

Images