CN107164347B - Ideal plant type gene NPT1 for controlling rice stem thickness, tillering number, spike grain number, thousand grain weight and yield and its application - Google Patents

Abstract

The invention discloses an ideal plant type gene NPT1 capable of increasing the thickness of rice stalks, the number of grains per spike, the thousand grain weight and the yield and application thereof. The functions and the expression quantity of the NPT1 gene are closely related to the thickness of the rice stem, the number of grains per spike, the grain weight and the yield, and an excellent allelic variation type NPT1 of the gene causes the significant reduction of the expression quantity of the gene, so that the thickening of the rice stem, the number of grains per spike and the grain weight are increased, and the yield is increased. Further research finds that NPT1 encodes a deubiquitinating enzyme similar to human OTUB1 protein, and realizes regulation and control of rice plant (spike) type by regulating and controlling OsSPL14 protein stability. The npt1 is polymerized with the excellent agronomic character regulatory gene dep1-1, so that the rice yield can be further improved. NPT1 is used as new gene for controlling important rice agronomic character, and its clone provides certain theoretical and technical support for rice molecular polymerization breeding and yield improvement.

Description

Ideal plant type gene NPT1 for controlling rice stem thickness, tillering number, spike grain number, thousand grain weight and yield and its application

Technical Field

The invention belongs to the technical field of plant biology. Specifically, the invention relates to a gene for increasing the thickness of rice stalks, the number of grains per spike, the thousand grain weight and the yield and application thereof.

Background

Rice is one of the important food crops, and approximately one half of the global population is kept alive. In the last 60 th century, the popularization of half dwarf breeding has led to the remarkable improvement of rice yield all over the world. Although the utilization of rice heterosis and the breeding of new varieties thereof have made great progress in the aspect of increasing rice yield in recent 30 years, the increasing range of the yield still cannot meet the demand of growing population on food. Population numbers in 2050 are expected to reach 89 billion, which means that food production needs to be improved by 50% in 2050. In the face of the severe situation that the population is increased rapidly, the environment is worsened continuously and the arable land area is reduced continuously, how to effectively improve the yield per unit of rice becomes a very important task in agricultural production.

The rice yield mainly comprises the factors of the effective spike number, the grain number of each spike, the thousand grain weight and the like on a unit area. The tillering number determines the effective spike number, and the tillering is one of important agronomic characters which influence the number of the rice spikes and further influence the yield of the rice; the grain number of each ear is determined by the primary branch, the secondary branch and the seed setting rate; the size of the kernel (length, width, thickness) determines the thousand kernel weight. Meanwhile, the yield of the rice is also influenced by the characteristics of spike-heading period, lodging resistance and disease resistance and stress tolerance. The rice panicle type refers to the size and the growth posture of rice panicle, and is an important component of the rice plant type, the panicle grain number is closely related to the panicle development, and the small flower number determines the grain number of each panicle; thousand kernel weight is closely related to grain size and filling degree in the grain ripening process, the agronomic characters are closely related to plant yield, and important agronomic characters such as plant height, tillering number, tillering angle, spike morphology, grain type and the like are typical complex agronomic characters and are controlled by a plurality of Quantitative Trait Loci (QTLs) and environmental factors.

In rice breeding, the ideal plant type is shaped to play a great role in genetic improvement of rice varieties. The traditional rice has higher plant height, weak stalks, low tolerance to nitrogen fertilizer, easy lodging and low yield; the introduction of the semi-dwarf gene sd1 obviously reduces the plant height, thickens the stem, increases the tillering number, improves the fertilizer resistance and lodging resistance, and thus obviously improves the yield. In order to further improve the yield per unit of Rice, in the last 80 th century, International Rice institute (IRRI) proposed an ideal Plant Type (New Plant Type) breeding plan, namely, the ideal Plant Type Rice with few tillers, big ears and thick and strong stalks is bred. Meanwhile, the theory of the japonica super rice in the north is provided by the breeder in China, and the theory indicates that the upright ear breeding is another important breeding form evolution selection which is suitable for ultrahigh yield after the semi-dwarf breeding, and a batch of high-yield rice new varieties represented by the Liaojing No. 5 and Shennong 265 are bred, so that the yield per unit level of the japonica rice in China is remarkably improved. In the early stage, the gene DEP1 for controlling the erect panicle type character is cloned from a high-yield japonica rice variety Shennong 265 in the laboratory, and the excellent allele DEP1-1 of the gene DEP1 is found to increase the number of grains per panicle and improve the yield, and plays a vital role in the breeding of super rice in China.

Disclosure of Invention

In order to further analyze the molecular regulation mechanism of the high-yield plant type of rice, a rice parent IR66167-27-5-1-6 with ideal plant type characteristics cultivated by international rice is utilized, and a key gene NPT1 for controlling the ideal plant type and yield is separated and cloned through QTL positioning and map location cloning technology. On the basis, various means such as genetics, molecular biology, biochemistry and the like are comprehensively utilized, the biological function of the NPT1 gene and the molecular basis of regulating and controlling the rice yield are deeply researched, a corresponding theoretical basis is provided for high-yield breeding of rice, and an important gene resource is also provided for design breeding of rice molecules.

The invention relates to an ideal plant type gene NPT1 for controlling the thickness, tillering number, grain number per spike, thousand grain weight and yield of rice stalks and application thereof. In particular, the present invention relates to new functions and applications of NPT1 in improving tillering, panicle weight, thousand kernel weight, yield, stalk thickness and lodging resistance of crops (e.g., rice, wheat, barley, corn, sorghum, etc.). More specifically, the NPT1 and its homologous gene are from rice, wheat, barley, corn, sorghum and other crops.

The inventor discovers that one strain RIL52 shows ideal plant type characteristics including the characters of increased stem thickness, reduced tillering number, obviously increased single-ear grain number and yield and the like by utilizing a rice parent IR66167-27-5-1-6 with less tillers, large ears and stout stems from the international rice institute and a recombinant inbred line group constructed by hybridization of China japonica rice variety Chunjiang 06. F constructed by hybridizing RIL52 and indica rice variety Zhe radiata 802₂The population carries out completely random field experiments, respectively inspects 3 characters of tillering number, grain per ear and stalk thickness, combines phenotypic values and molecular marker data of the characters, and discovers that a main effect QTL for simultaneously controlling the stalk thickness, grain per ear and tillering number exists on the long arm of the No. 8 chromosome through QTL analysis, and the QTL is named as qNPT 1. BC constructed by RIL52 and Zhe radiation 802 subsequently₂F₂And BC₂F₃In the population, the qNPT1 is finely positioned in the physical range of 4.1Kbp at the end of the long arm of the eighth chromosome of rice, and the segment only has one predicted candidate gene. On the basis, the IR66167-27-5-1-6 and the middle flower 11 are hybridized, and a middle flower 11 background (ZH11) near isogenic line is constructed for target characters, so that ZH11-npt1 stems are stronger, the tillering number is slightly reduced, the plant height is basically unchanged, the grain number per spike and thousand kernel weight are obviously increased, and the single plant yield is obviously increased.

Rice NPT1 encodes a deubiquitinase (OsOTUB1), a homologous gene of human OTUB1 in rice, and thus the gene is also called OsOTUB1 gene, and the two terms are abbreviated interchangeably in the present invention. Rice OsOTUB1(SEQ ID NO:15, a protein encoded by rice NTP1 gene, also referred to as NPT1 protein in the present invention, and the two terms are used interchangeably) was found to have activity of catalyzing depolymerization of K48 and K63 ubiquitin chains. The inventor researches the subcellular localization of the OsOTUB1 protein and finds that the OsOTUB1-GFP fusion protein is localized in cytoplasm and nucleus. In addition, a promoter-driven pOsOTUB1 of OsOTUB1 itself was constructed: : GUS plant expression vector, and agrobacterium mediated process to obtain transgenic plant. GUS staining is carried out on organs and tissues of transgenic plants in different development stages, and the gene is expressed in the whole development stage of rice, and particularly has high expression in a vascular bundle system and meristem.

The function of the OsOTUB1 gene is verified by a transgenic method. The gene is found to reduce expression moderately or lose function mutation to reduce the tiller number, but can increase the thickness of the stem, the grain number of each ear and the thousand grain weight, thereby remarkably increasing the yield. Conversely, overexpression of this gene results in a plaque-like phenotype and cell death. The interaction protein is screened by yeast two-hybrid, and the OsOTUB1 protein is found to interact with ubiquitin conjugated enzyme OsUBC13 and inhibit the function of the ubiquitin conjugated enzyme OsUBC 13. Further research shows that OsOTUB1 interacts with the rice plant type and yield positive regulation factor OsSPL14 protein, and the rice plant type and yield are regulated and controlled by influencing the stability of the OsSPL14 protein.

Meanwhile, the inventor clones cDNA sequences of OsOTUB1 homologous genes from wheat, barley, corn, sorghum, mice and human respectively, and proves that the cDNA sequences have biological functions similar to OsOTUB1 in controlling the thickness, tillering number, spike grain number, thousand grain weight and yield of rice stalks through transgenic research.

The excellent allele npt1 is introduced into the high-yield japonica rice variety Wuyujing No. 7, and years of multipoint field yield measurement statistical analysis shows that the rice yield can be further improved on the basis of high yield of the main cultivars by the polymerization of npt1 and dep 1-1.

The invention aims to provide an ideal plant type gene NPT1 capable of regulating and controlling the thickness of stalks, tillering number, grain number per spike, thousand grain weight and yield, and provides a new gene resource with important breeding utilization value for the design and breeding of high-yield molecules of rice.

Accordingly, the present invention provides the following:

in a first aspect, the invention provides a rice ideal plant type gene NPT1 and an allele NPT1 thereof, wherein the NPT1 can increase the stalk thickness, the number of grains per ear, the thousand kernel weight and the yield per plant of rice. The nucleotide sequences involved in these two genes include:

(1) SEQ ID NOs: 1-4;

(2) a nucleotide sequence that hybridizes under moderately stringent conditions, preferably high stringent hybridization conditions, to the complement of the nucleotide sequence of (1);

(3) a nucleotide sequence having at least 70%, preferably at least 80%, more preferably at least 90%, especially at least 95% or 98% or 99% identity to the nucleotide sequence of (1);

(4) a nucleotide sequence which encodes a protein of the same amino acid sequence as the nucleotide sequence of (1) but differs in sequence due to the degeneracy of the genetic code;

(5) a nucleotide sequence encoding one of the following amino acid sequences: SEQ ID NO:15, or an amino acid sequence which differs from the amino acid sequence shown in SEQ ID NO: 13, or an amino acid sequence that differs from the amino acid sequence set forth in SEQ id no:15, preferably at least 80%, more preferably at least 90%, especially at least 95% or 98% identity;

(6) an active fragment of the nucleotide sequence of any one of (1) to (6);

(7) a nucleotide sequence complementary to the nucleotide sequence of any one of (1) to (6).

In a second aspect, the present invention provides a promoter sequence of the gene of the first aspect and alleles thereof as set forth in SEQ ID NO: 5 or 6.

Table 1.SEQ ID NOs: 1-6 and their sources

SEQ ID NO：	Name (R)	Origin of origin
			1	NPT1 cDNA sequence	Zhe radiation 802
2	npt1 cDNA sequence	IR66167-27-5-1-6
			3	NPT1 gDNA sequence	Zhe radiation 802
4	npt1 gDNA sequence	IR66167-27-5-1-6
			5	NPT1 promoter sequence	Zhe radiation 802
6	npt1 promoter sequence	IR66167-27-5-1-6

In a third aspect, the present invention provides a homologue of the rice NPT1 gene of the first aspect, which homologue is derived from uraria wheat, barley, maize, sorghum, soybean, canola, cotton or tomato, encoding a polypeptide of SEQ ID NOs: 16-23.

Specifically, the homologous gene comprises SEQ ID NOs: 7-14.

TABLE 2 nucleotide sequence of homologous gene of rice NPT1 gene

SEQ ID NO：	Name (R)	Origin of origin
			7	TuNPT1 cDNA sequence	Ural pattern wheat
8	HvNPT1 cDNA sequence	Barley
			9	ZmNPT1 cDNA sequence	Corn (corn)
10	SbNPT1 cDNA sequence	Sorghum grain
			11	GmNPT1 cDNA sequence	Soybean
12	BnNPT1 cDNA sequence	Rape seed
			13	GhNPT1 cDNA sequence	Cotton
14	SlNPT1 cDNA sequence	Tomato

In a fourth aspect, the present invention provides an isolated polypeptide (also known as a protein) comprising an amino acid sequence selected from the group consisting of:

(1) SEQ ID NOs: 15-23,

(2) and (b) a sequence that differs from the sequence of SEQ ID NO: 15-23, or a pharmaceutically acceptable salt thereof,

(3) and SEQ ID NOs: 15-23, preferably at least 80%, more preferably at least 90%, especially at least 95% or 98% or 99% identity,

(4) an active fragment of the amino acid sequence of (1) or (2) or (3),

(5) the present invention relates to the amino acid sequence encoded by the polynucleotide molecule.

Wherein, OsNPT1 encodes the homologous protein of OTUB1 in rice, so the encoded protein is named as OsOTUB1, and the amino acid sequence of the protein sequence and the homologous protein thereof is represented by SEQ ID NOs: 15-23, see table 3 below.

TABLE 3 names and sources of NPT1 protein sequences and their variant proteins

In a fifth aspect, the invention provides a recombinant construct comprising an NPT1 or an allelic NPT 1-related polynucleotide as described in the first to third aspects of the invention. Wherein the vector used for the construct is a cloning vector or an expression vector for expressing the polynucleotide.

In a sixth aspect, the present invention provides a recombinant host cell comprising a recombinant construct according to the fifth aspect of the invention or having integrated in its genome the NPT1 or the allele NPT1 polynucleotide according to the first to third aspects of the invention. The host cell may be selected from plant cells or microbial cells, such as e.coli cells, agrobacterium cells, preferably plant cells, most preferably rice cells. The cell may be isolated, ex vivo, cultured, or part of a plant.

In a seventh aspect, the present invention provides the use of a polynucleotide or polypeptide of the first to fourth aspects or a recombinant construct of the fifth aspect or a recombinant host cell of the sixth aspect for improving a trait in a rice plant.

The present invention also relates to a method of improving a trait of a rice plant, the method comprising preparing a rice plant comprising a polynucleotide of any one of the first to fourth aspects or a construct of the fifth aspect, e.g., the method may comprise regenerating a transgenic plant from a recombinant plant cell of the sixth aspect or transfecting a rice plant with a recombinant microbial cell of the sixth aspect to obtain a transgenic plant. Such traits include, but are not limited to: the thickness of the stalk, the number of single spike grains, the yield and the like.

The present invention also provides a method for breeding rice with improved yield, which comprises: the transgenic rice plant with the reduced NPT1 gene expression level or the reduced protein function caused by the change of the amino acid sequence is obtained by transfecting a rice plant with the recombinant host cell of the seventh aspect, and particularly, the NPT1 gene expression level is reduced by an RNAi technology, or the NPT1 gene expression level is reduced by CRISPR/Cas9 and creation of the transgenic rice with the loss or the reduced protein function of the NPT 1.

In an eighth aspect, the invention provides the use of the npt1 gene to increase crop stalk thickness, grain per ear, thousand kernel weight, and thereby increase crop yield.

In a ninth aspect, the present invention relates to a method of breeding rice with increased yield. The method comprises the following steps: a transgenic rice plant is regenerated from the recombinant rice host cell containing the NPT1 allele of the sixth invention, or the expression level of the NPT1 gene is reduced, or the biological function of the NPT1 protein is changed, or the Tilling technology, namely the directional induced genome mutation technology is used for obtaining rice with the NPT1 gene expression level reduced or the NPT1 protein is lost or the function is weakened, or the rice plant containing the NPT1 allele is crossed with another plant, so that the plant with slightly reduced tillering number, increased stem stalk, increased grain per ear and thousand kernel weight and further increased yield is preferably selected.

It should be understood by the skilled person that based on the research of the present inventors, the reduction of the expression level of NPT1 gene or the reduction of the function of the NPT1 protein expressed by the gene can increase the tillering number, the thickness of stalks, the number of grains per ear, the thousand-grain weight and the yield of rice, and the reduction of the expression level of NPT1 gene or the reduction of the function of the NPT1 protein expressed by the gene can be achieved by selecting an appropriate technique, thereby breeding rice.

In the tenth aspect, the invention finds that the OsOTUB1 protein (i.e., rice NPT1 protein) can interact with the ubiquitin-binding enzyme OsUBC13 and inhibit the function thereof by screening the interacting proteins through yeast two-hybrid. The inventor firstly discovers that the yield of the transgenic plant over-expressed by OsUBC13 can be increased, which indicates that the OsUBC13 gene can be used for rice breeding. Therefore, the present invention relates to a method for breeding rice with increased grain per ear and yield by overexpressing OsUBC13, which comprises transfecting a rice plant with a recombinant host cell containing a recombinant construct of OsUBC13 to obtain a transgenic rice plant, and affecting NPT1 activity in the obtained transgenic rice plant by using the action of OsUBC13 and NPT1 proteins encoded by OsUBC13, thereby increasing grain per ear and yield. Wherein the cell is a microbial cell, preferably an E.coli or Agrobacterium cell. The action principle is that OsUBC13 encodes rice ubiquitin-conjugating enzyme OsUBC13, the protein directly interacts with NPT1 protein, and the enzyme activity is inhibited by NPT1 protein, so that the activity of over-expressed OsUBC13 transgenic rice similar to NPT1 protein is reduced, the number of grains per ear and the yield of rice can be increased. Wherein, the protein sequence coded by the OsUBC13 gene is shown as SEQ ID NO: 36, in a specific embodiment, the nucleotide sequence of the OsUBC13 gene is shown as seq id NO: shown at 35.

Eleventh aspect, crops with increased yield are produced by knocking out NPT1 or homologous genes TuNPT1, HvNPT1, ZmNPT1, SbNPT1, GmNPT1, BnNPT1, GhNPT1, SlNPT1 by CRISPR/cas9 gene editing technology. The above crops are preferably crops such as rice, wheat, barley, corn, sorghum, soybean, rape, cotton, tomato, etc., but not limited thereto.

In a twelfth aspect, a molecular marker assisted selective pyramiding method for breeding high yielding rice varieties, the method comprising crossing a rice parent comprising the superior allele npt1 with another rice parent comprising the dep1-1 gene, and selecting lines or varieties comprising a pyramiding of npt1 and dep1 genes in progeny based on the molecular markers. Wherein the dep1-1 gene encodes SEQ ID NO: 34 (i.e., DEP1 protein), and in a specific embodiment, the nucleotide sequence of DEP1-1 gene is shown in SEQ ID NO: shown at 33.

In the thirteenth aspect, the inventors further study and find that OsOTUB1 interacts with the rice plant type and yield positive regulatory factor OsSPL14 protein, and regulates the rice plant type and yield by influencing the stability of OsSPL14 protein. Therefore, the invention provides a method for cultivating rice with increased number of grains per ear and yield by enhancing a rice plant type regulatory protein OsSPL14, which comprises the steps of transforming a rice plant by using a recombinant construct containing an NPT1 gene and a recombinant host cell to obtain a transgenic rice plant, and obtaining a transgenic plant with enhanced OsSPL14 function, wherein the cell is a microbial cell, and the microbial cell is preferably an Escherichia coli or agrobacterium cell. The action principle is that NPT1 directly interacts with OsSPL14 protein, and genetics proves that OsSPL14 is located at the downstream of NPT1, and the function of the OsSPL14 is inhibited by NPT 1.

Wherein the rice OsSPL14 protein sequence is shown as SEQ ID NO: 38, the rice OsSPL14cDNA sequence is shown as SEQ ID NO: shown at 37.

Brief Description of Drawings

FIG. 1 shows that QTL positioning of an ideal plant type strain qNPT1 of rice is controlled. (a) The Chunjiang 06 and international rice ideal plant type rice IR66167-27-5-1-6 are hybridized and a recombinant inbred line is obtained by a single seed transmission method, wherein RIL52 shows the characteristics of the ideal plant type, and the scale is 20 cm; (b) ear phenotype comparison, scale bar, 5 cm; (c) carrying out statistical analysis on the tillering number; (d) performing statistic analysis on grain number of ears; (e) counting and analyzing the thickness of the middle part of the reverse stalk; (f) and (3) controlling the thickness of rice stalks, grain number of ears and tiller number, and carrying out major QTL analysis.

FIG. 2. isolation and cloning of qNPT1 using the map-based cloning method. (a) Finely positioning the qNPT1 gene in an interval of 4.1kb, wherein a candidate gene of the qNPT1 gene codes a deubiquitinase, and is a homologous gene of a human OTUB1 gene in rice; (b) haplotype analysis at the screens.

FIG. 3 OsOTUB1 functional verification. (a) Comparing the rice plant types, wherein the rice plant types are 20 cm; (b) the CRISPR/cas9 method creates a rice osotsub 1-C1 mutant, wherein the green part is a sgRNA target sequence, and the red part is a PAM sequence; (c) comparative analysis of heading stage; (d) plant height comparison analysis; (e) performing statistical analysis on the diameter of the inverted section; (f) comparing and analyzing the tillering ratio; (g) ear length comparison analysis; (h) comparing and analyzing the number of the first-grade branches of each ear; (i) comparing and analyzing the number of second-grade branches of each ear; (j) comparing and analyzing the number of grains per spike; (k) comparing and analyzing thousand grain weight; (l) And (5) carrying out statistical analysis on the yield of the single plant.

FIG. 4 shows real-time quantitative PCR detection of OsOTUB1 gene expression level in different rice tissues. R: root tip; c: stalks; LB: a blade; LS: a leaf sheath; SAM: shoot apical meristem; YP 0.2: 0.2cm young ear; YP 6: ear of 06 cm; YP 12: 12cm ear.

FIG. 5 pOsOTUB1 in ZH11 background: : and (5) performing GUS staining on GUS transgenic plants. (a) OsOTUB1 was expressed in coleoptile and root, scale bar, 1 cm; (b) transection of the root maturation zone showed that OsOTUB1 was expressed in pericycle and phloem, scale bar, 200 μm; (c) OsOTUB1 is obviously highly expressed in a root tip resting center, and has a scale of 200 mu m; (d) transverse cutting of an inverted stem shows that OsOTUB1 is expressed in the vascular bundle of the stem, the scale bar is 100 mu m; (e) dyeing young ears in different development periods, and finding that OsOTUB1 has the strongest expression in the young ear period, the late development period of the ears is gradually reduced, and the proportion is 1 cm; (f) OsOTUB1 was expressed in developing glumes, scale bar, 1 mm.

FIG. 6 OsOTUB1-GFP fusion protein localized in cytoplasm and nucleus. (a) The OsOTUB1-GFP fusion protein is positioned in the root tip elongation zone cells, and the proportion is 20 mu m; (b) the OsOTUB1-GFP fusion protein is positioned at 10 days in a 10-day seedling leaf sheath dissociation protoplast, and the proportion is 10 mu m.

FIG. 7 phenotypic analysis of OsOTUB1 overexpressing transgenic plants. (a) And (5) comparing the plant types at the later stage of grouting. The OsOTUB1 overexpression transgenic plant shows the phenotypes of dwarfing, tiller reduction, leaf spot-like disease and the like in different degrees; scale bar, 20 cm; (b) ear morphology comparison. The OsOTUB1 overexpression transgenic material shows that ears become smaller and branches and stalks are reduced to different degrees; scale bar, 5 cm; (c) leaf phenotype comparative analysis. The over-expression transgenic lines OE-8# and OE-13# of OsOTUB1 have scab-like spots on leaves at the early stage of heading; scale bar, 2 cm; (d) trypan blue staining shows that the OsOTUB1 overexpression transgenic strains OE-8# and OE-13# have different degrees of programmed cell death; (e) analyzing the expression quantity of the OsOTUB1 gene in an overexpression strain; (f) the plant height of the OsOTUB1 overexpression transgenic plant shows reduction in different degrees; (g) the tillering number of the OsOTUB1 over-expression transgenic plant shows different degrees of reduction; (h) OsOTUB1 overexpression transgenic plants showed a different reduction in grain per ear.

FIG. 8, the rice OsOTUB1 protein has K48 site and K63 site ubiquitin chain depolymerization activity.

FIG. 9 OsOTUB1 and OsUBC13 interact to regulate rice plant type and yield. (a) Yeast two-hybrid verification of the interaction of OsOTUB1 and OsUBC13 protein; (b) pull-down experiments analyzed the interaction of OsOTUB1 and OsUBC13 protein; (c) BiFC experiment analysis OsOTUB1 and OsUBC13 protein interaction, scale bar, 10 μm; (d) comparing the plant types of OsUBC13 transgenic plants in the ZH11 background, wherein the plant type is 20 cm; (e) the thickness of the inverted stem is compared, and the length is 0.5mm on a scale; (f) ear type comparison, scale bar, 5 cm; (g) particle type comparison, scale bar, 2 mm; (h) analyzing the expression level of the OsUBC13 gene; (i) carrying out statistical analysis on the tillering number; (j) performing statistical analysis on the number of grains per spike; (k) carrying out statistical analysis on thousand seed weight; (l) And (5) performing inverse one-section thickness statistical analysis.

FIG. 10 SBP domain of OsSPL14 protein is involved in OsOTUB1 protein interaction. (a) Yeast double hybridCross validation OsOTUB1 delta N^1-80And OsSPL14 delta N2^1-100(ii) interaction; (b) schematic diagram of OsSPL14 protein deletion mutation; (c) BiFC experiments analyzed the interaction of different domains of OsSPL14 protein with OsOTUB1 protein, scale bar, 10 μm.

FIG. 11 shows that OsOTUB-OsSPL14 molecular module regulates rice plant type. (a) BiFC experiments demonstrate that OsOTUB1 interacts with the SBP domain of OsSPL 14; (b) Co-IP experiments prove that OsOTUB1 interacts with OsSPL14 protein; (c) under the NIL-npt1 background, the reduction of OsSPL14 expression can lead to the characters of tiller number increase and spike grain number decrease, and the like, and is similar to the ZH11 wild type phenotype; and ZH11-OsSPL14^WFPThe material phenotype was similar to NIL-npt1, scale bar, 20 cm; (d) reduction of OsSPL14 gene expression in the NIL-npt1 background resulted in a reduction in grain per ear, whereas ZH11-OsSPL14^WFPThe material phenotype was similar to NIL-npt1, scale bar, 5 cm; (e) analyzing the expression level of the OsSPL14 gene; (f) carrying out statistical analysis on the tillering number; (g) performing statistical analysis on the number of grains per spike; (h) and (5) counting and analyzing the thickness of the stalk of the reverse section.

FIG. 12 alignment analysis of amino acid sequences of OTUB1 and its homologous genes.

FIG. 13 overexpression of maize, barley, mouse and human OTUB1 homologous genes complemented the mutant phenotype of ZH11-npt 1. (a) Compared with the plant type at the later stage of grouting, the tillering of the over-expression transgenic plant is increased, the stem becomes thin, and the scale is 20 cm; (b) compared with the spike shape, the over-expression transgenic plant has the advantages that the branch and the stalk are reduced, the grain number of each spike is reduced, and the proportion scale is 5 cm; (c) analyzing the expression level of OsOTUB1 gene; (d) carrying out statistical analysis on the tillering number; (e) performing statistical analysis on the number of grains per spike; (f) and (5) performing statistical analysis on the diameter of the middle part of the reverse stalk.

FIG. 14, improvement of rice yield by polymerization breeding of the excellent alleles npt1 and dep 1-1. (a) Comparing plant types at the later stage of grouting, wherein the proportion is 20 cm; (b) comparing the shapes of the ear parts, and measuring the length of the ear parts by a scale bar of 5 cm; (c) particle type comparison, scale bar, 2 mm; (d) the thickness of the inverted stem is compared, and the length is 0.5mm on a scale; (e) performing statistical analysis on the number of the vascular bundles; (f) performing statistical analysis on heading stage; (g) statistical analysis of plant height; (h) counting and analyzing tillering number and thousand-grain weight; (i) performing statistical analysis on the number of grains per spike; (j) carrying out statistical analysis on thousand seed weight; (k) and (5) carrying out yield statistical analysis.

FIG. 15 shows the increase of yield of transgenic plants with decreased OsOTUB1 (i.e., NPT1) gene expression. (a) Comparing plant types at the later stage of grouting, wherein the proportion is 20 cm; (b) comparing the shapes of the ear parts, and measuring the length of the ear parts by a scale bar of 5 cm; (c) analyzing the expression level of OsOTUB1 gene; (d) performing statistical analysis on the number of grains per spike; (e) counting and analyzing the thickness of the reverse stem; (f) and (5) carrying out statistical analysis on the yield of the single plant.

FIG. 16 shows the sgRNA cassette sequence of OsOTUB1(SEQ ID NO: 24): u6a-sgRNA box monocots. Wherein the sequence shown in lower case letters is the target sequence and the sequence shown in bold underlining in the last part is the sgRNA coding sequence.

Detailed Description

Through extensive and intensive research, the invention clones an ideal plant type gene NPT1 which can change the thickness, tillering number, grain number per spike and yield of rice stalks, and the gene is positioned on the eighth chromosome long arm of rice; the reduction of the gene expression level or the function deletion mutation can cause the reduction of tillering number, the thickening of stems, the grain number of each ear, the thousand grain weight and the increase of yield.

Plant transformation

In a particularly preferred embodiment, at least one protein of the invention which controls grain width and grain weight is expressed in higher organisms, such as plants. The nucleotide sequence of the gene controlling grain width and grain weight of the present invention may be inserted into an expression cassette, which is then preferably stably integrated in the plant genome. In another preferred embodiment, the nucleotide sequence of the gene controlling grain width and grain weight is comprised in a non-pathogenic self-replicating virus. Plants transformed according to the invention may be monocotyledonous or dicotyledonous plants, including but not limited to maize, wheat, barley, rye, sweet potato, beans, peas, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, pepper, celery, squash, pumpkin, hemp, zucchini, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tomato, sorghum, sugarcane, sugar beet, sunflower, rapeseed, clover, tobacco, carrot, cotton, alfalfa, rice, potato, eggplant, cucumber, arabidopsis and woody plants such as conifers and deciduous trees. Particularly preferred is rice, wheat, barley, corn, oats, or rye.

Once the desired nucleotide sequence has been transformed into a particular plant species, it may be propagated in that species or transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques.

Preferably, the nucleotide sequences according to the invention are expressed in transgenic plants, which result in the biosynthesis of the corresponding grain width protein in the transgenic plants. In this way, transgenic plants with improved traits can be produced. In order to express the nucleotide sequence of the present invention in transgenic plants, the nucleotide sequence of the present invention may need to be modified and optimized. All organisms have a particular codon usage preference, which is known in the art, and the codons can be changed to conform to plant preferences while maintaining the amino acids encoded by the nucleotide sequences of the present invention. Moreover, high levels of expression in plants can best be achieved from coding sequences having at least about 35%, preferably more than about 45%, more preferably more than 50%, and most preferably more than about 60% GC content. Although preferred gene sequences can be expressed adequately in monocot and dicot species, the sequences can be modified to accommodate the specific codon preferences and GC content preferences of monocots or dicots, as these preferences have been shown to be different (Murray et al, Nucl. acids Res.17: 477-498 (1989)). In addition, the nucleotide sequence can be screened for the presence of non-canonical splice sites that cause truncation of the message. All changes that need to be made in these nucleotide sequences, such as those described above, are carried out using the methods described in published patent applications EP 0385962 (Monsanto), EP 0359472 (Lubrizol) and WO 93/07278(Ciba-Geigy) using site-directed mutagenesis techniques, PCR and synthetic gene construction well known in the art.

The invention will be further illustrated with reference to the following specific examples. It is to be understood that the following examples are intended only to further illustrate the present invention and are not intended to limit the spirit and scope of the present invention.

It should be noted that, unless otherwise specified, the reagents, enzymes and the like used in the following examples are those commercially available from reagent companies as analytical grade reagents or enzymes.

Example 1: cloning of ideal plant type gene NPT1 of rice

The inventor hybridizes the China japonica rice variety Chunjiang 06 with the international rice ideal plant type strain IR66167-27-5-1-6 to obtain F₁Obtaining a recombinant inbred line by a single-grain transmission method; among them, the RIL52 strain has a phenotype of ideal plant type characteristics of increased stalk thickness, slightly reduced tillering number and significantly increased spike grain number (FIG. 1 a-e). Hybridizing RIL52 with indica rice variety Zhejiang rice 802 to obtain F₁，F₂And (3) randomly selecting 196 leaves of each individual plant from the progeny to extract DNA, and correspondingly inspecting the properties of the thickness of the middle stem of the inverted section, the tillering number, the grain number of each ear and the like. Polymorphism analysis is carried out on RIL52 and Zhejiang radiation 802 by SSR primer pairs, polymorphic primers are selected and 196F primers are respectively carried out₂And carrying out PCR amplification on the single plants, wherein according to the electrophoresis result and the requirement of mapping software MapmakerVersion 3.0, all the single plants with the RIL52 band type are marked as B, the single plants with the Zhe radiation 802 band type are marked as A, and the single plants with the RIL52 and the Zhe radiation 802 band type are marked as H. QTL positioning and effect estimation are carried out by utilizing a Win QTL Cartogrier V2.5 and a composite interval mapping method, and the result shows that a main effect QTL which simultaneously controls the thickness (Culm Diameter), tillering Number (Tiller Number) and Grain Number per spike (Grain Number) of rice stalks exists on the long arm of the No. 8 chromosome, and the main effect QTL is named as qNPT1 (figure 1 f).

Hybridizing RIL52 with Zhejiang radiation 802, and backcrossing the Zhejiang radiation 802 to obtain BC₁F₂A population; 389 individuals with phenotype similar to RIL52 plants were selected. Further, 93 individuals with a definite phenotype were selected from them, and DNA was extracted for rough localization. The target gene was located between chromosome 8 long arms P6049 and P351 by screening 8 InDel markers in the target region. The remaining 296 individuals were used for fine mapping, and the target gene was mapped between P5528 and P3914. BC that will resemble the RIL52 phenotype₁F₂The single plant is backcrossed with ZF802 continuously to obtainBC for traits of interest₂F₂5326 samples are separated, and the 6 In-Del markers developed In the screens interval are continuously used for screening the exchange individual plants, and finally the target genes are positioned In the 4.1Kbp interval between P139 and P143, wherein the target genes comprise 1 prediction gene. The gene encodes a deubiquitinase, which is a homologous gene of human OTUB1 in rice and is named as OsOTUB1 (figure 2 a). RAP-DB (http:// rapdb.dnas. affrc. go. jp /) predicts the presence of two transcripts for OsOTUB1, where OsOTUB1.1 has 8 exons, 7 introns, coding region 825 bp; OsOTUB1.2 has 5 exons, 4 introns and 597bp coding region. Haplotype analysis of the restriction region revealed that the region from IR66167-27-5-1-6 had 4 SNP differences and a single base insertion difference, one of which was located in the promoter (FIG. 2 b).

The molecular markers used for QNPT1 identification and separation are PCR-based markers including SSR markers derived from microsatellite marker linkage patterns published by McCouch et al (2001, 2002) and self-designed InDel markers, STS markers are SSR target sequences with good microsatellite repeatability obtained by analyzing clone sequences with SSR analysis tools (http:// www.gramene.org/gramene/searches/ssrtol), Primer designs are performed on the target sequences with Primer5 analysis software, 75 pairs of primers are selected from the primers to be uniformly distributed on chromosomes, the markers with good polymorphism among parents are used for genetic background screening, part of the Primer names and sequences are shown in Table 4. the PCR program is slightly modified according to the method of Panaud et al (1996), specifically, 20. mu.l of amplification reaction system is used for each tube, and comprises 0.15. mu.M SSR primers, Tris dNTPs, 1 × PCR buffer (50mM KCl, 10 mM-8.3, and 1.5. mu.5. MgCl. the PCR reaction system comprises 0.15. mu.M SSR primers, Tris dNTPs and 1. mu.5 PCR buffer (50 mM-KC₂0.01% gelatin), 50-100 ng template DNA and 1UTaq enzyme; the reaction procedure is as follows: DNA denaturation at 94 ℃ for 5min, cycling (94 ℃ for 1min, 56 ℃ for 1min, 72 ℃ for 1min) for 36 times, and re-extension at 72 ℃ for 5 min. The amplified PCR product was electrophoresed with 6% polyacrylamide denaturing gel, the voltage was adjusted to 300V, and the electrophoresis was carried out at room temperature for about 3 hours. After electrophoresis, silver staining record band type or gel imaging.

DNA of Zhonghua 11(ZH11) is used as a template to respectively amplify promoter regions of 2.5Kbp OsOTUB1.1 and OsOTUB1.2, and a pCAMBIA-2300 vector (see Hajduewicz et al, 1994) is inserted to form the vectors pCAMBIA-OsOTUB1.1-2300 and pCAMBIA-OsOTUB1.2-2300 carrying the rice self-promoter. Meanwhile, using cDNA of young ear material of ZH11 as a template, amplifying coding region sequences of OsOTUB1.1 and OsOTUB1.2, respectively inserting vectors pCAMBIA-OsOTUB1.1-2300 and pCAMBIA-OsOTUB1.2-2300, and forming a plant expression vector pOsOTUB1.1: : OsOTUB1.1 and pOsOTUB1.2: : OsOTUB1.2. ZH11-npt1 was transformed by an Agrobacterium-mediated method and transgenic plants were obtained. The study found that pOsOTUB1.1: : the primary branch and the secondary branch of the OsOTUB1.1 transgenic positive plant are reduced, the ear is lengthened, the grain number of each ear is obviously reduced, the stem is thinned, the tillering is increased, and the phenotype is similar to that of a ZH11 wild type; and pOsOTUB1.2: : the phenotype of the OsOTUB1.2 transgenic positive plant is similar to that of ZH11-npt 1. The above results indicate that the OsOTUB1.1 transcript has functions and can restore the phenotype of ZH11-npt 1.

Example 2: construction of middle flower 11 background near-isogenic line

The inventor continuously backcrosses RIL52 to obtain middle flowers 11, selects plants with thickened stalks, reduced tillering and increased spike grain number, and utilizes an InDel molecular marker P135 to track and detect a target section; meanwhile, background scanning is carried out on the segments except the target traits, and finally the near isogenic line ZH11-npt1 material which is very close to the genetic background of the Zhonghua 11 is obtained for subsequent research. The late stage of filling ZH11-npt1 shows the phenotype of strong stalks, reduced effective tiller number and increased grain number per spike. Further statistical analysis shows that compared with the ZH11 wild type, ZH11-npt1 internode stems have obviously increased thickness, effective tiller number is reduced by about 2, ear length is slightly shortened (length is 18-20cm), the number of grains per ear is increased by 50-70 grains, and the yield of each plant is increased by about 10% (figure 3).

Example 3: functional verification of NPT1

The method comprises the steps of respectively extracting total RNA (ribonucleic acid) of roots (root), young stalks (culm), leaves (leaf blade), leaf sheaths (leaf sheath), apical meristems (SAM), 0.2cm young ears (young panicle), 6cm ears and 12cm ears of a pair of near-isogenic line seedlings with a middle flower 11 background, carrying out reverse transcription to obtain cDNA (complementary deoxyribonucleic acid), carrying out quantitative PCR (polymerase chain reaction) detection on the expression of OsOTUB1 in different tissues and organs of a pair of materials, wherein OsOTUB1 has higher-level expression in the whole development period of rice, and particularly has high expression in the young ears. Compared with ZH11, OsOTUB1 showed some degree of down-regulation in different tissues and organs of ZH11-npt1 (FIG. 4).

The GUS sequence was amplified using plasmid pB1121(Chen et al, 2003) as a template, and the GUS fragment was recovered and ligated with the vector backbone to construct vector pCAMBIA: : GUS-2300; amplifying the OsOTUB1.1 promoter sequence of 2.5kb, carrying out enzyme digestion, recovering and inserting pCAMBIA: : GUS-2300, which is constructed into pOsOTUB 1: : and (4) GUS. The gene is transferred into ZH11 by an agrobacterium-mediated method, and GUS staining is carried out on organs and tissues of transgenic plants in different development periods, so that the gene is expressed in the whole development period of rice, and is particularly obviously expressed in a vascular bundle system. Seedlings grown for one week were stained and significant OsOTUB1 expression was observed in coleoptiles and roots (FIG. 5 a); expression in both the Quiescent Center (QC) and root cap of the root tip meristem (fig. 5 b); pericycle expression in roots (fig. 5 c); expression in the stalk vascular bundle (FIG. 5 d); the expression is carried out in different stages of ear development, and the expression is gradually reduced in the later stage, and is mainly concentrated on glumes (fig. 5e, f).

Inserting an OsOTUB1.1 promoter into a vector by taking pCAMBIA-2300 as a skeleton vector, and then inserting an OsOTUB1.1 coding sequence and a GFP coding sequence with a stop codon removed in sequence to construct an OsOTUB1.1-GFP fusion protein plant expression vector pOTUB1 driven by a self promoter: OsOTUB1.1-GFP and converts ZH 11. Direct compression observation of transgenic seedling root tips revealed that the OsOTUB1.1-GFP fusion protein was localized in cytoplasm and nucleus (FIG. 6 a). Further enzymolysis of the transgenic positive plant seedling sheath protoplast also confirmed the localization of the OsOTUB1.1-GFP fusion protein in cytoplasm and nucleus (FIG. 6 b).

The pCAMBIA-2300 is used as a skeleton vector to construct pActin: : the OsOTUB1.1 overexpression vector is transferred into ZH11 by an agrobacterium-mediated method, and the OsOTUB1.1 gene expression quantity is detected by real-time quantitative PCR, so that overexpression transgenic strains OE-8 and OE-13 are obtained. The two ultrahigh expression strains show small ears and dwarfing in the late filling stage, leaves have obvious scab-like phenotype, and trypan blue staining is further carried out on the leaves with the scab-like phenotype, so that cell death of part of cells is found. Statistical analysis shows that the ultrahigh expression of OsOTUB1.1 causes the remarkable reduction of the number of primary branches, secondary branches and grains per spike, the plant height is reduced, and the dose effect is presented (figure 7).

The ubiquitination and deubiquitination regulation of target proteins plays an important role in cell and life activities. Rice OsOTUB1 encodes a deubiquitinase, which participates in the depolymerization of ubiquitin chains. OsOTUB1.1 and OsOTUB1.2 are constructed on a prokaryotic expression vector pGEX-4T-1 of GE company, transferred into a Rosetta (DE3) strain to induce and express proteins and purified, and an OTUB1 protein and two substrate ubiquitin chains Tetra-ub of Boston biochem company are purchased. GST-OsOTUB1.1, GST-OsOTUB1.2 and OTUB1 were incubated with two substrate ubiquitin chains, Tetraub-ub, respectively, for 1 hour at 37 ℃ for in vitro deubiquitination experiments. Western Blot detection finds that both Tetra-ub-K48 and Tetra-ub-K63 can be cleaved by OsOTUB1.1 but not by OsOTUB1.2, which indicates that OsOTUB1.1 with complete catalytic active sites can catalyze depolymerization of not only 48 but also 63 ubiquitin chains. Further analyzing the catalytic activity of OsOTUB1.1 on K48 th and K63 ubiquitin chains, finding that the catalytic activity and the depolymerization capability of the OsOTUB1.1 on K48 th and K63 ubiquitin chains are different, the depolymerization capability of the OsOTUB1.1 on the K48 th ubiquitin chain is stronger, and basically all substrates are depolymerized to form Ub 1; while the ability to depolymerize ubiquitin chains at K63 was weak, forming Ub3, Ub2 and Ub1 (FIG. 8).

Example 4: NPT1/OsOTUB1 interacting protein OsUBC13 identification and functional verification

OsOTUB1.1 was constructed on pGBKT7 (Clontech) and the interacting proteins were screened from the rice ear cDNA library using the yeast two-hybrid technique. By adopting a co-transformation method, 200 positive clones are obtained on an-Ade/-His/-Leu/-Trp auxotrophic plate preliminarily, and 40 positive clones are obtained after blue white spot screening. The extracted plasmid was transformed into E.coli again, confirming that OsUBC13(Os01g48280) and OsSPL14(Os08g39890) interact with OsOTUB1.1, respectively.

OsUBC13 encodes a ubiquitin-binding enzyme whose homologous protein UBC13 in animals interacts directly with OTUB1 and is inhibited by OTUB1. OsOTUB1.1 is inserted into pGEX-4T-1 pronucleusExpression vector (purchased from GE) to construct pGEX-4T-OsOTUB1.1; OsUBC13 was inserted into pET-28a prokaryotic expression vector (purchased from Novagen) to construct pET-28a-OsUBC 13. Simultaneously transferring the empty vector and a control protein GST (purchased from GE) into an escherichia coli strain Rosetta, and performing induced expression and purification to obtain GST, GST-OsOTUB1.1 and His-OsUBC13 proteins. GST and GST-OsOTUB1.1 were incubated with Sepharose 4B at 4 ℃ for 1 hour, and then His-OsUBC13 protein was added. Western Blot detection is carried out after 2-hour incubation at 4 ℃, and GST pull-down experiments prove that GST-OsOTUB1.1 and His-OsUBC13 interact. OsOTUB1.1 was ligated into pSY-735-35S-cYFP-HA (Bracha-Drori, K.et al, 2004) vector to express YFP^C-OsOTUB1.1; OsUBC13 was ligated into pSY-736-35S-nYFP-EE (Bracha-Drori, K.et al, 2004) vector to express YFP^N-OsUBC 13. And (3) dissociating the first leaf sheath of the rice seedling for 7 days by adopting an enzyme method to obtain the protoplast. Cotransformation of protoplasts by PEG-mediated method showed YFP^C-OsOTUB1.1 and YFP^NOsUBC13 interacts in the nucleus and cytoplasm (FIGS. 9 a-c).

The pCAMBIA-2300 is taken as a skeleton vector to respectively construct p 35S: OsUBC13 and p 35S: : the OsUBC13-RNAi plant expression vector is converted into ZH11, and the over-expressed OsUBC13 plant height is found to have no obvious change, the tillering is slightly reduced, the stalks are thickened, the number of primary branches and secondary branches is increased, the spike grain number is increased, and the phenotype is similar to NIL-npt 1. The middle part of the stalk between the reverse sections is transversely cut, and the stalk is thickened and thickened, and the number of vascular bundles is increased. The expression of OsUBC13 is reduced through RNAi, the transgenic plant height is found to have no obvious change, but the tillering is reduced, the stem becomes thin, the number of primary branches and secondary branches is reduced, the number of grains per spike is reduced, and the phenotype is similar to that of an OsOTUB1.1 over-expression plant. The middle part of the first internode below the spike is transversely cut, and the stalks are found to be thin and the number of vascular bundles is reduced. The above results indicate that OsOTUB1 has the function of inhibiting OsUBC13 (FIG. 9 d-i).

Example 5: identification and functional verification of NPT1/OsOTUB1 interacting protein OsSPL14

OsSPL14 encodes a transcription factor, which is regulated by miR156 at the RNA level. OsSPL14 has increased transcription level and protein level, and reduced tillering, grain number per ear and yield of riceThousand kernel weight is increased, meanwhile, the stalks become thick and strong, the lodging resistance is enhanced, and further, the yield is improved. To further confirm the interaction and interaction domain of OsOTUB1 and OsSPL14, YFP expression was constructed^N-OsSPL14 full-length and different segment deletion transient expression vectors respectively expressing YFP^CExpression vector transient Co-transformation of rice leaf sheath protoplasts of OsOTUB1.1 Observation of OsOTUB1.1 with the SBP-domain of OsSPL14 (FIG. 10, FIG. 11 a.) this indicates that the SBP domain of rice SPL transcription factor is the key domain for the interaction of OsOTUB1.1 with OsSPL14 Co-immunoprecipitation (Co-immunoprecipitation, Co-IP) is an experimental approach to study Protein interactions in vivo extraction of the ZH11 background pActin:totalprotein of OTUB1.1-GFP transgenic plants incubated with anti-GFP antibody at 4 ℃ for 1h, followed by addition of 40. mu.L Protein G agarose beads followed by Co-incubation at 4 ℃ for 1h, removal of supernatant rinse three times and addition of 2 × loading buffer, water bath for 5min followed by polyacrylamide electrophoresis Western Blot 1 and OsSPL14 Protein interactions in vivo (FIG. 11 b).

Constructing pActin by taking pCAMBIA-2300 as a skeleton vector: : the OsSPL14-RNAi plant expression vector is transformed into ZH11-npt1, and the transgenic plant is observed to find that the reduction of the OsSPL14 expression level leads to the remarkable increase of plant tillering, the number of primary branches and secondary branches at the ear part is reduced, the number of grains per ear is reduced, and the phenotype is partially similar to that of ZH 11. Excellent allele OsSPL14^WFPHybridization to the background of ZH11 found ZH11-OsSPL14^WFPTillering is reduced, the number of primary branches and secondary branches at the ear part is increased, and the number of single-ear grains is increased, which is similar to the ZH11-npt1 phenotype. These studies indicate that OsSPL14 is downstream of OsOTUB1, and both regulate the morphogenesis of rice plant type (panicle type) (FIGS. 11 c-h).

Example 6: cloning and functional analysis of NPT1 homologous Gene

In the database provided by NCBI website (www.ncbi.nih.nlm.gov), through Basic localization search tool (BLAST) alignment, homologous cDNA sequences of wheat, barley, corn, sorghum, Arabidopsis, soybean, mouse and human were obtained, respectively Uura map wheat TuOTUB1(SEQ ID NO: 7), barley HvOTUB1(SEQ ID NO: 8), maize ZmOTUB1(SEQ ID NO: 9), sorghum SbOTUB1(SEQ ID NO: 10), Arabidopsis AtOTUB1(SEQ ID NO: 11), soybean GmOTUB1(SEQ ID NO: 12), mouse MmOTUB1(SEQ ID NO: 13) and human OTUB1(SEQ ID NO: 14), which encode proteins with homology, respectively: TuOTUB1(SEQ ID NO: 16) has 86.43% similarity to OsOTUB1(SEQ ID NO: 4) of rice; HvOTUB1(SEQ ID NO: 17) has 86.79% similarity to OsOTUB 1; ZmOTUB1(SEQ ID NO: 19) had 69.38% similarity to rice OsOTUB 1; sb OTUB1(SEQ ID NO: 18) had 68.10% similarity to rice OsOTUB 1; AtOTUB1(SEQ ID NO: 20) has 59.80% similarity to OsOTUB 1; the similarity of GmOTUB1(SEQ ID NO: 21) to rice OsOTUB1 is 61.32%; MmOTUB1(SEQ ID NO: 22) had a 38.70% similarity to rice OsOTUB 1; HsOTUB1(SEQ ID NO: 23) had a 39.12% similarity to rice OsOTUB1 (FIG. 12).

Homologous genes ZmOTUB1, HvOTUB1, MmOTUB1 and HsOTUB1 of OsOTUB1 were isolated from corn, barley, mouse and human, respectively, by a homologous cloning method, and pOsOTUB1 was constructed: TuOTUB1, pOsOTUB 1: HvOTUB1, pOsOTUB 1: MmOTUB1 and pActin: HsDEP1 vector for transforming ZH11-npt1 rice plant; phenotypic comparison analysis of transgenic rice plants showed that the over-expressed corn, barley, mouse and human OTUB1 homologous genes were able to complement the mutant phenotype of ZH11-npt1 rice plants, indicating that the functions of these homologous genes are conserved (fig. 13).

Example 7: excellent allele npt1 and dep1-1 polymerization breeding application

DEP1 is a main effect QTL for controlling rice erect panicle type and yield traits, and the excellent allele DEP1-1 can improve the activity of rice shoot apical meristem, increase the number of grains per panicle and further improve the yield (see the invention patent application with the applicant's authorization, application number is 201110029759.9, the gene is named as DEP1 at the time, and the original DEP1 is named as DEP1-1 again later for distinguishing different variation types of the same DEP1 gene). In order to evaluate the polymerization effect of dep1-1 and NPT1, NPT1 is introduced into a high-yield japonica rice variety Wuyujing No. 7 (WYJ7-dep1-1) carrying dep1-1(SEQ ID NO: 33) by a hybridization method, and a pair of near-isogenic lines of WYJ7-NPT1-dep1-1 and WYJ7-NPT1-dep1-1 is obtained by molecular marker-assisted selection and continuous backcrossing for 6 times. Years of multi-point field production measurement analysis shows that excellent allele npt1 and dep1-1 polymerization does not affect the heading stage and the plant height of rice, the tillering number is slightly reduced, but the stem thickening, the grain number per ear and the thousand-grain weight can be obviously increased, and further the yield is increased (figure 14). The molecular markers involved in the breeding method are P135 and Pd1, and the sequences are shown in Table 5.

Example 8: NPT1 and homologous genes thereof knocked out by using CRISPR/cas9 system

By Basic Local Alignment Search Tool (BLAST) alignment, homologous cDNA sequences of wheat, barley, corn, sorghum, soybean, rapeseed, cotton and tomato were obtained. And (3) taking the conserved region of the amino acid sequence of the protein coded by the homologous gene as a target sequence to design a target site. The sequence is as follows:

rice: 5' -tcagctggaaagtgttctgcagg

Wheat: 5' -ttaaggcgaacacgaggagatgg

Barley: 5' -ttaagacggacacgaggagatgg

Corn: 5' -aagctttatgttttcctacctgg

Sorghum: 5' -aagctttatgttctcctacttgg

Soybean: 5' -attcgtcgtactcgaggagatgg

Rape: 5' -gttgcaatcaggcgaacaagagg

Cotton: 5' -gcagccattagaagaacgcgagg

Tomato: 5' -gctgccattagaagaacacgtgg

Designing a primer to connect a target sequence into an sgRNA expression cassette (sequence SEQ ID NO: 24-32), and inserting pYLCRISPR/Cas9P into a monocotyledon while performing enzyme digestion_ubi-MH, inserting pYLCRISPR/Cas9P into dicotyledonous plant by edge cutting_35SDH, a method for the production of transgenic positive plants in rice, in particular reference (Ma et al, 2015). Extracting the DNA of different strains of transgenic rice, amplifying gDNA sequence containing target site by PCR, recovering PCR product and sequencing to find out different forms of target site knock-out strains. Wherein 7 bases of the osotub1-C1 mutant gDNA are deleted, which results in a frame shift mutation and premature termination of the amino acid sequence of the encoded protein. Compare ZThe H11, osotsub 1-C1 mutant showed a NIL-npt 1-like phenotype (FIG. 3).

Example 9: transgenic plants with reduced NPT1 gene expression and increased yield

PCR amplifies the cDNA sequence of 300bp at the 5' end of the coding region of the NPT1 gene (namely OsOTUB1 gene), constructs an RNAi interference vector pActin with a palindrome structure: : RNAi-OsOTUB1, and transferred into ZH11 by agrobacterium-mediated method, OsOTUB1 gene expression in transgenic positive plants shows different degrees of down regulation and shows a similar phenotype of ZH11-npt 1. Comparing the ZH11 and RNAi-OsOTUB1, the RNAi-OsOTUB1 transgenic material is found to have shortened spike, thickened stalk, increased number of primary and secondary branches, increased grain number per spike and increased yield (FIG. 15).

TABLE 4 partial primers and sequences for QTL analysis and map-based cloning

TABLE 5 partial primers and sequences for vector construction

It should be understood that while the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein, and any combination of the various embodiments may be made therein without departing from the spirit and scope of the present invention as defined by the following claims.

Reference documents:

Kiewicz P，Svab Z，and Maliga P.(1994).The small，versatilepPZP familyofAgrobacterium binary vectors for plant transformation.Plant MolecularBiology 25.989-994.

Chen P-Y，Wang C-K，Soong S-C，and To K.-Y(2003).Complete sequence ofthe binary vector pBI121 and its application in cloning T-DNA insertion fromtransgenic plants.Molecular Breeding 11，287-293.

Ma X，Zhang Q，Zhu Q，et al.(2015).A Robust CRISPR/Cas9 System forConvenient，High-Efficiency Multiplex Genome Editing in Monocot and DicotPlants.Mol Plant 8，1274-1284.

Bracha-Drori K，Shichrur K，Katz A，et al.(2004).Detection of protein-protein interactions in plants using bimolecular fluorescencecomplementation.Plant J；40：419-427.

sequence listing

<110> institute of genetics and developmental biology of Chinese academy of sciences

<120> ideal plant type gene NPT1 for controlling thickness, tillering number, spike grain number, thousand grain weight and yield of rice stem and application thereof

<130>IB178051

<160>38

<170>PatentIn version 3.1

<210>1

<211>825

<212>DNA

<213> NPT1 cDNA from Zhe radiation 802

<400>1

atgggcgggg actactacca ctcgtgctgc ggcgaccccg accccgacct ccgcgcgccc 60

gaggggccca agctgccgta cgtcggggac aaggaacctc tctccacttt agccgctgag 120

tttcagtctg gcagccccat tttacaggag aaaataaagt tgcttggtga acagtatgat 180

gctttaagaa ggacacgagg agatggaaac tgcttttatc gaagctttat gttttcctac 240

ttggaacata tcctagagac acaagacaaa gctgaggttg agcgcattct aaaaaaaatt 300

gagcagtgca agaagactct tgcagatctt ggatacattg agttcacctt tgaagatttc 360

ttctctatat tcattgatca gctggaaagt gttctgcagg gacatgaatc ctccataggg 420

gccgaagagc ttctagaaag aaccagggat cagatggttt ctgattatgt tgtcatgttc 480

tttaggtttg tcacctctgg tgaaatccaa aggagggctg agttcttcga accattcatc 540

tctggcttga caaattcgac tgtggttcag ttctgcaagg cttccgtgga gccgatgggc 600

gaggaaagtg accatgtcca cataattgcc ctatcagatg cgttgggtgt gccaatccgt 660

gtgatgtacc tagacagaag ctcatgtgat gctggaaata taagtgtgaa ccaccatgat 720

ttcagccctg aggccaattc atcggacggt gctgctgctg ctgagaaacc ttacattact 780

ttgctctacc gtcctggtca ctacgacatt ctctacccga agtga 825

<210>2

<211>825

<212>DNA

<213> npt1 cDNA from IR66167-27-5-1-6

<400>2

atgggcgggg actactacca ctcgtgctgc ggcgaccccg accccgacct ccgcgcgccc 60

gaggggccca agctgccgta cgtcggggac aaggaacctc tctccacttt agccgctgag 120

tttcagtctg gcagccccat tttacaggag aaaataaagt tgcttggtga acagtatgat 180

gctttaagaa ggacacgagg agatggaaac tgcttttatc gaagctttat gttttcctac 240

ttggaacata tcctagagac acaagacaaa gctgaggttg agcgcattct aaaaaaaatt 300

gagcagtgca agaagactct tgcagatctt ggatacattg agttcacctt tgaagatttc 360

ttctctatat tcattgatca gctggaaagt gttctgcagg gacatgaatc ctccataggg 420

gccgaagagc ttctagaaag aaccagggat cagatggttt ctgattatgt tgtcatgttc 480

tttaggtttg tcacctctgg tgaaatccaa aggagggccg agttcttcga accattcatc 540

tctggcttga caaattcgac tgtggttcag ttctgcaagg cttccgtgga gccgatgggc 600

gaggaaagtg accatgtcca cataattgcc ctatcagatg cgttgggtgt gccaatccgt 660

gtgatgtacc tagacagaag ctcatgtgat gctggaaata taagtgtgaa ccaccatgat 720

ttcagccctg aggccaattc atcggacggt gctgctgctg ctgagaaacc ttacattact 780

ttgctctacc gtcctggtca ctacgacatt ctctacccga agtga 825

<210>3

<211>3825

<212>DNA

<213> npt1 gDNA sequence from Zhe radiation 802

<400>3

atgggcgggg actactacca ctcgtgctgc ggcgaccccg accccgacct ccgcgcgccc 60

gaggggccca agctgccgta cgtcggggac aaggtgagat gttgacgcct ctctctcttt 120

ctctgtctct ctcgctcgct ttgactcatc tgcgctttga ctcatctgcg gtcgatagat 180

ttgttcatgt ggtagaaatg ggtctgaatc gtggtaagac gcccagtgtt gccatgccag 240

tatccgctag ttgtgccagc aggtgaggcg atagatcagt cctgttagtc tagttggatg 300

ctgattgttg gtcatcatta ctgttgtatt ggtgctccat ttctatgtga attgacattt 360

taaggcgtct atacaagcag tggggactag aatttggata acaagtaaca atttcccctt 420

attgcgtcat cttaaaggat aagaggagtt atcagatgct ggattttctc ctttattttt 480

agtcgtggtg cctggaataa tggagattgg ctgaacaagt tcatatcagt tgtgtccatt 540

ttcatcctct ggatggtcag tccttaagta ttgtcaggcg ctattgttgt gagttgtaac 600

tgttgtactt gattttttag cttcgttggt gaactgatgt ttggaggttc atgcagaagt 660

cagaaccatg gggaattaga atttggatga acagacagca attacctttc gtgttctctt 720

ctaggaaaag aagggtttat ctgttatcat ttgctggatg tgctccttac ttaatattta 780

tgcatggaat aatagagatg gccaaacaag tttgctccat agcgtattat gattctagga 840

taaaagtggt gtcatccttt aatcgtcaca cctaggacaa taaatgtgaa ggacgaactt 900

gttgatgcag aataatagcc tatgctagtc aattcagcac agaaactgag gttaaatgtg 960

tcccaaaagt ttcagttaag gttcacacta ggatttacac gaacagaaca aatctgcaaa 1020

tatagtccat atgagaaggt ggagagctac atacacacaa tttcatatga aatggaaaat 1080

gatgttggca ctaaacttgg atttaggtca agtagttaga tatttgatgc ctcaaattca 1140

ttttgttctg ttaattgcaa gcaccttttc acaatggagg acactaatgc attgctatga 1200

ttatctctgt gtttgtacag ttattttagg ctatcgtatg actttcttct gctttcattt 1260

gtgttcatta ttgatatctt ttgaaccttg caggaacctc tctccacttt agccgctgag 1320

tttcagtctg gcagccccat tttacaggag aaaataaagg tccatatgga tttggcagtt 1380

ataatatgta atagacatat tttggttgat ctatcgtatcaatggatggt gcttcaattt 1440

gttcttataa tttcttgctt ggtctgcagt tgcttggtga acagtatgat gctttaagaa 1500

ggacacgagg agatggaaac tgcttttatc gaagctttat gttttcctac ttggtattat 1560

ttttggtctg tttccataca aactttgact attttataag ctgatgatct tatcatttgc 1620

ttctaggaac atatcctaga gacacaagac aaagctgagg ttgagcgcat tctaaaaaaa 1680

attgagcagt gcaagaagac tcttgcagat cttggataca ttgagttcac ctttgaagat 1740

ttcttctctg taagtcttta ttgttacttt gtgtggtcct ccttacttat cctgttcaat 1800

tgctgttttg caacttatgc cagatgtatt ccctctgaat agtatgaaga tctgtccgat 1860

tattttcatg tatgcttgtt tgcatttcct ttttagatgt tcctggaata atttttgtat 1920

gagctagtta taatgagagc ttgtgcattt tcctgtcatg caacaaatta aatactagtg 1980

tctaatcctt gtgcattgtt aataactttg aaaatgatta gccttgaaga ttggtccatt 2040

atatatatgt tcacttgttt cttagttagg atcactcacc agtcaccctt ctgaagttca 2100

taatgtatca cttataagta agctagcaaa acaaaatttg gactgtttgt agccacccag 2160

aacccaaata gatggatttc acattatttt ctactggctt tgggagttat ttgatcgatg 2220

ctagtacaac gttgaaattt gggtagttga gatgcgtttt tcacaaagga ctcctttatt 2280

ggtgcttgat ctacaactgg tgttttactt ttttacaaaa aaatgtaatc tccttgcagt 2340

gcactcaaat tattgcaacc tccttcctta tgttcccacc ctcattattt tcagatattc 2400

attgatcagc tggaaagtgt tctgcaggga catgaatcct ccatagggta aatatcctag 2460

agttatattt gtatccttaa tgcatatgac caataatcat gtattaacaa caaagcaatt 2520

tttgtaattg tttataaagt atggcatgtc catcataaat gttttccttc tgtagtgaat 2580

ctattttgtt ttcctgtatc cttagggccg aagagcttct agaaagaacc agggatcaga 2640

tggtttctga ttatggtttg tacatccaga tatgtgtagt atgcctttct ctgctttgct 2700

ctcattattt aactatgtct tctttagttg tcatgttctt taggtttgtc acctctggtg 2760

aaatccaaag gagggctgag ttcttcgaac cattcatctc tggcttgaca aattcgactg 2820

tggttcaggt tagctccata cttccatttt atgagggttt gtacagtcgt tggggaggta 2880

ttatgaggta caatacctcc aggtaccggg agttaccaca cataagcata aaatgtgtgg 2940

tgcctctcca aggaccacaa gaaatctctt cattatattt gtaatgcaca gagcagagag 3000

tacagacaaa tagacctgca ctctgcattt tcattaagta tttagatgtg agattattct 3060

atgttttatc tctcttgtta gtattttttg ctctgtttta taatggaagt tcattttctt 3120

gggaactgtc attcacaaaa caatgagtta tcgtaccctg ccatttagta gggaatttgg 3180

tggtaaaaaa ccattaactt tttcttcaat tttgtgcctt ctgcacaagg tgggataggg 3240

catatattgt ggaacaaaag agtgcacaat gactaattat ttagtatgca tcacactgga 3300

gtatgatata ctagtggaaa ggttatggca aaataccatg atagtagctt gatagattag 3360

caggtccgta agtatttttc caatgataat gttttattca ttaaactgta gcaggataaa 3420

atctacttat gcaccttttt ttcatgagta gcaaacaatg cattctctgg tttgaaaaac 3480

ttgttcaagt tgcagtgtgt tattccaatc cgtgtttgtg tgacaagcaa ttgctggagt 3540

tactgatcct gagttcaatt caatttgcag ttctgcaagg cttccgtgga gccgatgggc 3600

gaggaaagtg accatgtcca cataattgcc ctatcagatg cgttgggtgt gccaatccgt 3660

gtgatgtacc tagacagaag ctcatgtgat gctggaaata taagtgtgaa ccaccatgat 3720

ttcagccctg aggccaattc atcggacggt gctgctgctg ctgagaaacc ttacattact 3780

ttgctctacc gtcctggtca ctacgacatt ctctacccga agtga 3825

<210>4

<211>3824

<212>DNA

<213> npt1 gDNA sequence from IR66167-27-5-1-6

<400>4

atgggcgggg actactacca ctcgtgctgc ggcgaccccg accccgacct ccgcgcgccc 60

gaggggccca agctgccgta cgtcggggac aaggtgagat gttgacgcct ctctctctct 120

ctgtctctct cgctcgcttt gactcatctg cgctttgact catctgcggt cgatagattt 180

gttcatgtgg tagaaatggg tctgaatcgt ggtaagacgc ccagtgttgc catgccagta 240

tccgctagtt gtgccagcag gtgaggcgat agatcagtcc tgttagtcta gttggatgct 300

gattgttggt catcattact gttgtattgg tgctccattt ctatgtgaat tgacatttta 360

aggcgtctat acaagcagtg gggactagaa tttggataac aagtaacaat ttccccttat 420

tgcgtcatct taaaggataa gaggagttat cagatgctgg attttctcct ttatttttag 480

tcgtggtgcc tggaataatg gagattggct gaacaagttc atatcagttg tgtccatttt 540

catcctctgg atggtcagtc cttaagtatt gtcaggcgct attgttgtga gttgtaactg 600

ttgtacttga ttttttagct tcgttggtga actgatgttt ggaggttcat gcagaagtca 660

gaaccatggg gaattagaat ttggatgaac agacagcaat tacctttcgt gttctcttct 720

aggaaaagaa gggtttatct gttatcattt gctggatgtg ctccttactt aatatttatg 780

catggaataa tagagatggc caaacaagtt tgctccatag cgtattatga ttctaggata 840

aaagtggtgt catcctttaa tcgtcacacc taggacaata aatgtgaagg acgaacttgt 900

tgatgcagaa taatagccta tgctagtcaa ttcagcacag aaactgaggt taaatgtgtc 960

ccaaaagttt cagttaaggt tcacactagg atttacacga acagaacaaa tctgcaaata 1020

tagtccatat gagaaggtgg agagctacat acacacaatt tcatatgaaa tggaaaatga 1080

tgttggcact aaacttggat ttaggtcaag tagttagata tttgatgcct caaatttatt 1140

ttgttctgtt aattgcaagc accttttcac aatggaggac actaatgcat tgctatgatt 1200

atctctgtgt ttgtacagtt attttaggct atcgtatgac tttcttctgc tttcatttgt 1260

gttcattatt gatatctttt gaaccttgca ggaacctctc tccactttag ccgctgagtt 1320

tcagtctggc agccccattt tacaggagaa aataaaggtc catatggatt tggcagttat 1380

aatatgtaat agacatattt tggttgatct atcgtatcaa tggatggtgc ttcaatttgt 1440

tcttataatt tcttgcttgg tctccagttg cttggtgaac agtatgatgc tttaagaagg 1500

acacgaggag atggaaactg cttttatcga agctttatgt tttcctactt ggtattattt 1560

ttggtctgtt tccatacaaa ctttgactat tttataagct gatgatctta tcatttgctt 1620

ctaggaacat atcctagaga cacaagacaa agctgaggtt gagcgcattc taaaaaaaat 1680

tgagcagtgc aagaagactc ttgcagatct tggatacatt gagttcacct ttgaagattt 1740

cttctctgta agtctttatt gttactttgt gtggtcctcc ttacttatcc tgttcaattt 1800

ctgttttgca acttatgcca gatgtattcc ctctgaatag tatgaagatc tgtccgatta 1860

ttttcatgta tgcttgtttg catttccttt ttagatgttc ctggaataat ttttgtatga 1920

gctagttata atgagagctt gtgcattttc ctgtcatgca acaaattaaa tactagtgtc 1980

taatccttgt gcattgttaa taactttgaa aatgattagc cttgaagatt ggtccattat 2040

atatatgttc acttgtttct tagttaggat cactcaccag tcacccttct gaagttcata 2100

atgtatcact tataagtaag ctagcaaaac aaaatttgga ctgtttgtag ccacccagaa 2160

cccaaataga tggatttcac attattttct actggctttg ggagttattt gatcgatgct 2220

agtacaacgt tgaaattttg ggtagttgag atgcattttt cacaaaggac tcctttattg 2280

gtgcttgatc tacaactggt gttttacttt tttacaaaaa aatgtaatct ccttgcagtg 2340

cactcaaatt attgcaacct ccttccttat gttcccaccc tcattatttt cagatattca 2400

ttgatcagct ggaaagtgtt ctgcagggac atgaatcctc catagggtaa atatcctaga 2460

gttatatttg tatccttaat gcatatgacc aataatcatg tattaacaac aaagcatttt 2520

ttgtaattgt ttataaagta tggcatgtcc atcataaatg ttttccttct gtagtgaatc 2580

tattttgttt tcctgtatcc ttagggccga agagcttcta gaaagaacca gggatcagat 2640

ggtttctgat tatggtttgt acatccagat atgtgtagta tgcctttctc tgctttgctc 2700

tcattattta actatgtctt ctttagttgt catgttcttt aggtttgtca cctctggtga 2760

aatccaaagg agggccgagt tcttcgaacc attcatctct ggcttgacaa attcgactgt 2820

ggttcaggtt agctccatac ttccattgtatgagggtttg tacagttgtt ggggaggtat 2880

tatgaggtac aatacctcca ggtaccggga gttaccacac ataagcataa aatgtgtggt 2940

gcctctccaa ggaccacaag aaatctcttc attatatttg taatgcacag agcagagagt 3000

acagacaaat agacctgcac tctgcatttt cattaagtat ttagatgtga gattattcta 3060

tgttttatct ctcttgttag tattttttgc tctgttttat aatggaagtt cattttcttg 3120

ggaactgtca ttcacaaaac aatgagttat cgtaccctgc catttagtag ggaatttggt 3180

ggtaaaaaac cattaacttt ttcttcaatt ttgtgccttc tgcacaaggt gggatagggc 3240

atatattgtg gaacaaaaga gtgcacaatg actaattatt tagtatgcat cacactggag 3300

tatgatatac tagtggaaag gttatggcaa aataccatga tagtagcttg atagattagc 3360

aggtccgtaa gtatttttcc aatgataatg ttttattcat taaactgtag caggataaaa 3420

tctacttatg cacctttttt tcatgagtag caaacaatgc attctctggt ttgaaaaact 3480

tgttcaagtt gcagtgtgtt attccaatcc gtgtttgtgt gacaagcaat tgctggagtt 3540

actgatcctg agttcaattc aatttgcagt tctgcaaggc ttccgtggag ccgatgggcg 3600

aggaaagtga ccatgtccac ataattgccc tatcagatgc gttgggtgtg ccaatccgtg 3660

tgatgtacct agacagaagc tcatgtgatg ctggaaatat aagtgtgaac caccatgatt 3720

tcagccctga ggccaattca tcggacggtg ctgctgctgc tgagaaacct tacattactt 3780

tgctctaccg tcctggtcac tacgacattc tctacccgaa gtga 3824

<210>5

<211>2462

<212>DNA

<213> NPT 12.5 kb promoter sequence from Zhejiang radiation 802

<400>5

gagttgaagt tgttgctgct gtcataagta ctatctgcta aatgggcaca ctcctagcat 60

tattagaact gagaaatatc ccaagcaatg aaagcgacaa aaaagtaccc gtttgaagac 120

atgattgaca tggtcacatc aaacaccgga catcaacatc taaatgtaca taacaaggcc 180

aaaataattt tcgatgctgg ttggtgctac caagtcccac gtatgatact taagaatcaa 240

tcatgaatat tacaaatcaa gtcaaactac gttatgtatt gaactcttat aattactgca 300

acatatcaca ctggaatttc ctatggtaat tcctcgccag ccttatccta cccatccctt 360

gcagtatatt aagagcatca acaacaaaca tgattcaaga caacttttat taacactgaa 420

caacataaat tgggaacaaa acaaaccact tggaggcatg attaggataa tcggtattaa 480

agaactggac atcacaattc acaactagat gttgaaataa tacctgtctc ttctttggct 540

catggcaggt gtcagtgaaa tatactgatg ctccaagaga gctggaagca ccgtttccac 600

gtaatcaaaa tgtccttttc gtttgctgca atcaacctta aagggctctt ttgatgctat 660

ctcttcaggc atgtccttta caacttccac ataacctctg gtttgctcaa tgaagtaatc 720

aacatcgaaa acgtctgcaa atccactgac agagaatacc aataagtgat gaactacctt 780

ttgaacagaa ataaactgca taactacaag tagcacagtc gttcatcttg tagagtgatt 840

ctcataccta gattcattcc agtaggcagc aacctcaaac ttgggcagaa ccattgttgc 900

gttgagaagg cgcgcaaccg caattccatc acatagctga agaaacattc ggaagaataa 960

ttacaaccag gagtaacata ataacatagc cagttgaaat cacattcgcc ttgcaatgtg 1020

aaaattttca taaataatct gaaaatttag ttatgccact atatatcatg caacctgcct 1080

ccacgacatt ttaatcatgg agtagaagat aaaacatatg atccccctca ttgaccctac 1140

tatcttacta cttgtgcatg gccgaacgat ctaacagcga aatccagaaa gccaacactc 1200

atttgatccc actaacaacg gaagagagaa acgctagccg agatcgctta acgtacatcg 1260

cgtcgcagct ggttgagccc gccgtagcag tcgatccgga tgtacccatt cctcctcgac 1320

ggagctgcag aagaagagga ggttcaaaac cgcaatcacc accacagtct caagcagaga 1380

tgtccactac ccggatcctt aaacccaaac cacaaatcac ggcgaggtct cacccggcat 1440

tgccgcccgc caccacccgc acgaccgcca ctccgccacc cgccgctgcg cccatatgac 1500

ccgcgacccc gacgccgacg gcgactcctc cctaaagacc aaaagcgagt aagcgagatc 1560

cgtaagcttc tggaacaatc tcgagcatca gctgcaagag gtgaggctgg gccgcgtacc 1620

tggaggtggg aagagtgaag aagaaaggcg gagaggaggg tggagagagg aggaagtaga 1680

gcgcgggggc gaggaagatg accggtagga ggatgcggac gcggctgcgc gcccaccacg 1740

ccgccggcga cgccgacgac gacatcgcct cgccgcgaga agcactggat ctgatcggcc 1800

gccgcctcca cgccggagtg gagagcgtat ataagctcgt cagaatgtgg gcccgtggct 1860

atgtgggccc accatgtcat cgacgcttat caagatcgag cggtggcgtg aggaaaccgg 1920

taggggtggg ggggctaacc aatcggaaac gcgtaataac tcacccgcgg ttcactttct 1980

ccttatgaca cgtgggccca tctcttcctg gacccacctg tcagttaccc ttacggcctc 2040

cactctgagg atctaaacgt aaaaacgaat ttatcggagg gcttatccgc gaggggaaaa 2100

aaacgcgcac ttatttctcg ccttcgccga gatctcggaa gagaagaaca cgcaccgcgg 2160

ggagagggga gagaagcgga aagctccacc gaatcgaagc ccccacacac gcgaagctgg 2220

cgcgggaggc ggccgacgcg agcgcccgga agcgcaaggc ggcggacggc ggcggggagg 2280

gcgacgccgc ggcgacggtc ccggaggagg cggtgatggg ggaggcggcg gcggcagccg 2340

cggcccccga gccggtcgtc gaggggggag gagggggggg ggaggggttg aatcctaacc 2400

ctagcggcgg tgggggagga ggtggtggag ggtgctcgga ctccgtgtcg gtcgagctct 2460

cg 2462

<210>6

<211>2462

<212>DNA

<213> npt 12.5 kb promoter sequence from IR66167-27-5-1-6

<400>6

gagttgaagt tgttgctgct gtcataagta ctatctgcta aatgggcaca ctcctagcat 60

tattagaact gagaaatatc ccaagcaatg aaagcgacaa aaaagtaccc gtttgaagac 120

atgattgaca tggtcacatc aaacaccgga catcaacatc taaatgtaca taacaaggcc 180

aaaataattt tcgatgctgg ttggtgctac caagtcccac gtatgatact taagaatcaa 240

tcatgaatat tacaaatcaa gtcaaactac gttatgtatt gaactcttat aattactgca 300

acatatcaca ctggaatttc ctatggtaat tcctcgccag ccttatccta cccatccctt 360

gcagtatatt aagagcatca acaacaaaca tgattcaaga caacttttat taacactgaa 420

caacataaat tgggaacaaa acaaaccact tggaggcatg attaggataa tcggtattaa 480

agaactggac atcacaattc acaactagat gttgaaataa tacctgtctc ttctttggct 540

catggcaggt gtcagtgaaa tatactgatg ctccaagaga gctggaagca ccgtttccac 600

gtaatcaaaa tgtccttttc gtttgctgca atcaacctta aagggctctt ttgatgctat 660

ctcttcaggc atgtccttca caacttccac ataacctctg gtttgctcaa tgaagtaatc 720

aacatcgaaa acgtctgcaa atccactgac agagaatacc aataagtgat gaactacctt 780

ttgaacagaa ataaactgca taactacaag tagcacagtc gttcatcttg tagagtgatt 840

ctcataccta gattcattcc agtaggcagc aacctcaaac ttgggcagaa ccattgttgc 900

gttgagaagg cgcgcaaccg caattccatc acatagctga agaaacattc ggaagaataa 960

ttacaaccag gagtaacata ataacatagc cagttgaaat cacattcgcc ttgcaatgtg 1020

aaaattttca taaataatct gaaaatttag ttatgccact atatatcatg caacctgcct 1080

ccacgacatt ttaatcatgg agtagaagat aaaacatatg atccccctca ttgaccctac 1140

tatcttacta cttgtgcatg gccgaacgat ctaacagcga aatccagaaa gccaacactc 1200

atttgatccc actaacaacg gaagagagaa acgctagccg agatcgctta acgtacatcg 1260

cgtcgcagct ggttgagccc gccgtagcag tcgatccgga tgtacccatt cctcctcgac 1320

ggagctgcag aagaagagga ggttcaaaac cgcaatcacc accacagtct caagcagaga 1380

tgtccactac ccggatcctt aaacccaaac cacaaatcac ggcgaggtct cacccggcat 1440

tgccgcccgc caccacccgc acgaccgcca ctccgccacc cgccgctgcg cccatatgac 1500

ccgcgacccc gacgccgacg gcgactcctc cctaaagacc aaaagcgagt aagcgagatc 1560

cgtaagcttc tggaacaatc tcgagcatca gctgcaagag gtgaggctgg gccgcgtacc 1620

tggaggtggg aagagtgaag aagaaaggcg gagaggaggg tggagagagg aggaagtaga 1680

gcgcgggggc gaggaagatg accggtagga ggatgcggac gcggctgcgc gcccaccacg 1740

ccgccggcga cgccgacgac gacatcgcct cgccgcgaga agcactggat ctgatcggcc 1800

gccgcctcca cgccggagtg gagagcatat ataagctcgt cagaatgtgg gcccgtggct 1860

atgtgggccc accatgtcat cgacgcttat caagatcgag cggtggcgtg aggaaaccgg 1920

taggggtggg ggggctaacc aatcggaaac gcgtaataac tcacccgcgg ttcactttct 1980

ccttatgaca cgtgggccca tctcttcctg gacccacctg tcagttaccc ttacggcctc 2040

cactctgagg atctaaacgt aaaaacgaat ttatcggagg gcttatccgc gaggggaaaa 2100

aaacgcgcac ttatttctcg ccttcgccga gatctcggaa gagaagaaca cgcaccgcgg 2160

ggagagggga gagaagcgga aagctccacc gaatcgaagc ccccacacac gcgaagctgg 2220

cgcgggaggc ggccgacgcg agcgcccgga agcgcaaggc ggcggacggc ggcggggagg 2280

gcgacgccgc ggcgacggtc ccggaggagg cggtgatggg ggaggcggcg gcggcagccg 2340

cggcccccga gccggtcgtc gaggggggag gagggggggg ggaggggttg aatcctaacc 2400

ctagcggcgg tgggggagga ggtggtggag ggtgctcgga ctccgtgtcg gtcgagctct 2460

cg 2462

<210>7

<211>840

<212>DNA

<213> TuNPT1 cDNA sequence of wheat in Ural plot

<400>7

atgggcgggg actactacca cgcctgctgc ggcgacccgg accccgacca caagcccgag 60

ggaccccagg tgccgtacat cggtaacaag gaacctctct ccgccttagc agcagagttc 120

cagtctggca gccccatttt acaggagaaa ataaagttgc ttggtgaaca atatgatgct 180

ttaaggcgaa cacgaggaga tggaaactgc ttttatcgaa gctttatgtt ctcctacctg 240

gaacatatcc tagagacaca agatagagct gaggttgagc gcatcctaaa aaacattgaa 300

cagtgcaaga tgacactttc aggtcttgga tacattgaat tcacttttga agacttcttc 360

tctatgttca ttgaggagct gcaaaatgtt ctgcagggac acgaaacttc tattgggcct 420

gaagaacttc tagaaagaac cagggatcaa acgacttctg attatgttgt catgttcttt 480

aggtttgtta cctctggtga aattcaaagg agggctgagt tctttgaacc atttatttct 540

ggcttgacaa attcgaccgt ggctcagttt tgcaagtctt ctgtggagcc aatgggcgag 600

gaaagcgacc atgtgcacat tattgctctg tcagatgcgt taggggtgcc aatccgcgtg 660

atgtacctag accgaagctc ctgtgacaca ggcaatctaa gtgtgaacca ccatgatttc 720

attcctgcag ccaattcctc tgaaggtgat gctgcaatgg gattaaatcc ggctgaggag 780

aaaccttaca ttactctgct ctaccggcct ggtcactatg atattctcta cccaaagtga 840

<210>8

<211>840

<212>DNA

<213> barley HvNPT1 cDNA sequence

<400>8

atgggcgggg actactacca cgcctgctgc ggcgaccccg accccgaccc caagcccgag 60

ggaccccagg tgccgtacatcggtaacaag gaacctctct ccgccttagc agcagagttc 120

cagtctggca gccccatttt acaggagaaa ataaagttgc ttggtgaaca atatgatgct 180

ttaagacgga cacgaggaga tggaaactgc ttttatcgaa gctttatgtt ctcctacctg 240

gaacatatcc ttgagacaca agacagagct gaggttgagc gcatcctaaa aaacattgaa 300

caatgcaaga agacactttc aggtcttgga tacattgagt tcacttttga ggacttcttc 360

tctatgttca ttgaggagct gcaaaatgtt ctgcagggac acggaacttc tattgggcct 420

gaagaacttc tagaaagaac cagggatcag acgacttctg attatgttgt catgttcttt 480

agatttgtta cctctggtga aattcaaagg agggctgagt tctttgaacc atttatttct 540

ggcttgacaa attcgaccgt ggttcagttt tgcaagtctt ctgtggagcc aatgggcgag 600

gaaagtgacc atgtgcacat tattgctctg tcagatgcgt taggggtgcc aatccgcgtg 660

atgtacctag accgaagctc ttgtgacaca ggcaatctaa gtgtgaacca ccatgatttc 720

atccctgcag ccaattcctc tgaaggtgat gctgcaatgg gattaaatcc tgctgatgag 780

aaaccttaca ttactctgct ctaccggcct ggtcactatg acattctcta cccgaagtga 840

<210>9

<211>891

<212>DNA

<213> maize ZmNPT1 cDNA sequence

<400>9

atgggcgacg ttccacaggc gccgcacgct gcgggaggtg gagaagagtg ggcggggccg 60

gaccctaacc ctagcccgag cctcggcggc tgctcggacc ccgtgtcggt ggagctctcc 120

atgggcgggg actactaccg cgcctgctgc ggcgagcccg atcccgacat ccccgagggg 180

cccaagctgc cgtgcgttgg ggacaaggaa cctctctcct ctttagcagc tgagtttcag 240

tctggcagcc ccattttaca agagaaaatt aagttgcttg gcgagcaata tggtgcttta 300

agacgtacac gtggagatgg aaactgcttt tatcgaagct ttatgttttc ctacctggaa 360

cacatcctag agacacaaga caaagctgag gctgatcgca tcatggtaaa aattgaggaa 420

tgcaagaaaa cactcctctc tcttggatat attgagttca cttttgagga cttcttttcg 480

atattcattg aactgctgga aagtgttctg cagggacatg aaactcctat agggtttgtc 540

acttctggtg aaattcaaag gaggtctgac ttctttgaac cgttcatatc tggcttgaca 600

aattcaaccg tggttcagtt ctgcaaggct tctgtggaac ctatgggtga ggaaagtgac 660

catgtgcaca taattgccct atcagatgca ctaggcgtac caatccgtgt tatgtaccta 720

gaccgaagct cgtgtgacac tggcaacctg agcgtgaatc accacgattt catcccgtcg 780

gccaatgatt cggagggtga tgcggccacg acacctgctc ctgccacaga gaaaccgtac 840

atcactttgc tctaccgtcc tggccactac gatattctct acccaaagtg a 891

<210>10

<211>909

<212>DNA

<213> sorghum SbNPT1 cDNA sequence

<400>10

atgggcgacg tgccccaggc gccgcacgcc gcggaaggag gaggaggagg actggaggag 60

ggggcggtgc ccgaccctaa ccctagcccg agcctgagcc tcggcggctg ctcggacccc 120

gtgtcgctgg agctctccat gggcggggac tactaccgcg cctgctgcgg cgaccccgac 180

cccgacatcc ccgaggggcc caagctgccg tgcgttgggg aaaaggaacc tctctcctct 240

ttagcagccg agtttcagtc tggcagcccc attttacaag agaaaattaa gttgcttggc 300

gaacaatatg gtgctttaag acggacacgt ggagatggaa actgctttta tcgaagcttt 360

atgttctcct acttggaaca catcctagag acacaagaca aagctgaggc tgatcgcatc 420

atggtaaaaa ttgaggattg caagaagacg ctcctgtctc ttggatatat tgagttcact 480

tttgaggatt tctttgcgat attcattgat atgctggaaa gtgttctgca gggacatgaa 540

actcctatag ggtttgtcac ttctggtgaa attcaaagga ggtctgactt ctttgaacca 600

ttcatatctg gcttgacaaa ttcaactgtg gttcagttct gcaaggcttc tgtggaacct 660

atgggtgagg aaagtgacca tgttcacata attgccctat cggatgcact aggtgtacct 720

atccgtgtta tgtacctaga ccgaagctcg tgtgatactg gcaatctgag tgtgaatcac 780

catgatttca tcccttcgtc caatgcttct gagggtgatg ctgcgatgac atctactcct 840

gacgctgaga aaccttacat cactttgctc taccgtcctg gtcactatga tattctctac 900

ccaaagtga 909

<210>11

<211>906

<212>DNA

<213> Soybean GmNPT1 cDNA sequence

<400>11

atgcagagta aagaagctgt tgtggaagat ggggaaataa agagtgtgac tgctgtaggg 60

tctgaaattg atgggtggac caattttggg gacgatgaca taatgcagca gcagtataca 120

attcagtctg aagaggctaa gaaagttcca tctgtgggcg acaaggaacc actgagtagc 180

ttagctgctg aatataaatc aggcagtcct atcttgctgg agaaaataaa ggtgcttgat 240

gagcaatacg ctgccattcg tcgtactcga ggagatggaa actgcttctt tcgaagcttt 300

atgttttcat atcttgagca tgttatgaaa tgtcaagacc aagcagaagt tgatcgtatc 360

caagccaatg ttgaaaaaag tagaaaagca ctgcagacct tgggttatgc agacttgact 420

tttgaagatt tttttgcgtt attccttgag cagctggaat ctgttattca agggaaagag 480

acttccataa gtcatgaaga gcttgttctt agaagccgag atcagtcagt atctgattat 540

gtcgttatgt tcttcagatt tgttacctct gccgcaatac aaaagcgcac agaatttttt 600

gaaccattca tactaggctt aactaataca acggtcgagc agttttgcaa atcatctgtt 660

gaaccaatgg gtgaagagag cgaccatgtg cacattactg ccctttcaga tgcattgggc 720

attccagtcc gtgttgtgta ccttgaccgc agctcaagtg atactggtgg tgtcagtgta 780

aatcatcatg atttcatgcc agtggctggt gatctcccaa atgctagttg cagctctgaa 840

aagaacattc ctttcatcac actactatat cgtcctggtc actatgacat cctctatcca 900

aaatga 906

<210>12

<211>903

<212>DNA

<213> rape BnNPT1 cDNA sequence

<400>12

atgcagaatc agaatgatac ggtgaaggat gatgcggagc tcgctgcttc catctcggct 60

gaacaatggg gatgctgttc agtggaggaa ccatcttttc aagatgatga agctgctaaa 120

gttccttatg ttggtgataa ggagcctatg tctagtttagctgcagagta ccaagcaggg 180

agccccattt tgcttgagaa gataaaggta ctggacagtc aatatgttgc aatcaggcga 240

acaagaggag atggaaactg cttcttccga agttttatgt tctcttacct tgagcatatt 300

ttggaatcac aagatggtgc tgaagttgac cgtatcaagc tcaatgttga aaaatgtaga 360

aagaatctgc agaacttagg ctacacagat ttcacatttg aggacttctt tgcgttgttc 420

cttgagcaac tagatgacat cctccaagga ggcgaagagt ctataagcta tgatgagctg 480

gttaacagaa gtagagatca gtctgtttcc gactacattg tgatgttctt caggtttgtt 540

actgctggtg aaataaaaac gcgtgctgag ttcttcgagc cttttataac aggattatct 600

aataccacag tggatcagtt ttgcaagaca tcagttgaac cgatggggga agagagtgac 660

catattcaca taacagcttt gtcggacgcg cttggtgttg caatccgggt tgtgtatctt 720

gaccgtagct catgtgatac tggaggtggt gtcactgtga accatcacga ctttgttccc 780

gttggcagtg gcactaatga gaaagaagaa gcttcttctg ctgctccctt tataacattg 840

ctctatcgtc caggccatta cgatatcctc taccccaagg tattggagaa tgtggaaaaa 900

tga 903

<210>13

<211>912

<212>DNA

<213> Cotton GhNPT1 cDNA sequence

<400>13

atgcaaaatc aggatggagc ggtagctgat agggaaaagg aatctgctgt atccattccc 60

atttctgaag ttgatgactg ggcaaatttc gcagatgatg atatcatgca gcaacaatct 120

gccattcatg ctgaggaggc caagaaaatt ccatttgttg gtgacaagga accactctct 180

atgttggcag ctgaatatga atcaggaagt cctatattgc tagaaaaaat aaaggtgctt 240

gatcagcaat atgcagccat tagaagaacg cgaggagatg gaaactgctt tttccggagt 300

tttatgtttt cataccttga acatattttg gaatctcaag accgtgctga ggttgatcgt 360

atcaaaggca atgttgaaga atgtagaaag ccacttcagc gcttagccca cacagatttt 420

acatttgagg actttttttc gttattcctt gagcagctgg aatgcgttct tcaaggaaat 480

gaagattcca taagtcagga tgaattaata ctaaggagtc gagatcagtc aatttccgac 540

tatgttgtaa tgttcttcag gtttgttacc tctggtgaaa tacgaaagcg atcagagttt 600

ttcgaaccct ttattttggg attaacaaat gcaacagtgg aacagttttg caagtcatcc 660

gtagagccaa tgggtgaaga gagtgatcat gtgcacatta ctgccctttc agacgctctg 720

ggcgtgccaa ttcgtgttgt gtaccttgat cggagctctt gtgacattgg tggtgttagt 780

gtaaaccatc atgattttct tcctacttcg ggcgataagt caaatgctaa aggtggtagc 840

actgtccctg tcaagccttt tattaccttg ctatatcgtc caggccacta tgacattctc 900

tatccaaagt ga 912

<210>14

<211>906

<212>DNA

<213> tomato SlNPT1 cDNA sequence

<400>14

atgcaggatc aggatgtgga tgtggatgtg gctgatgcag caaaagaaac gtttacatct 60

tctgaaactg atgactggaa aaaatacaag gatgatgata ttatgcaaca gcactctgcc 120

atacaagctg aacaagctgt aaaagttcca tttcttggtg ataaggaacc tttgtcctca 180

ttagaagctg aataccatct gggaaattca attgtgcttg agaaaataaa ggtgctgagt 240

gaacagtatg ctgccattag aagaacacgt ggagatggga actgcttttt ccgcagtttc 300

atgtttggtt accttgagca cattctggaa tcacaagatc acaatgaagt tcaacacatt 360

aaatctaata ttgaggaatg caagaagaca cttcaaagtt tgggctatgc agaattcacc 420

tttgaagact tttttgcatt attcctcgag caactcgata gtgttcttca aggtagcgaa 480

gattccataa gtcatgatga actcctgtgc agaagtcgtg atccatcaat ttctgactat 540

gttgttatgt tcttcagatt tgtgacatca ggtgaaataa gaaagcggtc cgagtttttc 600

gaaccattta ttctaggact aacaaatacc tcagtggagc agttttgcaa gtcagcagtg 660

gaacccatgg gtgaagagag tgatcatgtg caaattacag ccctatcaga tgcattgggt 720

gtaccgatcc gtgttgtata tcttgaccga agctcatgtg agaacaacag catcaatgta 780

aatcaccatg actttattcc tactagcagg gaggtcggga atagtgatgt ttccaagacc 840

acaaatcgtc catctatcac cctgctgtat cgcccagggc attatgacat tctgtacccc 900

aagtga 906

<210>15

<211>274

<212>PRT

<213> Rice OsOTUB1 protein

<400>15

Met Gly Gly Asp Tyr Tyr His Ser Cys Cys Gly Asp Pro Asp Pro Asp

15 10 15

Leu Arg Ala Pro Glu Gly Pro Lys Leu Pro Tyr Val Gly Asp Lys Glu

20 25 30

Pro Leu Ser Thr Leu Ala Ala Glu Phe Gln Ser Gly Ser Pro Ile Leu

35 40 45

Gln Glu Lys Ile Lys Leu Leu Gly Glu Gln Tyr Asp Ala Leu Arg Arg

50 55 60

Thr Arg Gly Asp Gly Asn Cys Phe Tyr Arg Ser Phe Met Phe Ser Tyr

65 70 75 80

Leu Glu His Ile Leu Glu Thr Gln Asp Lys Ala Glu Val Glu Arg Ile

85 90 95

Leu Lys Lys Ile Glu Gln Cys Lys Lys Thr Leu Ala Asp Leu Gly Tyr

100 105 110

Ile Glu Phe Thr Phe Glu Asp Phe Phe Ser Ile Phe Ile Asp Gln Leu

115 120 125

Glu Ser Val Leu Gln Gly His Glu Ser Ser Ile Gly Ala Glu Glu Leu

130 135 140

Leu Glu Arg Thr Arg Asp Gln Met Val Ser Asp Tyr Val Val Met Phe

145 150 155 160

Phe Arg Phe Val Thr Ser Gly Glu Ile Gln Arg Arg Ala Glu Phe Phe

165170 175

Glu Pro Phe Ile Ser Gly Leu Thr Asn Ser Thr Val Val Gln Phe Cys

180 185 190

Lys Ala Ser Val Glu Pro Met Gly Glu Glu Ser Asp His Val His Ile

195 200 205

Ile Ala Leu Ser Asp Ala Leu Gly Val Pro Ile Arg Val Met Tyr Leu

210 215 220

Asp Arg Ser Ser Cys Asp Ala Gly Asn Ile Ser Val Asn His His Asp

225 230 235 240

Phe Ser Pro Glu Ala Asn Ser Ser Asp Gly Ala Ala Ala Ala Glu Lys

245 250 255

Pro Tyr Ile Thr Leu Leu Tyr Arg Pro Gly His Tyr Asp Ile Leu Tyr

260 265 270

Pro Lys

<210>16

<211>279

<212>PRT

<213> TuOTUB1 protein of wheat in Ural chart

<400>16

Met Gly Gly Asp Tyr Tyr His Ala Cys Cys Gly Asp Pro Asp Pro Asp

1 5 10 15

His Lys Pro Glu Gly Pro Gln Val Pro Tyr Ile Gly Asn Lys Glu Pro

20 25 30

Leu Ser Ala Leu Ala Ala Glu Phe Gln Ser Gly Ser Pro Ile Leu Gln

35 40 45

Glu Lys Ile Lys Leu Leu Gly Glu Gln Tyr Asp Ala Leu Arg Arg Thr

50 55 60

Arg Gly Asp Gly Asn Cys Phe Tyr Arg Ser Phe Met Phe Ser Tyr Leu

65 70 75 80

Glu His Ile Leu Glu Thr Gln Asp Arg Ala Glu Val Glu Arg Ile Leu

85 90 95

Lys Asn Ile Glu Gln Cys Lys Met Thr Leu Ser Gly Leu Gly Tyr Ile

100 105 110

Glu Phe Thr Phe Glu Asp Phe Phe Ser Met Phe Ile Glu Glu Leu Gln

115 120 125

Asn Val Leu Gln Gly His Glu Thr Ser Ile Gly Pro Glu Glu Leu Leu

130 135 140

Glu Arg Thr Arg Asp Gln Thr Thr Ser Asp Tyr Val Val Met Phe Phe

145 150 155 160

Arg Phe Val Thr Ser Gly Glu Ile Gln Arg Arg Ala Glu Phe Phe Glu

165 170 175

Pro Phe Ile Ser Gly Leu Thr Asn Ser Thr Val Ala Gln Phe Cys Lys

180 185 190

Ser Ser Val Glu Pro Met Gly Glu Glu Ser Asp His Val His Ile Ile

195 200 205

Ala Leu Ser Asp Ala Leu Gly Val Pro Ile Arg Val Met Tyr Leu Asp

210 215 220

Arg Ser Ser Cys Asp Thr Gly Asn Leu Ser Val Asn His His Asp Phe

225 230 235 240

Ile Pro Ala Ala Asn Ser Ser Glu Gly Asp Ala Ala Met Gly Leu Asn

245 250 255

Pro Ala Glu Glu Lys Pro Tyr Ile Thr Leu Leu Tyr Arg Pro Gly His

260 265 270

Tyr Asp Ile Leu Tyr Pro Lys

275

<210>17

<211>279

<212>PRT

<213> barley HvOTUB1 protein

<400>17

Met Gly Gly Asp Tyr Tyr His Ala Cys Cys Gly Asp Pro Asp Pro Asp

1 5 10 15

Pro Lys Pro Glu Gly Pro Gln Val Pro Tyr Ile Gly Asn Lys Glu Pro

20 25 30

Leu Ser Ala Leu Ala Ala Glu Phe Gln Ser Gly Ser Pro Ile Leu Gln

35 40 45

Glu Lys Ile Lys Leu Leu Gly Glu Gln Tyr Asp Ala Leu Arg Arg Thr

50 55 60

Arg Gly Asp Gly Asn Cys Phe Tyr Arg Ser Phe Met Phe Ser Tyr Leu

65 70 75 80

Glu His Ile Leu Glu Thr Gln Asp Arg Ala Glu Val Glu Arg Ile Leu

85 90 95

Lys Asn Ile Glu Gln Cys Lys Lys Thr Leu Ser Gly Leu Gly Tyr Ile

100 105 110

Glu Phe Thr Phe Glu Asp Phe Phe Ser Met Phe Ile Glu Glu Leu Gln

115 120 125

Asn Val Leu Gln Gly His Gly Thr Ser Ile Gly Pro Glu Glu Leu Leu

130 135 140

Glu Arg Thr Arg Asp Gln Thr Thr Ser Asp Tyr Val Val Met Phe Phe

145 150 155 160

Arg Phe Val Thr Ser Gly Glu Ile Gln Arg Arg Ala Glu Phe Phe Glu

165 170 175

Pro Phe Ile Ser Gly Leu Thr Asn Ser Thr Val Val Gln Phe Cys Lys

180 185 190

Ser Ser Val Glu Pro Met Gly Glu Glu Ser Asp His Val His Ile Ile

195 200 205

Ala Leu Ser Asp Ala Leu Gly Val Pro Ile Arg Val Met Tyr Leu Asp

210 215 220

Arg Ser Ser Cys Asp Thr Gly Asn Leu Ser Val Asn His His Asp Phe

225 230 235 240

Ile Pro Ala Ala Asn Ser Ser Glu Gly Asp Ala Ala Met Gly Leu Asn

245 250 255

Pro Ala Asp Glu Lys Pro Tyr Ile Thr Leu Leu Tyr Arg Pro Gly His

260 265 270

Tyr Asp Ile Leu Tyr Pro Lys

275

<210>18

<211>296

<212>PRT

<213> maize ZmOTUB1 protein

<400>18

Met Gly Asp Val Pro Gln Ala Pro His Ala Ala Gly Gly Gly Glu Glu

1 5 10 15

Trp Ala Gly Pro Asp Pro Asn Pro Ser Pro Ser Leu Gly Gly Cys Ser

20 25 30

Asp Pro Val Ser Val Glu Leu Ser Met Gly Gly Asp Tyr Tyr Arg Ala

35 40 45

Cys Cys Gly Glu Pro Asp Pro Asp Ile Pro Glu Gly Pro Lys Leu Pro

50 55 60

Cys Val Gly Asp Lys Glu Pro Leu Ser Ser Leu Ala Ala Glu Phe Gln

65 70 75 80

Ser Gly Ser Pro Ile Leu Gln Glu Lys Ile Lys Leu Leu Gly Glu Gln

85 90 95

Tyr Gly Ala Leu Arg Arg Thr Arg Gly Asp Gly Asn Cys Phe Tyr Arg

100 105 110

Ser Phe Met Phe Ser Tyr Leu Glu His Ile Leu Glu Thr Gln Asp Lys

115 120 125

Ala Glu Ala Asp Arg Ile Met Val Lys Ile Glu Glu Cys Lys Lys Thr

130 135 140

Leu Leu Ser Leu Gly Tyr Ile Glu Phe Thr Phe Glu Asp Phe Phe Ser

145 150 155 160

Ile Phe Ile Glu Leu Leu Glu Ser Val Leu Gln Gly His Glu Thr Pro

165 170 175

Ile Gly Phe Val Thr Ser Gly Glu Ile Gln Arg Arg Ser Asp Phe Phe

180 185 190

Glu Pro Phe Ile Ser Gly Leu Thr Asn Ser Thr Val Val Gln Phe Cys

195 200 205

Lys Ala Ser Val Glu Pro Met Gly Glu Glu Ser Asp His Val His Ile

210 215 220

Ile Ala Leu Ser Asp Ala Leu Gly Val Pro Ile Arg Val Met Tyr Leu

225 230 235 240

Asp Arg Ser Ser Cys Asp Thr Gly Asn Leu Ser Val Asn His His Asp

245 250 255

Phe Ile Pro Ser Ala Asn Asp Ser Glu Gly Asp Ala Ala Thr Thr Pro

260 265 270

Ala Pro Ala Thr Glu Lys Pro Tyr Ile Thr Leu Leu Tyr Arg Pro Gly

275 280 285

His Tyr Asp Ile Leu Tyr Pro Lys

290 295

<210>19

<211>302

<212>PRT

<213> sorghum sbOTUB1 protein

<400>19

Met Gly Asp Val Pro Gln Ala Pro His Ala Ala Glu Gly Gly Gly Gly

1 5 10 15

Gly Leu Glu Glu Gly Ala Val Pro Asp Pro Asn Pro Ser Pro Ser Leu

20 25 30

Ser Leu Gly Gly Cys Ser Asp Pro Val Ser Leu Glu Leu Ser Met Gly

35 40 45

Gly Asp Tyr Tyr Arg Ala Cys Cys Gly Asp Pro Asp Pro Asp Ile Pro

50 55 60

Glu Gly Pro Lys Leu Pro Cys Val Gly Glu Lys Glu Pro Leu Ser Ser

65 70 75 80

Leu Ala Ala Glu Phe Gln Ser Gly Ser Pro Ile Leu Gln Glu Lys Ile

85 90 95

Lys Leu Leu Gly Glu Gln Tyr Gly Ala Leu Arg Arg Thr Arg Gly Asp

100 105 110

Gly Asn Cys Phe Tyr Arg Ser Phe Met Phe Ser Tyr Leu Glu His Ile

115 120 125

Leu Glu Thr Gln Asp Lys Ala Glu Ala Asp Arg Ile Met Val Lys Ile

130 135 140

Glu Asp Cys Lys Lys Thr Leu Leu Ser Leu Gly Tyr Ile Glu Phe Thr

145 150 155 160

Phe Glu Asp Phe Phe Ala Ile Phe Ile Asp Met Leu Glu Ser Val Leu

165 170 175

Gln Gly His Glu Thr Pro Ile Gly Phe Val Thr Ser Gly Glu Ile Gln

180 185 190

Arg Arg Ser Asp Phe Phe Glu Pro Phe Ile Ser Gly Leu Thr Asn Ser

195 200 205

Thr Val Val Gln Phe Cys Lys Ala Ser Val Glu Pro Met Gly Glu Glu

210 215 220

Ser Asp His Val His Ile Ile Ala Leu Ser Asp Ala Leu Gly Val Pro

225 230 235 240

Ile Arg Val Met Tyr Leu Asp Arg Ser Ser Cys Asp Thr Gly Asn Leu

245 250 255

Ser Val Asn His His Asp Phe Ile Pro Ser Ser Asn Ala Ser Glu Gly

260 265 270

Asp Ala Ala Met Thr Ser Thr Pro Asp Ala Glu Lys Pro Tyr Ile Thr

275 280 285

Leu Leu Tyr Arg Pro Gly His Tyr Asp Ile Leu Tyr Pro Lys

290 295 300

<210>20

<211>301

<212>PRT

<213> Soybean GmOTUB1 protein

<400>20

Met Gln Ser Lys Glu Ala Val Val Glu Asp Gly Glu Ile Lys Ser Val

1 5 10 15

Thr Ala Val Gly Ser Glu Ile Asp Gly Trp Thr Asn Phe Gly Asp Asp

20 25 30

Asp Ile Met Gln Gln Gln Tyr Thr Ile Gln Ser Glu Glu Ala Lys Lys

35 40 45

Val Pro Ser Val Gly Asp Lys Glu Pro Leu Ser Ser Leu Ala Ala Glu

50 55 60

Tyr Lys Ser Gly Ser Pro Ile Leu Leu Glu Lys Ile Lys Val Leu Asp

65 70 75 80

Glu Gln Tyr Ala Ala Ile Arg Arg Thr Arg Gly Asp Gly Asn Cys Phe

85 90 95

Phe Arg Ser Phe Met Phe Ser Tyr Leu Glu His Val Met Lys Cys Gln

100 105 110

Asp Gln Ala Glu Val Asp Arg Ile Gln Ala Asn Val Glu Lys Ser Arg

115 120 125

Lys Ala Leu Gln Thr Leu Gly Tyr Ala Asp Leu Thr Phe Glu Asp Phe

130 135 140

Phe Ala Leu Phe Leu Glu Gln Leu Glu Ser Val Ile Gln Gly Lys Glu

145 150 155 160

Thr Ser Ile Ser His Glu Glu Leu Val Leu Arg Ser Arg Asp Gln Ser

165 170 175

Val Ser Asp Tyr Val Val Met Phe Phe Arg Phe Val Thr Ser Ala Ala

180 185 190

Ile Gln Lys Arg Thr Glu Phe Phe Glu Pro Phe Ile Leu Gly Leu Thr

195 200 205

Asn Thr Thr Val Glu Gln Phe Cys Lys Ser Ser Val Glu Pro Met Gly

210 215 220

Glu Glu Ser Asp His Val His Ile Thr Ala Leu Ser Asp Ala Leu Gly

225 230 235 240

Ile Pro Val Arg Val Val Tyr Leu Asp Arg Ser Ser Ser Asp Thr Gly

245 250 255

Gly Val Ser Val Asn His His Asp Phe Met Pro Val Ala Gly Asp Leu

260 265 270

Pro Asn Ala Ser Cys Ser Ser Glu Lys Asn Ile Pro Phe Ile Thr Leu

275 280 285

Leu Tyr Arg Pro Gly His Tyr Asp Ile Leu Tyr Pro Lys

290 295 300

<210>21

<211>300

<212>PRT

<213> rape BnOTUB1 protein

<400>21

Met Gln Asn Gln Asn Asp Thr Val Lys Asp Asp Ala Glu Leu Ala Ala

1 5 10 15

Ser Ile Ser Ala Glu Gln Trp Gly Cys Cys Ser Val Glu Glu Pro Ser

20 25 30

Phe Gln Asp Asp Glu Ala Ala Lys Val Pro Tyr Val Gly Asp Lys Glu

35 40 45

Pro Met Ser Ser Leu Ala Ala Glu Tyr Gln Ala Gly Ser Pro Ile Leu

50 55 60

Leu Glu Lys Ile Lys Val Leu Asp Ser Gln Tyr Val Ala Ile Arg Arg

65 70 75 80

Thr Arg Gly Asp Gly Asn Cys Phe Phe Arg Ser Phe Met Phe Ser Tyr

85 90 95

Leu Glu His Ile Leu Glu Ser Gln Asp Gly Ala Glu Val Asp Arg Ile

100 105 110

Lys Leu Asn Val Glu Lys Cys Arg Lys Asn Leu Gln Asn Leu Gly Tyr

115 120 125

Thr Asp Phe Thr Phe Glu Asp Phe Phe Ala Leu Phe Leu Glu Gln Leu

130 135 140

Asp Asp Ile Leu Gln Gly Gly Glu Glu Ser Ile Ser Tyr Asp Glu Leu

145 150 155 160

Val Asn Arg Ser Arg Asp Gln Ser Val Ser Asp Tyr Ile Val Met Phe

165 170 175

Phe Arg Phe Val Thr Ala Gly Glu Ile Lys Thr Arg Ala Glu Phe Phe

180 185 190

Glu Pro Phe Ile Thr Gly Leu Ser Asn Thr Thr Val Asp Gln Phe Cys

195 200 205

Lys Thr Ser Val Glu Pro Met Gly Glu Glu Ser Asp His Ile His Ile

210 215 220

Thr Ala Leu Ser Asp Ala Leu Gly Val Ala Ile Arg Val Val Tyr Leu

225 230 235 240

Asp Arg Ser Ser Cys Asp Thr Gly Gly Gly Val Thr Val Asn His His

245 250 255

Asp Phe Val Pro Val Gly Ser Gly Thr Asn Glu Lys Glu Glu Ala Ser

260 265 270

Ser Ala Ala Pro Phe Ile Thr Leu Leu Tyr Arg Pro Gly His Tyr Asp

275 280 285

Ile Leu Tyr Pro Lys Val Leu Glu Asn Val Glu Lys

290 295 300

<210>22

<211>303

<212>PRT

<213> cotton GhOTUB1 protein

<400>22

Met Gln Asn Gln Asp Gly Ala Val Ala Asp Arg Glu Lys Glu Ser Ala

1 5 10 15

Val Ser Ile Pro Ile Ser Glu Val Asp Asp Trp Ala Asn Phe Ala Asp

20 25 30

Asp Asp Ile Met Gln Gln Gln Ser Ala Ile His Ala Glu Glu Ala Lys

35 40 45

Lys Ile Pro Phe Val Gly Asp Lys Glu Pro Leu Ser Met Leu Ala Ala

50 55 60

Glu Tyr Glu Ser Gly Ser Pro Ile Leu Leu Glu Lys Ile Lys Val Leu

65 70 75 80

Asp Gln Gln Tyr Ala Ala Ile Arg Arg Thr Arg Gly Asp Gly Asn Cys

85 90 95

Phe Phe Arg Ser Phe Met Phe Ser Tyr Leu Glu His Ile Leu Glu Ser

100 105 110

Gln Asp Arg Ala Glu Val Asp Arg Ile Lys Gly Asn Val Glu Glu Cys

115 120 125

Arg Lys Pro Leu Gln Arg Leu Ala His Thr Asp Phe Thr Phe Glu Asp

130 135 140

Phe Phe Ser Leu Phe Leu Glu Gln Leu Glu Cys Val Leu Gln Gly Asn

145 150 155 160

Glu Asp Ser Ile Ser Gln Asp Glu Leu Ile Leu Arg Ser Arg Asp Gln

165 170 175

Ser Ile Ser Asp Tyr Val Val Met Phe Phe Arg Phe Val Thr Ser Gly

180 185 190

Glu Ile Arg Lys Arg Ser Glu Phe Phe Glu Pro Phe Ile Leu Gly Leu

195 200 205

Thr Asn Ala Thr Val Glu Gln Phe Cys Lys Ser Ser Val Glu Pro Met

210 215 220

Gly Glu Glu Ser Asp His Val His Ile Thr Ala Leu Ser Asp Ala Leu

225 230 235 240

Gly Val Pro Ile Arg Val Val Tyr Leu Asp Arg Ser Ser Cys Asp Ile

245 250 255

Gly Gly Val Ser Val Asn His His Asp Phe Leu Pro Thr Ser Gly Asp

260 265 270

Lys Ser Asn Ala Lys Gly Gly Ser Thr Val Pro Val Lys Pro Phe Ile

275 280 285

Thr Leu Leu Tyr Arg Pro Gly His Tyr Asp Ile Leu Tyr Pro Lys

290 295 300

<210>23

<211>301

<212>PRT

<213> tomato SlOTUB1 protein

<400>23

Met Gln Asp Gln Asp Val Asp Val Asp Val Ala Asp Ala Ala Lys Glu

1 5 10 15

Thr Phe Thr Ser Ser Glu Thr Asp Asp Trp Lys Lys Tyr Lys Asp Asp

20 25 30

Asp Ile Met Gln Gln His Ser Ala Ile Gln Ala Glu Gln Ala Val Lys

35 40 45

Val Pro Phe Leu Gly Asp Lys Glu Pro Leu Ser Ser Leu Glu Ala Glu

50 55 60

Tyr His Leu Gly Asn Ser Ile Val Leu Glu Lys Ile Lys Val Leu Ser

65 70 75 80

Glu Gln Tyr Ala Ala Ile Arg Arg Thr Arg Gly Asp Gly Asn Cys Phe

85 90 95

Phe Arg Ser Phe Met Phe Gly Tyr Leu Glu His Ile Leu Glu Ser Gln

100 105 110

Asp His Asn Glu Val Gln His Ile Lys Ser Asn Ile Glu Glu Cys Lys

115 120 125

Lys Thr Leu Gln Ser Leu Gly Tyr Ala Glu Phe Thr Phe Glu Asp Phe

130 135 140

Phe Ala Leu Phe Leu Glu Gln Leu Asp Ser Val Leu Gln Gly Ser Glu

145 150 155 160

Asp Ser Ile Ser His Asp Glu Leu Leu Cys Arg Ser Arg Asp Pro Ser

165 170 175

Ile Ser Asp Tyr Val Val Met Phe Phe Arg Phe Val Thr Ser Gly Glu

180 185 190

Ile Arg Lys Arg Ser Glu Phe Phe Glu Pro Phe Ile Leu Gly Leu Thr

195200 205

Asn Thr Ser Val Glu Gln Phe Cys Lys Ser Ala Val Glu Pro Met Gly

210 215 220

Glu Glu Ser Asp His Val Gln Ile Thr Ala Leu Ser Asp Ala Leu Gly

225 230 235 240

Val Pro Ile Arg Val Val Tyr Leu Asp Arg Ser Ser Cys Glu Asn Asn

245 250 255

Ser Ile Asn Val Asn His His Asp Phe Ile Pro Thr Ser Arg Glu Val

260 265 270

Gly Asn Ser Asp Val Ser Lys Thr Thr Asn Arg Pro Ser Ile Thr Leu

275 280 285

Leu Tyr Arg Pro Gly His Tyr Asp Ile Leu Tyr Pro Lys

290 295 300

<210>24

<211>578

<212>DNA

<213> sgRNA expression cassette sequence of OsOTUB1

<400>24

tggaatcggc agcaaaggat tttttcctgt agttttccca caaccatttt ttaccatccg 60

aatgatagga taggaaaaat atccaagtga acagtattcc tataaaattc ccgtaaaaag 120

cctgcaatcc gaatgagccc tgaagtctga actagccggt cacctgtaca ggctatcgag 180

atgccataca agagacggta gtaggaacta ggaagacgat ggttgattcg tcaggcgaaa 240

tcgtcgtcct gcagtcgcat ctatgggcct ggacggaata ggggaaaaag ttggccggat 300

aggagggaaa ggcccaggtg cttacgtgcg aggtaggcct gggctctcag cacttcgatt 360

cgttggcacc ggggtaggat gcaatagaga gcaacgttta gtaccacctc gcttagctag 420

agcaaactgg actgccttat atgcgcgggt gctggcttgg ctgccgtcag ctggaaagtg 480

ttctgcgttt tagagctaga aatagcaagt taaaataagg ctagtccgtt atcaacttga 540

aaaagtggca ccgagtcggt gctttttttc aagagctt 578

<210>25

<211>578

<212>DNA

<213> sgRNA expression cassette sequence of TuOTUB1

<400>25

tggaatcggc agcaaaggat tttttcctgt agttttccca caaccatttt ttaccatccg 60

aatgatagga taggaaaaat atccaagtga acagtattcc tataaaattc ccgtaaaaag 120

cctgcaatcc gaatgagccc tgaagtctga actagccggt cacctgtaca ggctatcgag 180

atgccataca agagacggta gtaggaacta ggaagacgat ggttgattcg tcaggcgaaa 240

tcgtcgtcct gcagtcgcat ctatgggcct ggacggaata ggggaaaaag ttggccggat 300

aggagggaaa ggcccaggtg cttacgtgcg aggtaggcct gggctctcag cacttcgatt 360

cgttggcacc ggggtaggat gcaatagaga gcaacgttta gtaccacctc gcttagctag 420

agcaaactgg actgccttat atgcgcgggt gctggcttgg ctgccgttaa ggcgaacacg 480

aggagagttt tagagctaga aatagcaagt taaaataagg ctagtccgtt atcaacttga 540

aaaagtggca ccgagtcggt gctttttttc aagagctt578

<210>26

<211>578

<212>DNA

<213> sgRNA expression cassette sequence of HvOTUB1

<400>26

tggaatcggc agcaaaggat tttttcctgt agttttccca caaccatttt ttaccatccg 60

aatgatagga taggaaaaat atccaagtga acagtattcc tataaaattc ccgtaaaaag 120

cctgcaatcc gaatgagccc tgaagtctga actagccggt cacctgtaca ggctatcgag 180

atgccataca agagacggta gtaggaacta ggaagacgat ggttgattcg tcaggcgaaa 240

tcgtcgtcct gcagtcgcat ctatgggcct ggacggaata ggggaaaaag ttggccggat 300

aggagggaaa ggcccaggtg cttacgtgcg aggtaggcct gggctctcag cacttcgatt 360

cgttggcacc ggggtaggat gcaatagaga gcaacgttta gtaccacctc gcttagctag 420

agcaaactgg actgccttat atgcgcgggt gctggcttgg ctgccgttaa gacggacacg 480

aggagagttt tagagctaga aatagcaagt taaaataagg ctagtccgtt atcaacttga 540

aaaagtggca ccgagtcggt gctttttttc aagagctt 578

<210>27

<211>578

<212>DNA

<213> sgRNA expression cassette sequence of ZmOTUB1

<400>27

tggaatcggc agcaaaggat tttttcctgt agttttccca caaccatttt ttaccatccg 60

aatgatagga taggaaaaat atccaagtga acagtattcc tataaaattc ccgtaaaaag 120

cctgcaatcc gaatgagccc tgaagtctga actagccggt cacctgtaca ggctatcgag 180

atgccataca agagacggta gtaggaacta ggaagacgat ggttgattcg tcaggcgaaa 240

tcgtcgtcct gcagtcgcat ctatgggcct ggacggaata ggggaaaaag ttggccggat 300

aggagggaaa ggcccaggtg cttacgtgcg aggtaggcct gggctctcag cacttcgatt 360

cgttggcacc ggggtaggat gcaatagaga gcaacgttta gtaccacctc gcttagctag 420

agcaaactgg actgccttat atgcgcgggt gctggcttgg ctgccgaagc tttatgtttt 480

cctaccgttt tagagctaga aatagcaagt taaaataagg ctagtccgtt atcaacttga 540

aaaagtggca ccgagtcggt gctttttttc aagagctt 578

<210>28

<211>578

<212>DNA

<213> sgRNA expression cassette sequence for SbOTUB1

<400>28

tggaatcggc agcaaaggat tttttcctgt agttttccca caaccatttt ttaccatccg 60

aatgatagga taggaaaaat atccaagtga acagtattcc tataaaattc ccgtaaaaag 120

cctgcaatcc gaatgagccc tgaagtctga actagccggt cacctgtaca ggctatcgag 180

atgccataca agagacggta gtaggaacta ggaagacgat ggttgattcg tcaggcgaaa 240

tcgtcgtcct gcagtcgcat ctatgggcct ggacggaata ggggaaaaag ttggccggat 300

aggagggaaa ggcccaggtg cttacgtgcg aggtaggcct gggctctcag cacttcgatt 360

cgttggcacc ggggtaggat gcaatagaga gcaacgttta gtaccacctc gcttagctag 420

agcaaactgg actgccttat atgcgcgggt gctggcttgg ctgccgaagc tttatgttct 480

cctactgttt tagagctaga aatagcaagt taaaataagg ctagtccgtt atcaacttga 540

aaaagtggca ccgagtcggt gctttttttc aagagctt 578

<210>29

<211>455

<212>DNA

<213> sgRNA expression cassette sequence of GmOTUB1

<400>29

tggaatcggc agcaaaggat ttactttaaa ttttttctta tgcagcctgt gatggataac 60

tgaatcaaac aaatggcgtc tgggtttaag aagatctgtt ttggctatgt tggacgaaac 120

aagtgaactt ttaggatcaa cttcagttta tatatggagc ttatatcgag caataagata 180

agtgggcttt ttatgtaatt taatgggcta tcgtccatag attcactaat acccatgccc 240

agtacccatg tatgcgtttc atataagctc ctaatttctc ccacatcgct caaatctaaa 300

caaatcttgt tgtatatata acactgaggg agcaacattg gtcaattcgt cgtactcgag 360

gagagtttta gagctagaaa tagcaagtta aaataaggct agtccgttat caacttgaaa 420

aagtggcacc gagtcggtgc tttttttcaa gagct 455

<210>30

<211>455

<212>DNA

<213> sgRNA expression cassette sequence of BnOTUB1

<400>30

tggaatcggc agcaaaggat ttactttaaa ttttttctta tgcagcctgt gatggataac 60

tgaatcaaac aaatggcgtc tgggtttaag aagatctgtt ttggctatgt tggacgaaac 120

aagtgaactt ttaggatcaa cttcagttta tatatggagc ttatatcgag caataagata 180

agtgggcttt ttatgtaatt taatgggcta tcgtccatag attcactaat acccatgccc 240

agtacccatg tatgcgtttc atataagctc ctaatttctc ccacatcgct caaatctaaa 300

caaatcttgt tgtatatata acactgaggg agcaacattg gtcagttgca atcaggcgaa 360

caaggtttta gagctagaaa tagcaagtta aaataaggct agtccgttat caacttgaaa 420

aagtggcacc gagtcggtgc tttttttcaa gagct 455

<210>31

<211>455

<212>DNA

<213> sgRNA expression cassette sequence of GhOTUB1

<400>31

tggaatcggc agcaaaggat ttactttaaa ttttttctta tgcagcctgt gatggataac 60

tgaatcaaac aaatggcgtc tgggtttaag aagatctgtt ttggctatgt tggacgaaac 120

aagtgaactt ttaggatcaa cttcagttta tatatggagc ttatatcgag caataagata 180

agtgggcttt ttatgtaatt taatgggcta tcgtccatag attcactaat acccatgccc 240

agtacccatg tatgcgtttc atataagctc ctaatttctc ccacatcgct caaatctaaa 300

caaatcttgt tgtatatata acactgaggg agcaacattg gtcagcagcc attagaagaa 360

cgcggtttta gagctagaaa tagcaagtta aaataaggct agtccgttat caacttgaaa 420

aagtggcacc gagtcggtgc tttttttcaa gagct 455

<210>32

<211>455

<212>DNA

<213> sgRNA expression cassette sequence of SlOTUB1

<400>32

tggaatcggc agcaaaggat ttactttaaa ttttttctta tgcagcctgt gatggataac 60

tgaatcaaac aaatggcgtc tgggtttaag aagatctgtt ttggctatgt tggacgaaac 120

aagtgaactt ttaggatcaa cttcagttta tatatggagc ttatatcgag caataagata 180

agtgggcttt ttatgtaatt taatgggcta tcgtccatag attcactaat acccatgccc 240

agtacccatg tatgcgtttc atataagctc ctaatttctc ccacatcgct caaatctaaa 300

caaatcttgt tgtatatata acactgaggg agcaacattg gtcagctgcc attagaagaa 360

cacggtttta gagctagaaa tagcaagtta aaataaggct agtccgttat caacttgaaa 420

aagtggcacc gagtcggtgc tttttttcaa gagct 455

<210>33

<211>825

<212>DNA

<213> cDNA sequence of rice dep1-1

<400>33

atgggggagg aggcggtggt gatggaggcg ccgaggccca agtcgccgcc gaggtacccg 60

gacctgtgcg gccggcggcg gatgcagctg gaggtgcaga tcctgagccg cgagatcacg 120

ttcctcaagg atgagcttca cttccttgaa ggagctcagc ccgtttctcg ttctggatgc 180

attaaagaga taaatgagtt tgttggtaca aaacatgacc cactaatacc aacaaagaga 240

aggaggcaca gatcttgccg tctttttcgg tggatcggat caaaattgtg tatctgcatt 300

tcatgtcttt gctactgttg caagtgctca cccaagtgca aaagaccaag gtgcctcaat 360

tgttcttgca gctcatgctg cgacgagcca tgctgtaagc caaactgcag tgcgtgctgc 420

gctgggtcat gctgtagtcc agactgctgc tcatgctgta aacctaactg cagttgctgc 480

aagacccctt cttgctgcaa accgaactgc tcgtgctcct gtccaagctg cagctcatgc 540

tgcgatacat cgtgctgcaa accgagctgc acctgcttca acatctag 588

<210>34

<211>195

<212>PRT

<213> amino acid sequence of rice DEP1 protein

<400>34

Met Gly Glu Glu Ala Val Val Met Glu Ala Pro Arg Pro Lys Ser Pro

1 5 10 15

Pro Arg Tyr Pro Asp Leu Cys Gly Arg Arg Arg Met Gln Leu Glu Val

20 25 30

Gln Ile Leu Ser Arg Glu Ile Thr Phe Leu Lys Asp Glu Leu His Phe

35 40 45

Leu Glu Gly Ala Gln Pro Val Ser Arg Ser Gly Cys Ile Lys Glu Ile

50 55 60

Asn Glu Phe Val Gly Thr Lys His Asp Pro Leu Ile Pro Thr Lys Arg

65 70 75 80

Arg Arg His Arg Ser Cys Arg Leu Phe Arg Trp Ile Gly Ser Lys Leu

85 90 95

Cys Ile Cys Ile Ser Cys Leu Cys Tyr Cys Cys Lys Cys Ser Pro Lys

100 105 110

Cys Lys Arg Pro Arg Cys Leu Asn Cys Ser Cys Ser Ser Cys Cys Asp

115 120 125

Glu Pro Cys Cys Lys Pro Asn Cys Ser Ala Cys Cys Ala Gly Ser Cys

130 135 140

Cys Ser Pro Asp Cys Cys Ser Cys Cys Lys Pro Asn Cys Ser Cys Cys

145 150 155 160

Lys Thr Pro Ser Cys Cys Lys Pro Asn Cys Ser Cys Ser Cys Pro Ser

165 170 175

Cys Ser Ser Cys Cys Asp Thr Ser Cys Cys Lys Pro Ser Cys Thr Cys

180 185 190

Phe Asn Ile

195

<210>35

<211>462

<212>DNA

<213> Rice OsUBC13 Gene sequence

<400>35

atggccaaca gcaacctccc ccggcgaatc atcaaggaga cgcagcgact cctcagcgag 60

ccagcgccgg gaatcagcgc gtctccgtcg gaggagaaca tgcgctactt caacgtcatg 120

atccttggcc cggcacagtc cccctatgaa ggtggagttt ttaagcttga actcttttta 180

cctgaggaat atcctatggc tgctccaaag gttaggttcc tgaccaaaat ataccacccc 240

aacattgaca agcttggtag gatatgcctt gacattctca aggacaaatg gagcccagcc 300

cttcagattc ggacagttct tttgagtatc caggcactcc taagtgcacc aaaccctgat 360

gatcctctct ctgataacat tgcaaagcac tggaaagcca atgaagcaga agctgttgaa 420

acagcaaagg agtggactcg cctgtatgcc agcggtgcat aa 462

<210>36

<211>153

<212>PRT

<213> protein sequence encoded by rice OsUBC13 gene

<400>36

Met Ala Asn Ser Asn Leu Pro Arg Arg Ile Ile Lys Glu Thr Gln Arg

1 5 10 15

Leu Leu Ser Glu Pro Ala Pro Gly Ile Ser Ala Ser Pro Ser Glu Glu

20 25 30

Asn Met Arg Tyr Phe Asn Val Met Ile Leu Gly Pro Ala Gln Ser Pro

35 40 45

Tyr Glu Gly Gly Val Phe Lys Leu Glu Leu Phe Leu Pro Glu Glu Tyr

50 55 60

Pro Met Ala Ala Pro Lys Val Arg Phe Leu Thr Lys Ile Tyr His Pro

65 70 75 80

Asn Ile Asp Lys Leu Gly Arg Ile Cys Leu Asp Ile Leu Lys Asp Lys

85 90 95

Trp Ser Pro Ala Leu Gln Ile Arg Thr Val Leu Leu Ser Ile Gln Ala

100105 110

Leu Leu Ser Ala Pro Asn Pro Asp Asp Pro Leu Ser Asp Asn Ile Ala

115 120 125

Lys His Trp Lys Ala Asn Glu Ala Glu Ala Val Glu Thr Ala Lys Glu

130 135 140

Trp Thr Arg Leu Tyr Ala Ser Gly Ala

145 150

<210>37

<211>1254

<212>DNA

<213> Rice OsSPL14cDNA

<400>37

atggagatgg ccagtggagg aggcgccgcc gccgccgccg gcggcggagt aggcggcagc 60

ggcggcggtg gtggtggagg ggacgagcac cgccagctgc acggtctcaa gttcggcaag 120

aagatctact tcgaggacgc cgccgcggca gcaggcggcg gcggcactgg cagtggcagt 180

ggcagcgcga gcgccgcgcc gccgtcctcg tcttccaagg cggcgggtgg tggacgcggc 240

ggagggggca agaacaaggg gaagggcgtg gccgcggcgg cgccaccgcc gccgccgccg 300

ccgccgcggt gccaggtgga ggggtgcggc gcggatctga gcgggatcaa gaactactac 360

tgccgccaca aggtgtgctt catgcattcc aaggctcccc gcgtcgtcgt cgccggcctc 420

gagcagcgct tctgccagca gtgcagcagg ttccacctgc tgcctgaatt tgaccaagga 480

aaacgcagct gccgcagacg ccttgcaggt cataatgagc gccggaggag gccgcaaacc 540

cctttggcat cacgctacgg tcgactagct gcatctgttg gtgagcatcg caggttcaga 600

agctttacgt tggatttctc ctacccaagg gttccaagca gcgtaaggaa tgcatggcca 660

gcaattcaac caggcgatcg gatctccggt ggtatccagt ggcacaggaa cgtagctcct 720

catggtcact ctagtgcagt ggcgggatat ggtgccaaca catacagcgg ccaaggtagc 780

tcttcttcag ggccaccggt gttcgctggc ccaaatctcc ctccaggtgg atgtctcgca 840

ggggtcggtg ccgccaccga ctcgagctgt gctctctctc ttctgtcaac ccagccatgg 900

gatactacta cccacagtgc cgctgccagc cacaaccagg ctgcagccat gtccactacc 960

accagctttg atggcaatcc tgtggcaccc tccgccatgg cgggtagcta catggcacca 1020

agcccctgga caggttctcg gggccatgag ggtggtggtc ggagcgtggc gcaccagcta 1080

ccacatgaag tctcacttga tgaggtgcac cctggtccta gccatcatgc ccacttctcc 1140

ggtgagcttg agcttgctct gcaggggaac ggtccagccc cagcaccacg catcgatcct 1200

gggtccggca gcaccttcga ccaaaccagc aacacgatgg attggtctct gtag 1254

<210>38

<211>417

<212>PRT

<213> protein encoded by OsSPL14 of rice

<400>38

Met Glu Met Ala Ser Gly Gly Gly Ala Ala Ala Ala Ala Gly Gly Gly

1 5 10 15

Val Gly Gly Ser Gly Gly Gly Gly Gly Gly Gly Asp Glu His Arg Gln

20 25 30

Leu His Gly Leu Lys Phe Gly Lys Lys Ile Tyr Phe Glu Asp Ala Ala

35 40 45

Ala Ala Ala Gly Gly Gly Gly Thr Gly Ser Gly Ser Gly Ser Ala Ser

50 55 60

Ala Ala Pro Pro Ser Ser Ser Ser Lys Ala Ala Gly Gly Gly Arg Gly

65 70 75 80

Gly Gly Gly Lys Asn Lys Gly Lys Gly Val Ala Ala Ala Ala Pro Pro

85 90 95

Pro Pro Pro Pro Pro Pro Arg Cys Gln Val Glu Gly Cys Gly Ala Asp

100 105 110

Leu Ser Gly Ile Lys Asn Tyr Tyr Cys Arg His Lys Val Cys Phe Met

115 120 125

His Ser Lys Ala Pro Arg Val Val Val Ala Gly Leu Glu Gln Arg Phe

130 135 140

Cys Gln Gln Cys Ser Arg Phe His Leu Leu Pro Glu Phe Asp Gln Gly

145 150 155 160

Lys Arg Ser Cys Arg Arg Arg Leu Ala Gly His Asn Glu Arg Arg Arg

165 170 175

Arg Pro Gln Thr Pro Leu Ala Ser Arg Tyr Gly Arg Leu Ala Ala Ser

180 185 190

Val Gly Glu His Arg Arg Phe Arg Ser Phe Thr Leu Asp Phe Ser Tyr

195 200 205

Pro Arg Val Pro Ser Ser Val Arg Asn Ala Trp Pro Ala Ile Gln Pro

210 215 220

Gly Asp Arg Ile Ser Gly Gly Ile Gln Trp His Arg Asn Val Ala Pro

225 230 235 240

His Gly His Ser Ser Ala Val Ala Gly Tyr Gly Ala Asn Thr Tyr Ser

245 250 255

Gly Gln Gly Ser Ser Ser Ser Gly Pro Pro Val Phe Ala Gly Pro Asn

260 265 270

Leu Pro Pro Gly Gly Cys Leu Ala Gly Val Gly Ala Ala Thr Asp Ser

275 280 285

Ser Cys Ala Leu Ser Leu Leu Ser Thr Gln Pro Trp Asp Thr Thr Thr

290 295 300

His Ser Ala Ala Ala Ser His Asn Gln Ala Ala Ala Met Ser Thr Thr

305 310 315 320

Thr Ser Phe Asp Gly Asn Pro Val Ala Pro Ser Ala Met Ala Gly Ser

325 330 335

Tyr Met Ala Pro Ser Pro Trp Thr Gly Ser Arg Gly His Glu Gly Gly

340 345 350

Gly Arg Ser Val Ala His Gln Leu Pro His Glu Val Ser Leu Asp Glu

355360 365

Val His Pro Gly Pro Ser His His Ala His Phe Ser Gly Glu Leu Glu

370 375 380

Leu Ala Leu Gln Gly Asn Gly Pro Ala Pro Ala Pro Arg Ile Asp Pro

385 390 395 400

Gly Ser Gly Ser Thr Phe Asp Gln Thr Ser Asn Thr Met Asp Trp Ser

405 410 415

Leu

6

Claims (12)

1. The nucleotide sequence of the allele of the plant type gene for controlling the tillering number, the thickness of stalks, the grain number per ear, the thousand grain weight and the yield of rice is shown as SEQ ID NO. 2 or 4, and the allele is named as npt 1.

2. The promoter sequence of the allele of claim 1 as set forth in SEQ ID NO 6.

3. A recombinant construct comprising the sequence of claim 1.

4. A recombinant host cell characterized by comprising the sequence of claim 1; or comprising the recombinant construct of claim 3, wherein the cell is a microbial cell.

5. According toThe recombinant host cell of claim 4, wherein the microbial cell is Escherichia coli (E.coli)Escherichia coli) Or Agrobacterium (Agrobacterium tumefaciens) A cell.

6. A method of breeding rice for increased yield, the method comprising: transfecting a rice plant with a recombinant host cell comprising the allele NPT1 of claim 1 to obtain a transgenic rice plant having a reduced expression level of the NPT1 gene or a reduced function of the protein due to an altered amino acid sequence, or crossing a rice plant comprising the allele NPT1 of claim 1 with another rice plant;

wherein the NPT1 gene is a gene encoding the amino acid sequence shown in SEQ ID NO. 15;

wherein the other rice plant is a plant with increased number of single panicle and increased yield.

7. A method for breeding rice with increased grain per ear and yield by overexpressing OsUBC13, which comprises transforming a rice plant with a recombinant construct comprising OsUBC13 and a recombinant host cell to obtain a transgenic rice plant, wherein the activity of NPT1 protein in the obtained transgenic rice plant is affected, thereby increasing grain per ear and yield, wherein the cell is a microbial cell; wherein the amino acid sequence of the NPT1 protein is shown as SEQ ID NO. 15.

8. The method of claim 7, wherein the microbial cell is Escherichia coli (E. coli)Escherichia coli) Or Agrobacterium (Agrobacterium tumefaciens) A cell.

9. A method of pyramiding breeding for molecular marker assisted selection for breeding high yielding rice varieties, which comprises crossing a rice parent comprising the allele npt1 of claim 1 with another rice parent carrying the superior allele dep1-1, and breeding lines or varieties in which the superior alleles npt1 and dep1-1 are pyramided in progeny based on the molecular markers;

wherein the nucleotide sequence of the dep1-1 gene is shown as SEQ ID NO: shown at 33.

10. A method for knocking out NPT1 gene by CRISPR/cas9 gene editing technology to cultivate crop with improved yield comprises the steps of knocking out target gene by CRISPR/cas9 gene editing technology by taking NPT1 gene as target, and cultivating the crop with improved yield, wherein the crop is rice;

wherein the NPT1 gene is a gene encoding the amino acid sequence shown in SEQ ID NO. 15.

11. A method for cultivating rice with increased grain number per ear and yield by enhancing the function of a rice plant type regulatory protein OsSPL14 comprises the steps of transforming a rice plant by using a recombinant construct containing NPT1 and recombinant host cells to obtain a transgenic rice plant, and obtaining a transgenic plant with enhanced OsSPL14 function, wherein the cells are microbial cells;

wherein the NPT1 is a gene which codes an amino acid sequence shown in SEQ ID NO. 15.

12. The method of claim 11, wherein the microbial cell is escherichia coli(Escherichia coli) Or Agrobacterium (Agrobacterium tumefaciens) A cell.

Images