CN104694549A - Rice lateral root sprout-controlling gene OsHK1 and protein encoded by gene OsHK1 - Google Patents

Abstract

The invention discloses a rice lateral root sprout-controlling gene OsHK1 and a protein encoded by the gene OsHK1. The controlling gene OsHK1 has a full length of 5964bp, wherein a CDS length is 2994bp; a nucleotide sequence of the CDS is shown as SEQ ID NO: 1 and an amino acid sequence of the protein encoded by the gene OsHK1 is shown as SEQ ID NO: 2. According to the rice lateral root sprout-controlling gene OsHK1, when mutations developed from one or multiple nucleotide sequences are added, substituted, inserted or deleted in the CDS of the controlling gene OsHK1, the protein encoded by the gene OsHK1 acts to enable rice to be insensitive to cytomin which inhibits rice lateral root sprout as well as boosts existing lateral root sprout to stretch, so that mutated lateral root can be led to normally spout, so as to greatly enhance water and mineral absorbing capacity of the rice from the outside. The gene can be utilized to perform transgenic modifications to rice breeds; thus, the rice lateral root sprout-controlling gene OsHK1 and the protein encoded by the gene OsHK1 provide molecular regulating mechanism to rice lateral root growth and provides a basis for regulating rice root system structure by gene engineering methods.

Description

The protein of Rice lateral root generation controlling gene OsHK1 and coding

The divisional application of the application's to be original applying number be application for a patent for invention of 201310372601.0, its applying date is

On August 23rd, 2013, denomination of invention is " protein of Rice lateral root generation controlling gene OsHK1 and coding ".

Technical field

The present invention relates to Rice lateral root generation controlling gene, be specifically related to the protein of Rice lateral root generation controlling gene OsHK1 and coding.

Background technology

Root system of plant mainly can be divided into taproot system and fibrous root system, and rice root is configured as fibrous root system.The root system of fibrous root system plants is made up of seminal root, adventive root and side root, due to huge side root, significantly increases paddy rice absorbs moisture and mineral substance ability from the external world.In higher plant, side root originates in specific cellular layer-pericycle on main root, according to it carry on the back adjacent vascular tissue, can be divided into two kinds of cell types: in dicotyledons Arabidopis thaliana, side root originates in the pericyclic cell closing on xylem; In such as paddy rice, corn cereal crop, side root originates in the pericyclic cell closing on protophloem.The growth course of Rice lateral root is more similar with Arabidopis thaliana, and first two pericyclic cells closed on carry out anticlinal division, and then carry out vertical week repeatedly, periclinal division, former base expands gradually, and progressively through cortex, to finally breaking through epidermis.The growth of Rice lateral root strengthens, to paddy growth and high yield significant.If Authorization Notice No. is the patent of invention of CN102268081, disclose the protein of Rice lateral root controlling gene OsIAA11 and coding, this Rice lateral root controlling gene OsIAA11 is the gene of cloning from Osiaa11 mutant, there is the function controlling Rice lateral root and grow, the good transgenic paddy rice of side root controlling functions can be cultivated.

Summary of the invention

Technical problem to be solved by this invention is to provide the protein of a kind of Rice lateral root generation controlling gene OsHK1 and coding, the protein of this controlling gene OsHK1 and coding can make paddy rice insensitive to phytokinin, thus selects the transgenic paddy rice controlling side root and occur and grow.

The present invention solves the problems of the technologies described above adopted technical scheme: Rice lateral root generation controlling gene OsHK1, this controlling gene OsHK1 total length is 5964bp(OsHK1 gene number: LOC_Os02g50480), wherein the long nucleotide sequence for 2994bp, CDS of CDS is as shown in SEQ ID NO:1.If with the addition of the 44bp sequence as shown in SEQ ID NO:3 at 466bp place in CDS nucleotide sequence, become mutant Oshk1-1 paddy rice.Or the cytosine(Cyt) (C) at 2923bp place in CDS nucleotide sequence sports thymus pyrimidine (T), becomes mutant Oshk1-2 paddy rice.

Gene of the present invention improves: mutant, allelotrope and derivative that interpolation, replacement, insertion and the one or more Nucleotide of disappearance that nucleotide sequence to be also included in the nucleotide sequence shown in SEQ ID NO:1 other generate.

The protein that Rice lateral root generation controlling gene OsHK1 encodes, the aminoacid sequence of this protein is as shown in SEQ ID NO:2, in the CDS nucleotide sequence of controlling gene OsHK1 when 466bp place adds the 44bp sequence as shown in SEQ ID NO:3, cause translation premature termination, coded product only has 176 amino acid as shown in SEQ ID NO:4, and the amino acid position of sudden change is positioned at CHASE structural domain.When sporting thymus pyrimidine at the cytosine(Cyt) at 2923bp place in CDS nucleotide sequence, in aminoacid sequence, the proline(Pro) of 975 has replaced to Serine, and this site is positioned at acceptance domain.

Protein of the present invention improves: aminoacid sequence to be also included in the aminoacid sequence shown in SEQ ID NO:2 other interpolation, replacement, insertion and the one or more amino acids production of disappearance derivative.

Compared with prior art, the invention has the advantages that the protein of Rice lateral root generation controlling gene OsHK1 and coding, controlling gene OsHK1 total length is 5964bp, wherein CDS is long is 2994bp, the nucleotide sequence of CDS is as shown in SEQ ID NO:1, the aminoacid sequence of the protein of coding is as shown in SEQ ID NO:2, the interpolation of CDS in this controlling gene OsHK1, replace, insert and lack the mutant that one or more Nucleotide generates, the protein of its coding shows as and makes paddy rice insensitive to phytokinin, and phytokinin suppresses the generation of Rice lateral root but the elongation of the side root that promotion has generated, sudden change side root is caused normally to occur, significantly increase paddy rice absorbs moisture and mineral substance ability from the external world.By utilizing this gene pairs rice varieties to carry out transgenosis transformation, therefore the invention provides the molecular regulation mechanism that Rice lateral root is grown, and for be provided the foundation by genetic engineering means adjusting and controlling rice root structure.

Accompanying drawing explanation

Fig. 1 is that the insensitive mutant Oshk1-1 of rice cell mitogen and wild-type show water 63 shine (B) in normal condition and 0.2 μM of 6-BA process complete stool after 7 days according to (A) and root;

Fig. 2 is structure iron and the mutational site of the protein of gene and coding, and in Fig. 2, A is gene structure and mutational site (arrow indication); B is protein structure and mutational formats (arrow indication), the amino acid sites in digitized representation corresponding function territory;

Fig. 3 is that function complementation experiment T1 detects figure (B) for the phenotype (A) of transgenic paddy rice and the RT-PCR of two replies strain (OV1 and OV2);

Fig. 4 is the structural representation that transgenosis replys carrier pCAMBIA-1300.

Embodiment

Below in conjunction with accompanying drawing embodiment, the present invention is described in further detail.

Embodiment 1

The present inventor is from the EMS(ethyl methylsulfonate of Development of Laboratories) respectively screen in rice cell mitogen insensitive (Exogenous cytokinin does not suppress side root a to occur) mutant Oshk1-1(CDS nucleotide sequence in long-grained nonglutinous rice (Oryza Sativa L. ssp japonica) the fine mutant library of local variety show water 63 and Japan of mutagenesis with the addition of 44bp sequence at 466bp) and Oshk1-2(CDS nucleotide sequence in the C at 2923bp place sport T), these two mutant are the cryptic mutants of the genetic development meeting Dominant gene.Under normal operation mutant compared with wild-type without obvious phenotypic difference, but the phytokinin applied external source is almost completely insensitive, under the condition of 0.2 μM of 6-BA process, sudden change side root can normally occur, and wild-type then can not form side root (Fig. 1) in same condition.The present inventor adopts gene map position cloning process to be separated OsHK1 gene.First a F is created ₂target group, be maternal by Oshk1 mutant, wild-type long-grained nonglutinous rice Kasalath is the F that paternal hybrid obtains ₂in recessiveness individuality composition.And utilize SSR(Simple Sequence Repeats) molecule marker carries out Primary Location to OsHK1 site, coarse positioning result shows that mutant Oshk1-1 and Oshk1-2 is allelic variant body, mutator gene is positioned between mark RM5472 and RM250 on the 2nd karyomit(e), and genetic distance is respectively 1.1cM and 8.9cM.According to paddy gene annotation information, there is a rice cell mitogen acceptor OsHK1 in this interval.By order-checking and comparison, we find that OsHK1 gene there occurs sudden change, this gene DNA total length is 5964bp, and wherein CDS is long is 2994bp.OsHK1 contains four separation structure territories, is respectively CHASE structural domain (phytokinin land), two membrane spaning domains, transmission territory (or being called kinases territory, histidine kinase domain) and acceptance domains (receiver domain).Mutant Oshk1-1 adds 44bp at the 466bp place of CDS sequence, and cause translation premature termination according to this sudden change of prediction, coded product only has 176 amino acid, and the amino acid position of sudden change is positioned at CHASE structural domain; Mutant Oshk1-2 sports thymus pyrimidine (T) at the cytosine(Cyt) (C) at the 2923bp place of CDS sequence, causes the proline(Pro) of in coded aminoacid sequence 975 to replace to Serine, and this site is positioned at acceptance domain (Fig. 2).Caused by OsHK1 transgenation to confirm mutation type surface.We have carried out transgenosis to mutant and have replied checking.The complete OsHK1 CDS sequence (SEQ ID NO:1) driven by 35S promoter is cloned into during binary plant transgene carrier pCAMBIA1300 changes.By the reply carrier that builds by agrobacterium mediation converted mutant Oshk1-1 callus, through kanamycin-resistant callus tissue induction and then be divided into transgenic seedling.The mutant (transgenic positive strain) having transformed external source OsHK1 gene is the same with wild-type to the response of Exogenous cytokinin, and side root is suppressed (Fig. 3 A).The RNA of the blade of extracting wild-type and two transgenic positive strains, reverse transcription becomes cDNA.Semiquatitative RT-PCR assay result shows, overexpression OsHK1 gene (Fig. 3 B) really in transgenic positive strain.Transgenosis reply test confirms mutation type surface and is caused by OsHK1 transgenation, shows present invention obtains the transgenic paddy rice making mutant recover normal function.Result shows, the rice Os HK1 gene of we clone has certain using value, can carry out transgenosis transformation by utilizing this gene pairs crop varieties.

Embodiment 2, the screening of mutant and phenotype

With the fine mutant library of the elegant water 63 of EMS mutagenesis and Japan for screening mutant object, M ₂seed is clean with distilled water flushing, 0.6% rare HNO ₃broken dormancy process 16hr, 37 DEG C of dark place vernalization are to showing money or valuables one carries unintentionally.The seed showed money or valuables one carries unintentionally is moved on nylon gauze, carries out phytokinin process.0.2 μM of 6-BA is added in normal paddy rice nutrient solution (nutrient solution formula is International Rice institute standard recipe), under temperature (daytime/night) left and right that is 30/22 DEG C, illumination 12 hours conditions, cultivate 7 days, by comparing the mutant of root growth situation screening to phytokinin abnormal reaction, 1 insensitive mutant of phytokinin (side root can normally occur) (Fig. 1) is respectively screened, i.e. side root generation defect mutant Oshk1-1 and Oshk1-2 of rice cell mitogen mediation from the fine mutant library of elegant water 63 and Japan.

Embodiment 3, the assignment of genes gene mapping

F ₂acquisition is hybridized by homozygote (Oshk1-1) and rice variety Kasalath in target group, altogether identifies the F of 155 insensitive phenotypes of phytokinin ₂individuality, adopts the rapid extracting method of paddy rice minim DNA from rice leaf, extract the genomic dna being used for the assignment of genes gene mapping.Get about 2cm paddy rice young leaflet tablet, through liquid nitrogen freezing, clayed into power by blade in the centrifuge tube of 1.5ml, extract STb gene, the DNA of acquisition is dissolved in 200 μ l sterilized waters.Each SSR reaction 2 μ l DNA sample.In the location test of OsHK1 gene, first to 30 F ₂individuality carries out ssr analysis.According to the molecular genetic linkage map that the japonica rice of announcing and long-grained nonglutinous rice create, choose approaches uniformity and be distributed in SSR primer on each bar karyomit(e), carry out pcr amplification according to known reaction conditions, be then separated at the acrylamide gel electrophoresis of 7%, detect the polymorphism of PCR primer, for 30 F ₂there is no the SSR primer of recon in individuality, then expand target group.

Embodiment 4, predictive genes and sequential analysis

According to the result of the assignment of genes gene mapping, between mark RM5472 and RM250 of OsHK1 gene on the 2nd karyomit(e), genetic distance is respectively 1.1cM and 8.9cM.According to TIGR(http: //www.tigr.org/tdb/e2k1/osa1/) paddy gene annotation information, to location chromosome segment in gene carry out forecast analysis, find that there is a cytokinin receptor OsHK1 gene in this interval.Be that template increases to OsHK1 gene with wild-type and Oshk1 mutants cDNA, amplified production checks order respectively, and sequencing result compares, and finds that the 466bp place of mutant Oshk1-1 after CDS sequence A TG adds 44bp, causes translating premature termination; The cytosine(Cyt) at the 2923bp place of mutant Oshk1-2 after CDS sequence A TG sports thymus pyrimidine, causes the proline(Pro) of in the aminoacid sequence of coding 975 to replace to Serine (Fig. 2).

Embodiment 5, the checking that has complementary functions of OsHK1 gene in mutant

According to the CDS sequence information of OsRHL1 gene, the primer of the complete ORF of design amplification, primer upstream sequence: AAAGTCGACC CACTAGCCAG ACCATCATCA, downstream sequence: AAATCTAGAC CACTAGCCAG ACCATCATCA.With the root cDNA of elegant water 63 for template, the ORF amplifying OsHK1 gene with high-fidelity enzyme PrimerSTAR DNA Polymerase, is connected with pUCm-T, connects the heat-shock transformed bacillus coli DH 5 alpha competent cell of product.Order-checking determine sequence correct after plasmid connect with changing carrier (Fig. 4) with the same pCAMBIA1300 through KpnI, XbaI double digestion after KpnI, XbaI double digestion, the heat-shock transformed bacillus coli DH 5 alpha competent cell of connection product.Enzyme is cut the correct plasmid of detection and is imported in mutant Oshk1-1 by the rice transformation system that Agrobacterium strains EHA105 mediates, through infecting, Dual culture, screening have hygromycin resistance callus, break up, take root, practice transplantation of seedlings, obtain transfer-gen plant.The rice transformation system that Agrobacterium (EHA105) mediates mainly is applied on method basis that the people such as Hiei (1994) report and is optimized.The response of Oshk1-1 mutant to 6-BA be separated in this transfer-gen plant reverts back to wild-type (Fig. 3 A), illustrates that the phenotype of Oshk1-1 really has OsHK1 to suddenly change and causes.The nucleotide sequence of the side root generation controlling gene OsHK1 of this rice cell mitogen mediation is as shown in SEQ ID NO:1; The protein of this genes encoding has the aminoacid sequence shown in SEQ ID NO:2.In order to detect transgenic positive plant whether overexpression OsHK1 gene, adopt Trizol method to extract elegant water 63 and 2 transgenosiss respectively to reply the total serum IgE of strain blades (the reply carrier that we build is CaMV 35S composition type expression promoter, if be transgenic positive plant, the overground part of so originally not expressing also can overexpression OsHK1 gene), reverse transcription becomes cDNA.During sxemiquantitative reaction, the cDNA template amount of each sample is first by the expression amount furnishing consistent (amplification condition: 58 DEG C, 26 circulations) of OsActin gene, then amplifying target genes.The upstream primer sequence of goal gene is: ACCTATAAGGGCAAGCACAAT; Downstream primer sequence is: ATCCAACGCCTTCCTTTC.Goal gene length is 361bp, and amplification condition is: 55 DEG C, 28 circulations.Semiquatitative RT-PCR assay result, as Fig. 3 B, to demonstrate in transgenic positive strain overexpression OsHK1 gene really.PCAMBIA1300 changes the transformation carrier that carrier is this laboratory, is with commercially available pCAMBIA-1300 carrier for basic framework, the Enhanced expressing carrier obtained at multiple clone site insertion 35S promoter and Nos terminator.

What more than enumerate is only several specific embodiments of the present invention, obviously, the invention is not restricted to above embodiment, many saltant types can also be had, namely in SEQ ID NO:1, add, replace, insert or delete one or several Nucleotide and the mutant, allelotrope or the derivative that generate, the gene order of 80% homology is had at least, for building the transgenic paddy rice with Rice lateral root generation controlling functions with the cDNA sequence shown in SEQ ID NO:1.Protein shown in SEQ ID NO:2 belongs to the insensitive functional protein of phytokinin, wherein carries out one or several amino acid replacement, inserts or lacks the functional analogue obtained.All modification that those of ordinary skill in the art can directly derive from content disclosed by the invention or associate all should be protection scope of the present invention.

<110> University Of Ningbo

 

The protein of <120> Rice lateral root generation controlling gene OsHK1 and coding

<160> 4

<170> PatentIn version 3.5

                   

<210> 1

<211> 2994

<212> DNA

<213> Rice lateral root generation controlling gene OsHK1

<220>

<221> CDS

 

<400> 1

atggggaagc cggaggcgag gagtgggtgg aggaacgcgg cggcggcggc gtgggtgctg 60

gtggccgtgg cgtgcgcggc gtacatgcac tggcacctgc ggcgggagac catggaccgc 120

gccgaggagc ggctcgtcag catgtgcgag gagcgggcga ggatgctgca ggagcagttc 180

ggcgtcaccg tcaaccacgt ccacgccctc gccatcctca tctccacctt ccatttcgag 240

aagttcccgt ccgccatcga ccaggataca tttgcaaagt acacggcaag gacatcgttt 300

gagcgcccac tgctgaatgg agtggcatat gcgcagcgta tcttccatca cgagagggaa 360

atgtttgaga accagcaggg atggattatg aagacgatga agcgacaggc tgcgcctcca 420

caggatgagt atgccccagt gattttttca caggatacgg tttcctacct tgcacgtatc 480

gacatgatgt ctggggagga ggaccgggaa aacatcttac gtgcaagggc taccggcaaa 540

gctgtgttga caaacccatt caggttgctt gggtcaaacc acttgggggt agttctcact 600

tttgctgtgt atcgccctgg tctagctgct gatgcatcag ttgaggagcg tgtggaagca 660

actgctggtt gtttggttgt tgtggtctca tcaaatcaaa tccctactaa cagatatctt 720

ggtggagctt ttgatgtgga gtcactcgtg gaaaatttgc tgagtaaact tgctggcaat 780

caggatattg tagtgaatgt gtatgatgtc acaaatgctt ctgaacctat ggccatgtat 840

ggtcctcaaa gtccagatgg taaagtgtcc ctcttccatg tgagcacgct tgactttggt 900

gatcctttca gggcgcatga aatgaggtgc aggtataggc aaaagcctcc tctgccatgg 960

tctgctatca ctaatccttt gggaactttt gttatatgga tgcttgtggg gtatataatt 1020

tgtgccgcat ggtctcgcta tgataaagtt tcagaggatt gtagaaagat ggaagagctc 1080

aaaactcaag cggaagctgc tgatgttgct aagtcccagt ttctggcaac tgtatcccat 1140

gagatcagaa cacctatgaa tggcgtcctt gtcgtccagc gatctaaaat tctacctttt 1200

gatgtaggaa tgctcgacat gctcttgggg acagatctga gtatgactca gaaggattat 1260

gctcagacag cccagatgtg tggcagagca ttgataacac tgataaatga tgtacttgat 1320

cgggctaaga ttgaagcagg gaaattggag cttgaggcag tgccatttga cctgcggtct 1380

ctcatggatg atgtgatctc cttattttct tcaaaatcaa gagagaagtg cattgagctt 1440

gcagtgtttg tatgtgatga tgttccaaaa gttgttattg gagatccatg gagatatcga 1500

caaatactga caaatttggt gggaaatgca gtcaaattca cagaacgggg ccatgtattt 1560

gtgcgagtct gcctggctga gaactcaaaa gtggaagcta atcaagtcct taatggaacc 1620

atgaatggga aagacggcaa agttgagact acagctaatg gcgccttcaa tactttgagt 1680

ggttttcaag ccgcagatga gcgcaataac tgggattatt ttaagctgct gctatctgat 1740

aaagagcccc atatggatga gcttgagtgc gacagatctt atcaaaatga ttgtgactgt 1800

gtgaccttga tgataagtat tgaggataca ggtgttggga tcccattaca tgcacaagat 1860

cgtgttttta cgcctttcat gcaggctgat agttcaactt caaggaacta tggtggaact 1920

ggcattggtt taagcatcag caaatgttta gctgaactta tgggcggtca aataagtttc 1980

actagccgtc catttgttgg gagtacattt acattctcag ctgtcctcaa gcgctcatgc 2040

aaagatactt caagtgattc aaagaggagc ttatctgagg cactaccaac tgcctttaag 2100

ggaatgaagg ctattttagt agatgggaga cctgtacgtg gagctgtcac acgatatcac 2160

cttaacaggt tgggaatagt tgttaaagtt gtgaataatt tgagtatggg gcttcagact 2220

ttagctggac aaaatggtgt gaaagagtcc agggagaaac tgtctatgct ttttatagag 2280

agtgacatct ggaggcctga gacagatatc ctattattga atcgtctgca tgagctaaag 2340

aataatggtc aggtgcatga gttgccgaag ctagttcttt tggtaacatc agaagctgac 2400

aaggacagat atggatccgc atttgatatt gtgatgtata aacctataag ggcaagcaca 2460

attgcttctt gccttcaaca gttgctaaaa gtagtgatgc ctgaaaggaa agacaatcaa 2520

aataggccct catttctccg cagcttgctg attgggaaga atatattgat tgtagatgat 2580

aataaagtca atctcagggt tgctgcagct gcgctcaaga aatatggtgc caaagttcat 2640

tgtgttgaaa gcggcaaaga tgcagtctcc ttacttcaac aaccacactg ctttgatgca 2700

tgctttatgg atgttcagat gccagagatg gatgggtttg aggcaactag acaaataagg 2760

caaatggagg taaaagcaaa cgaggaaagg aaggcgttgg atttaatgga gggttcaaca 2820

ttcgtcgagt cccatttgcc tgttctggca atgaccgcgg atgtcattca ggcgacatat 2880

gaagaatgta taaaatcggg aatggatggt tatgtgtcca aacctttcga cgaggagcag 2940

ttataccaag ctgtctccag attagtggtg ggaacgaagg aatcagcggt atga 2994

 

<210>2

<211>997

<212>PRT

The protein that <213> Rice lateral root generation controlling gene OsHK1 encodes

 

<400>2

Met Gly Lys Pro Glu Ala Arg Ser Gly Trp Arg Asn Ala Ala Ala

1 5 10 15

Ala Ala Trp Val Leu Val Ala Val Ala Cys Ala Ala Tyr Met His

20 25 30

Trp His Leu Arg Arg Glu Thr Met Asp Arg Ala Glu Glu Arg Leu

35 40 45

Val Ser Met Cys Glu Glu Arg Ala Arg Met Leu Gln Glu Gln Phe

50 55 60

Gly Val Thr Val Asn His Val His Ala Leu Ala Ile Leu Ile Ser

65 70 75

Thr Phe His Phe Glu Lys Phe Pro Ser Ala Ile Asp Gln Asp Thr

80 85 90

Phe Ala Lys Tyr Thr Ala Arg Thr Ser Phe Glu Arg Pro Leu Leu

95 100 105

Asn Gly Val Ala Tyr Ala Gln Arg Ile Phe His His Glu Arg Glu

110 115 120

Met Phe Glu Asn Gln Gln Gly Trp Ile Met Lys Thr Met Lys Arg

125 130 135

Gln Ala Ala Pro Pro Gln Asp Glu Tyr Ala Pro Val Ile Phe Ser

140 145 150

Gln Asp Thr Val Ser Tyr Leu Ala Arg Ile Asp Met Met Ser Gly

155 160 165

Glu Glu Asp Arg Glu Asn Ile Leu Arg Ala Arg Ala Thr Gly Lys

170 175 180

Ala Val Leu Thr Asn Pro Phe Arg Leu Leu Gly Ser Asn His Leu

185 190 195

Gly Val Val Leu Thr Phe Ala Val Tyr Arg Pro Gly Leu Ala Ala

200 205 210

Asp Ala Ser Val Glu Glu Arg Val Glu Ala Thr Ala Gly Cys Leu

215 220 225

Val Val Val Val Ser Ser Asn Gln Ile Pro Thr Asn Arg Tyr Leu

230 235 240

Gly Gly Ala Phe Asp Val Glu Ser Leu Val Glu Asn Leu Leu Ser

245 250 255

Lys Leu Ala Gly Asn Gln Asp Ile Val Val Asn Val Tyr Asp Val

260 265 270

Thr Asn Ala Ser Glu Pro Met Ala Met Tyr Gly Pro Gln Ser Pro

275 280 285

Asp Gly Lys Val Ser Leu Phe His Val Ser Thr Leu Asp Phe Gly

290 295 300

Asp Pro Phe Arg Ala His Glu Met Arg Cys Arg Tyr Arg Gln Lys

305 310 315

Pro Pro Leu Pro Trp Ser Ala Ile Thr Asn Pro Leu Gly Thr Phe

320 325 330

Val Ile Trp Met Leu Val Gly Tyr Ile Ile Cys Ala Ala Trp Ser

335 340 345

Arg Tyr Asp Lys Val Ser Glu Asp Cys Arg Lys Met Glu Glu Leu

350 355 360

Lys Thr Gln Ala Glu Ala Ala Asp Val Ala Lys Ser Gln Phe Leu

365 370 375

Ala Thr Val Ser His Glu Ile Arg Thr Pro Met Asn Gly Val Leu

380 385 390

Val Val Gln Arg Ser Lys Ile Leu Pro Phe Asp Val Gly Met Leu

395 400 405

Asp Met Leu Leu Gly Thr Asp Leu Ser Met Thr Gln Lys Asp Tyr

410 415 420

Ala Gln Thr Ala Gln Met Cys Gly Arg Ala Leu Ile Thr Leu Ile

425 430 435

Asn Asp Val Leu Asp Arg Ala Lys Ile Glu Ala Gly Lys Leu Glu

440 445 450

Leu Glu Ala Val Pro Phe Asp Leu Arg Ser Leu Met Asp Asp Val

455 460 465

Ile Ser Leu Phe Ser Ser Lys Ser Arg Glu Lys Cys Ile Glu Leu

470 475 480

Ala Val Phe Val Cys Asp Asp Val Pro Lys Val Val Ile Gly Asp

485 490 495

Pro Trp Arg Tyr Arg Gln Ile Leu Thr Asn Leu Val Gly Asn Ala

500 505 510

Val Lys Phe Thr Glu Arg Gly His Val Phe Val Arg Val Cys Leu

515 520 525

Ala Glu Asn Ser Lys Val Glu Ala Asn Gln Val Leu Asn Gly Thr

530 535 540

Met Asn Gly Lys Asp Gly Lys Val Glu Thr Thr Ala Asn Gly Ala

545 550 555

Phe Asn Thr Leu Ser Gly Phe Gln Ala Ala Asp Glu Arg Asn Asn

560 565 570

Trp Asp Tyr Phe Lys Leu Leu Leu Ser Asp Lys Glu Pro His Met

575 580 585

Asp Glu Leu Glu Cys Asp Arg Ser Tyr Gln Asn Asp Cys Asp Cys

590 595 600

Val Thr Leu Met Ile Ser Ile Glu Asp Thr Gly Val Gly Ile Pro

605 610 615

Leu His Ala Gln Asp Arg Val Phe Thr Pro Phe Met Gln Ala Asp

620 625 630

Ser Ser Thr Ser Arg Asn Tyr Gly Gly Thr Gly Ile Gly Leu Ser

635 640 645

Ile Ser Lys Cys Leu Ala Glu Leu Met Gly Gly Gln Ile Ser Phe

650 655 660

Thr Ser Arg Pro Phe Val Gly Ser Thr Phe Thr Phe Ser Ala Val

665 670 675

Leu Lys Arg Ser Cys Lys Asp Thr Ser Ser Asp Ser Lys Arg Ser

680 685 690

Leu Ser Glu Ala Leu Pro Thr Ala Phe Lys Gly Met Lys Ala Ile

695 700 705

Leu Val Asp Gly Arg Pro Val Arg Gly Ala Val Thr Arg Tyr His

710 715 720

Leu Asn Arg Leu Gly Ile Val Val Lys Val Val Asn Asn Leu Ser

725 730 735

Met Gly Leu Gln Thr Leu Ala Gly Gln Asn Gly Val Lys Glu Ser

740 745 750

Arg Glu Lys Leu Ser Met Leu Phe Ile Glu Ser Asp Ile Trp Arg

755 760 765

Pro Glu Thr Asp Ile Leu Leu Leu Asn Arg Leu His Glu Leu Lys

770 775 780

Asn Asn Gly Gln Val His Glu Leu Pro Lys Leu Val Leu Leu Val

785 790 795

Thr Ser Glu Ala Asp Lys Asp Arg Tyr Gly Ser Ala Phe Asp Ile

800 805 810

Val Met Tyr Lys Pro Ile Arg Ala Ser Thr Ile Ala Ser Cys Leu

815 820 825

Gln Gln Leu Leu Lys Val Val Met Pro Glu Arg Lys Asp Asn Gln

830 835 840

Asn Arg Pro Ser Phe Leu Arg Ser Leu Leu Ile Gly Lys Asn Ile

845 850 855

Leu Ile Val Asp Asp Asn Lys Val Asn Leu Arg Val Ala Ala Ala

860 865 870

Ala Leu Lys Lys Tyr Gly Ala Lys Val His Cys Val Glu Ser Gly

875 880 885

Lys Asp Ala Val Ser Leu Leu Gln Gln Pro His Cys Phe Asp Ala

890 895 900

Cys Phe Met Asp Val Gln Met Pro Glu Met Asp Gly Phe Glu Ala

905 910 915

Thr Arg Gln Ile Arg Gln Met Glu Val Lys Ala Asn Glu Glu Arg

920 925 930

Lys Ala Leu Asp Leu Met Glu Gly Ser Thr Phe Val Glu Ser His

935 940 945

Leu Pro Val Leu Ala Met Thr Ala Asp Val Ile Gln Ala Thr Tyr

950 955 960

Glu Glu Cys Ile Lys Ser Gly Met Asp Gly Tyr Val Ser Lys Pro

965 970 975

Phe Asp Glu Glu Gln Leu Tyr Gln Ala Val Ser Arg Leu Val Val

980 985 990

Gly Thr Lys Glu Ser Ala Val

995

 

<210> 3

<211> 44

<212> DNA

The sequence of the 466bp place interpolation of <213> Rice lateral root generation controlling gene OsHK1

<220>

<221> CDS

 

<400>3

ACCTTGCACG TATCGACATG ATGTCTGGGG AGGTGCGATT TCAA 44

 

<210>4

<211>176

<212>PRT

The protein that <213> rice mutant Oshk1-1 encodes

 

<400>4

Met Gly Lys Pro Glu Ala Arg Ser Gly Trp Arg Asn Ala Ala Ala

1 5 10 15

Ala Ala Trp Val Leu Val Ala Val Ala Cys Ala Ala Tyr Met His

20 25 30

Trp His Leu Arg Arg Glu Thr Met Asp Arg Ala Glu Glu Arg Leu

35 40 45

Val Ser Met Cys Glu Glu Arg Ala Arg Met Leu Gln Glu Gln Phe

50 55 60

Gly Val Thr Val Asn His Val His Ala Leu Ala Ile Leu Ile Ser

65 70 75

Thr Phe His Phe Glu Lys Phe Pro Ser Ala Ile Asp Gln Asp Thr

80 85 90

Phe Ala Lys Tyr Thr Ala Arg Thr Ser Phe Glu Arg Pro Leu Leu

95 100 105

Asn Gly Val Ala Tyr Ala Gln Arg Ile Phe His His Glu Arg Glu

110 115 120

Met Phe Glu Asn Gln Gln Gly Trp Ile Met Lys Thr Met Lys Arg

125 130 135

Gln Ala Ala Pro Pro Gln Asp Glu Tyr Ala Pro Val Ile Phe Ser

140 145 150

Gln Asp Thr Val Ser Tyr Leu Ala Arg Ile Asp Met Met Ser Gly

155 160 165

Glu Val Arg Phe Gln Thr Leu His Val Ser Thr

170 175

 

Claims (1)

1. Rice lateral root generation controlling gene OsHK1, this controlling gene OsHK1 total length is 5964bp, wherein the long nucleotide sequence for 2994bp, CDS of CDS is as shown in SEQ ID NO:1, it is characterized in that sporting thymus pyrimidine at the cytosine(Cyt) at 2923bp place in CDS nucleotide sequence.