CN109423492A - Application of the SlTOE1 gene in regulation tomato flowering time and yield - Google Patents

Application of the SlTOE1 gene in regulation tomato flowering time and yield Download PDF

Info

Publication number
CN109423492A
CN109423492A CN201710717987.2A CN201710717987A CN109423492A CN 109423492 A CN109423492 A CN 109423492A CN 201710717987 A CN201710717987 A CN 201710717987A CN 109423492 A CN109423492 A CN 109423492A
Authority
CN
China
Prior art keywords
ltoe1
protein
plant
silencing
gene expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710717987.2A
Other languages
Chinese (zh)
Other versions
CN109423492B (en
Inventor
李传友
朱强
邓磊
李常保
蒋红玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Genetics and Developmental Biology of CAS
Beijing Academy of Agriculture and Forestry Sciences
Original Assignee
Institute of Genetics and Developmental Biology of CAS
Beijing Academy of Agriculture and Forestry Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Genetics and Developmental Biology of CAS, Beijing Academy of Agriculture and Forestry Sciences filed Critical Institute of Genetics and Developmental Biology of CAS
Priority to CN201710717987.2A priority Critical patent/CN109423492B/en
Publication of CN109423492A publication Critical patent/CN109423492A/en
Application granted granted Critical
Publication of CN109423492B publication Critical patent/CN109423492B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Botany (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physiology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses application of the SlTOE1 gene in regulation tomato flowering time and yield.The present invention provides following 1) -3) in application in any object flowering of plant time and/or yield: 1) Protein S lTOE1；2) DNA molecular of Protein S lTOE1 is encoded；3) recombinant vector, expression cassette, transgenic cell line or the recombinant bacterium of the DNA molecular containing coding Protein S lTOE1.Present invention discover that SlTOE1 gene is related to tomato flowering time, yield；SlTOE1 albumen and its code segment gene can be used for early blossoming, the cultivation of high yield plant variety and identification, play a significant role in field in flowering of plant time, Yield Breeding, realize the effect for promoting tomato early blossoming and high yield.

Description

Application of the SlTOE1 gene in regulation tomato flowering time and yield
Technical field
The invention belongs to plant genetic engineering and gene genetics to modify field, and in particular to a kind of SlTOE1 gene is regulating and controlling Application in tomato flowering time and yield.
Background technique
Food Security is more and more urgent at present, and cultivating high-yield crop kind is to solve arranging at all for Food Security It applies.Improving per unit area yield can effectively improve land utilization ratio, reduces land use, meets people's increasing need.Blooming is The particularly important physiology course of most plants.The regulation flowering of plant time is conducive to avoid mature peak period, realizes bigger Economic value, moreover it is possible to planting range is widened, as early-maturing variety adapts to frost-free period shorter region.Cultivate precocious and high product Kind is the important goal of many crop breedings.
Arabidopsis TOE1 transcription factor is to inhibit to bloom by inhibiting the expression of florigen gene FT, arabidopsis TOE1 base Because completely losing plant Blooming after function, but plant is thin and weak, and seed production is greatly reduced.Appropriate Blooming can increase Bloom amount of the plant within growth period, so that yield is improved, so by suitably reducing arabidopsis TOE1 homologous gene in crop Expression quantity be possible to achieve the effect that early blossoming is increased production again.And it is difficult accurately to regulate and control specific gene using traditional breeding way Expression.
RNAi (RNA interference) technology is the Genetic Manipulative Technology in transcriptional level part inhibition of gene expression, New varieties, which are cultivated, using RNAi technology has become the powerful measure for breaking through traditional breeding method and limiting to.RNAi technology principle is in plant Interior expression endogenous gene exon the preceding paragraph antisense sequences, the sequence and internal restriction endonuclease, excision enzyme, unwindase etc., which combine, to be formed The silencing complex (RNA-induced silencing complex, RISC) of RNA induction.RISC and endogenous gene expression The mRNA homologous region nuclease that is specifically bound, and had the function of using it cut mRNA in binding site, cut Fracture mRNA afterwards degrades immediately, to reduce gene expression dose.The technology can not completely inhibit gene expression, only portion Divide and inhibits its expression quantity.The technology comparative maturity, at present the success inhibition of gene expression in many species.
Summary of the invention
A purpose of the invention is to provide following 1) -3) in any substance purposes.
Application of any substance in regulation flowering of plant time and/or yield in following 1) -3) provided by the invention:
1) Protein S lTOE1；
2) DNA molecular of Protein S lTOE1 is encoded；
3) recombinant vector, expression cassette, transgenic cell line or the recombinant bacterium of the DNA molecular containing coding Protein S lTOE1；
The Protein S lTOE1 is following (1) or (2):
(1) protein that the amino acid sequence shown in sequence 2 in sequence table forms；
(2) by amino acid sequence shown in sequence 2 in sequence table by one or several amino acid residues substitution and/or Deletion and/or addition and the protein with the same function as derived from (1).
The substance of inhibition or silencing Protein S lTOE1 gene expression is also present invention guarantor improving the application in plant products The range of shield；
Inhibit or silencing Protein S lTOE1 gene expression substance promote plant Blooming in application be also this Invent the range of protection；
Inhibit or silencing Protein S lTOE1 gene expression substance improve plant products and promote plant Blooming In application be also the scope of protection of the invention.
In above-mentioned application, the substance of the inhibition or silencing Protein S lTOE1 gene expression be it is following a) or b) or c):
A) the RNA segment of inhibition or silencing Protein S lTOE1 gene expression；
B) DNA fragmentation of the RNA is encoded；
C) contain recombinant vector, expression cassette, transgenic cell line or the recombinant bacterium of the DNA fragmentation.
In above-mentioned application, the RNA segment is the RNA of 209-708 nucleotide codings of sequence 3 or sequence 1；
The nucleotides sequence of the DNA fragmentation is classified as sequence 3.
Application of the substance of above-mentioned inhibition or silencing Protein S lTOE1 gene expression in the plant for cultivating output increased It is the scope of protection of the invention；
Or the substance of above-mentioned inhibition or silencing Protein S lTOE1 gene expression is also this cultivating the application in early flowering plant Invent the range of protection；
Or the substance of above-mentioned inhibition or silencing Protein S lTOE1 gene expression is in the plant for cultivating early blossoming and output increased Application be also the scope of protection of the invention.
Another object of the present invention is to provide a kind of method for cultivating output increased and/or early blossoming genetically modified plants.
Method provided by the invention to reduce or eliminate Protein S lTOE1 content, and/or reduces or eliminates Protein S lTOE1 Activity obtains gene plant；
At least one of 1) and 2) genetically modified plants have following character:
1) yield of the genetically modified plants is higher than the purpose plant；
2) flowering time of the genetically modified plants is earlier than the purpose plant.
In the above method, the method reduced or eliminated is Protein S lTOE1 gene table in inhibition or silencing purpose plant It reaches.
In the above method, Protein S lTOE1 gene expression is specially by above-mentioned inhibition in the inhibition or silencing purpose plant Or the DNA fragmentation of silencing Protein S lTOE1 gene expression imports in purpose plant, obtains genetically modified plants；
Or Protein S lTOE1 gene expression is specially by above-mentioned inhibition or silencing egg in the inhibition or silencing purpose plant The DNA fragmentation of white SlTOE1 gene expression is imported in purpose plant by above-mentioned recombinant vector, obtains genetically modified plants.
Among the above, the plant is monocotyledon or dicotyledon；
Or the plant is monocotyledon or dicotyledon, the dicotyledon is tomato.
3rd purpose of the invention is to provide the substance of a kind of inhibition or silencing Protein S lTOE1 gene expression.
Substance provided by the invention, for it is following a) or b) or c):
A) the RNA segment of inhibition or silencing Protein S lTOE1 gene expression；
B) DNA fragmentation of the RNA is encoded；
C) contain recombinant vector, expression cassette, transgenic cell line or the recombinant bacterium of the DNA fragmentation.
In above-mentioned substance, the RNA segment is the RNA of 209-708 nucleotide codings of sequence 3 or sequence 1；
The nucleotides sequence of the DNA fragmentation is classified as sequence 3.
The promotion plant Blooming, which is embodied in, reduces the first sequence flower frontal lobe the piece number and/or increase flowering of plant plant number Amount.
The early blossoming shifts to an earlier date for flowering time.
Above-mentioned application is by choosing the gene constructed RNAi (RNA of tomato TOE1 albumen (SlTOE1 albumen) code segment Interference) silent carrier and being conducted into the plant that sets out is realized；In an embodiment of the present invention, RNAi silent carrier For by interfere SlTOE1 expression segment be built into CaMV 35S promoter driving under SlTOE1 hair fastener silencing unit and by its Import the carrier obtained between plant binary expression vector (Gateway binary vector) corresponding restriction enzyme site of pBIN19, life Entitled SlTOE1::RNAi.
The experiment proves that the present invention utilizes RNAi technology, gene SlTOE1, SlTOE1 base in the silencing tomato of part Because silencing transgene tomato compared with the plant that sets out flowering time it is shorter, the first sequence flower frontal lobe the piece number it is less, yield significantly mentions It is high.Therefore, SlTOE1 gene is related to tomato flowering time, yield；SlTOE1 albumen and its code segment gene can be used for morning The cultivation and identification of flower, high yield plant variety, play a significant role in field in flowering of plant time, Yield Breeding, realize and promote Into tomato early blossoming and the effect of high yield.
Detailed description of the invention
Fig. 1 is the phenotypic results of the transgene tomato Blooming of SlTOE1 gene silencing.
Fig. 2 is the statistical result of the transgene tomato flowering time of SlTOE1 gene silencing.
Fig. 3 is the transgene tomato of SlTOE1 gene silencing in Beijing determination of yield result.
Fig. 4 is the transgene tomato of SlTOE1 gene silencing in Tai'an determination of yield result.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Quantitative experiment in following embodiments, is repeated three times, and results are averaged.
The nucleotides sequence of SlTOE1 gene is classified as sequence 1 in following embodiments, the ammonia of the Protein S lTOE1 of gene coding Base acid sequence is sequence 2.
Tomato uses tomato conventional variety M82 (hereinafter also referred to wild-type tomatoes) in following embodiments, is purchased from the U.S. kind Eggplant genetic resources center (TGRC, http://tgrc.ucdavis.edu/)
The plant binary expression vector acquisition of embodiment 1, SlTOE1 gene silencing
The plant binary recombinant vector pBIN19::SlTOE1i (SlTOE1::RNAi) of SlTOE1 gene silencing is by sequence The replacement pBIN19 plasmid of SlTOE1 hair fastener silencing unit shown in 3 (is recorded in Bevan M.Binary Agrobacterium Vectors for plant transformation.Nucleic Acids Res.1984.12 (22): 8711-8721., it is public Crowd can be obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research) on segment between Sac I and Xba I restriction enzyme site, obtain The carrier arrived, and pass through CaMV 35S promoter (3 1012-1357 of sequence) driving expression.
SlTOE1 hair fastener silencing unit shown in sequence 3, wherein sequence 3 1366-1865 are SlTOE1 gene order 1 209-708, and sequence 3 2677-3176 be SlTOE1 gene order 1 209-708 reverse complementary sequence, Sequence 3 1879-2645 are introne.
Above-mentioned recombinant vector is prepared via a method which:
1, the acquisition of SlTOE1::RNAi segment
The total serum IgE of tomato (Solanum lycopersicum) kind M82 is extracted, the cDNA that reverse transcription obtains is template, PCR amplification is carried out with primer 1 and primer 2.
SlTOE1i-F:5'CCGCTCGAGTCTAGAACGATGATGAGGAAGGATAC 3'(upstream primer)
SlTOE1i-R:5'CGGGGTACCAAGCTTAGTGCTATGGCGTCGCAGCA 3'(downstream primer)
530bp PCR product is obtained, using for use, by sequencing, which is produced after Omega DNA Purification Kit The nucleotides sequence of object is classified as nucleotide shown in sequence 1 209-708, which is named as SlTOE1::RNAi segment.
2, the acquisition of the intermediate vector containing hairpin structure
The Hind III&Xba I difference original pHANNIBAL plasmid of double digestion (is recorded in Wesley SV, Helliwell CA,Smith NA,Wang MB,Rouse DT,Liu Q,Gooding PS,Singh SP,Abbott D,Stoutjesdijk PA,Robinson SP,Gleave AP,Green AG,Waterhouse PM.Construct design for efficient,effective and high-throughput gene silencing in plants.Plant J.2001.27:581-590., the public can be obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research) and above-mentioned 530bp PCR product obtains the pHANNIBAL carrier framework and 510bpPCR product digestion products of 5816bp；
The pHANNIBAL carrier framework of 5816bp is connected with 510bp PCR product digestion products, is obtained pHANNIBAL::SlTOE1。
Kpn I and Xho I distinguish the PCR product of double digestion pHANNIBAL::SlTOE1 plasmid and above-mentioned 530bp, collect The pHANNIBAL::SlTOE1 plasmid enzyme restriction product of 6310bp and the PCR product digestion products of 522bp, connection, obtain pHANNIBAL::SlTOE1i。
3, the acquisition of recombinant vector
Sac I&Spe I double digestion pHANNIBAL::SlTOE1i plasmid, obtains the digestion products (sequence 3) of 3927bp；
Sac I&Xba I (isocaudarner of Spe I) double digestion pBIN19 plasmid, obtains the pBIN19 carrier bone of 11760bp Frame；
The digestion products of 3927bp are connected with the pBIN19 carrier framework of 11760bp, obtain recombinant vector pBIN19:: SlTOE1i (and being named as SlTOE1::RNAi).
Embodiment 2, the acquisition of SlTOE1 gene silencing transgene tomato and the genetic regulation to flowering time and yield
One, the transgene tomato of SlTOE1 gene silencing obtains
1, the recombinant bacterium of SlTOE1 gene silencing obtains
The recombinant expression carrier SlTOE1::RNAi of the SlTOE1 gene silencing obtained by embodiment 1 is converted into Agrobacterium AGL0 (is recorded in Li C, Liu G, Xu C, Lee GI, Bauer P, Ling HQ, Ganal MW, Howe GA.The tomato suppressor of prosystemin-mediated responses2gene encodes a fatty acid desaturase required for the biosynthesis of jasmonic acid and the production of a systemic wound signal for defense gene expression.Plant Cell.2003.15(7): 1646-1661., the public can be obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research), picking monoclonal blocks in containing 28 DEG C of overnight shaking cultures in the LB liquid medium of that enzyme element and rifampin antibiotic, obtain transformant.
Transformant is subjected to bacterium solution PCR identification (primer is SlTOE1i-F and SlTOE1i-R, obtains 477bp as the positive), Positive restructuring bacterium is named as AGL0/SlTOE1::RNAi, and be stored in -70 DEG C it is spare.
2, the transgene tomato of SlTOE1 gene silencing obtains
1), the preparation of tomato conversion correlation culture medium
Liquid MS medium: 4.4g MS salt, 30g sucrose and water are mixed, 1L is settled to water, with 1mol/L KOH tune Between pH to 5.8~6.0, high pressure sterilization.
Seed growth culture medium (1/2MS culture medium): 2.2g MS salt, 30g sucrose and water being mixed, are settled to 1L with water, With between 1mol/L KOH tune pH to 5.8~6.0,0.8% agar, high pressure sterilization is added.
(total) culture medium (D1) in advance: 4.4g MS, 1.0mg zeatin (Zeatin) and 30g sucrose is soluble in water, It is settled to 1L with water, between 1mol/L KOH tune pH to 5.8~6.0, adds 0.8% agar, high pressure sterilization.
Screen differential medium (2Z): by 4.4g MS salt, 2.0mg zeatin, 50mg kanamycins, 100mg inositol, 0.5mg folic acid and 20g sucrose are soluble in water, are settled to 1L with water, between 1mol/L KOH tune pH to 5.8~6.0, add 0.8% agar, high pressure sterilization.
Root media: by 4.4g MS salt, 50mg kanamycins, 0.5mg folic acid, 0.5mg indolebutyric acid and 30g sucrose It is soluble in water, it is settled to 1L with water, between 1mol/L KOH tune pH to 5.8~6.0, adds 0.8% agar, high pressure sterilization.
2), the preparation of the transgene tomato of SlTOE1 gene silencing
(1) preparation of explant is converted
Wild-type tomatoes (kind M82) is taken, full, the big seed of grain is selected, 2min is impregnated with 75% ethyl alcohol, then with 10% NaClO impregnates 10min and is seeded on seed growth culture medium with aseptic water washing 7 times, in 25 DEG C, 16h illumination/8h dark item Illumination cultivation under part.After sprouting 8 days, aseptically cotyledon is diced (movement is fast) with sharp scissors, it will Cotyledon small cube is inoculated in precultivation medium, is cultivated under 25 DEG C, 16h illumination/8h dark condition, after 2d, can be used for kind Eggplant conversion.
(2) preparation of infected liquid
The AGL0/SlTOE1::RNAi saved backup is inoculated in the LB liquid medium containing corresponding antibiotic, 28 DEG C, 200rpm is incubated overnight.Next day is forwarded in new LB liquid medium with the ratio of 1:100,28 DEG C, 200rpm cultivate to OD600=0.7.Bacterium solution is centrifuged 10min with 5000rpm, abandons supernatant, collects thallus.With liquid MS medium again suspended bacteria Body is diluted to OD600The acetosyringone of 50uL 0.074mol/L is added after=0.4, it is spare.
(3) conversion of explant, screen and take root
The cotyledon piece that step (1) obtains is immersed into the infected liquid 10min that (2) prepare respectively, is then inoculated in D1 culture (filter paper is put on culture medium) co-cultures 2 days on base, is transferred to screening and culturing in screening differential medium (2Z), every 2 weeks subculture one Secondary, culture generated resistant buds after 8 weeks.When Elongation of adventitious bud is to 3cm, resistant buds are cut with scalpel, and be forwarded to and take root On culture medium, culture of rootage, the T that will be taken root are carried out0Routine Management in soil is moved into for transgenic plant, harvests T1For SlTOE1:: The transgene tomato seed of RNAi.
Above-mentioned co-cultivation, screening and culturing, the condition of culture of rootage are equal are as follows: temperature is 25 DEG C, 16h illumination/8h is dark.
3), the identification of the transgene tomato of SlTOE1 gene silencing
By the T for one heart stage of two leaves for growing 18 days1It is fast for SlTOE1::RNAi transgene tomato clip above-ground plant parts Fast liquid nitrogen flash freezer, -80 DEG C of preservations.Total serum IgE is extracted, reverse transcription obtains cDNA, is control with wild-type tomatoes M82, carries out RT- PCR。
Primer for RT-PCR detection SlTOE1 expression are as follows:
Primer 3:5 '-ACGGCAGCATCATCAGGAT-3 '
Primer 4:5 '-CAGATCCTGAAGCAGTTCT-3 '
Using actin2 as internal reference, for expanding the RT-PCR primer of reference gene are as follows:
Primer 5:5 '-TTGCTGACCGTATGAGCAAG-3 '
Primer 6:5 '-GGACAATGGATGGACCAGAC-3 '
As a result T1Relative expression quantity for SlTOE1 gene in the transgene tomato of SlTOE1::RNAi is 0.0048；
The relative expression quantity of SlTOE1 gene is 0.0125 in wild-type tomatoes M82；
As can be seen that compared with wild-type tomatoes M82, T1For the SlTOE1 gene in SlTOE1::RNAi transgene tomato Expression is 38.4% of wild type or so, for positive available SlTOE1 gene silencing genetically modified plants.
4) acquisition of homozygous transgenic tomato
Positive T is accredited as by above-mentioned1T is obtained for SlTOE1::RNAi Transgenic Tomato Plants single plant sowing2For seed, The screening on the 1/2MS culture medium of the kanamycins containing 75mg/L will be broadcast after 30-40 seed disinfections respectively, and (wild type M82 is at this Growth will receive serious inhibition on kind of culture medium, show as that main root is shorter, and lateral root does not occur substantially, and transgenic line is due to tool There is kalamycin resistance growth to be not inhibited substantially, the generation of taproot and lateral root is all very normal), if some T1For SlTOE1:: The seed of RNAi transgenic plant harvest is all shown as to kalamycin resistance, then the T1It is homozygote for transgenic plant, The seed of harvest is also all homozygote, can be used for subsequent experiment.It is identified, positive T1For SlTOE1::RNAi transgenosis kind The seed of eggplant strain 4# harvest is all shown as to kalamycin resistance, i.e. T2It is for SlTOE1::RNAi transgene tomato strain 4# Homozygote.
Empty carrier pBIN19 is transferred in wild-type tomatoes M82 using same method, obtains T0In generation, turns empty carrier tomato, Sowing, sowing, until obtaining T2In generation, turns empty carrier tomato.Its SlTOE1 gene relative expression quantity is detected using same method, The result shows that T2In generation, turns in empty carrier tomato leaf that SlTOE1 expression quantity is compared with wild-type tomatoes M82, no significant difference.
Two, genetic regulation of the transgene tomato of SlTOE1 gene silencing to flowering time and yield
Flowering time and determination of yield test method are as follows:
Spring in 2016, in Beijing and Taian Shandong two places, by wild-type tomatoes M82, T2For SlTOE1::RNAi transgenosis Tomato strain 4# homozygosis material (TOE1RNAi-4) and T2In generation, turns the nursery in 32 hole hole tray of greenhouse simultaneously of empty carrier tomato, every cave The various half of both disks, 25 DEG C, illumination cultivation 20d under 16h illumination/8h dark condition.Respectively select 20 consistent seedling of growing way It is transplanted in greenhouse, spacing in the rows, line-spacing are in 60cm or more, two kinds of material random distributions.Normal water and fertilizer management guarantees all Plant water and fertilizer condition is almost the same.Plant is not interrupted, it is allowed to grow naturally.First of first sequence flower uses up to open entirely and be denoted as out Flower, is flowering time from sprouting to blooming.Post flowering counts the first sequence flower frontal lobe the piece number simultaneously, and quantity is smaller, and flowering time is got over It is early.General 90% fruit harvests fruit after reddening, and measures single plant yield, and photograph to record.With T2In generation, turns empty carrier tomato and is Control.
As a result as shown in Figs 1-4,
Fig. 1 is that (A is field early blossoming phenotype, and B is for the phenotypic results of the transgene tomato Blooming of SlTOE1 gene silencing Plant blossom mode), it can be seen that compared with wild-type tomatoes M82, T2It is pure for SlTOE1::RNAi transgene tomato strain 4# Condensation material Blooming (Figure 1A), is consulted, and Figure 1B shows to bloom in advance and inflorescence is more dense.
Fig. 2 is the statistical result of the transgene tomato flowering time of SlTOE1 gene silencing, and wherein A is the first sequence Hua Qianye The piece number is as a result, B is plant number statistical result of blooming, it can be seen that compared with wild-type tomatoes M82, T2For SlTOE1::RNAi The first sequence flower frontal lobe the piece number of transgene tomato strain 4# homozygosis material is few, and plant number of blooming increases, and shows T2For SlTOE1:: RNAi transgene tomato strain 4# homozygosis material flowering time is early.
Fig. 3 be the transgene tomato of SlTOE1 gene silencing in Beijing determination of yield as a result, wherein A is yield phenotype, B is Yield data statistics, it can be seen that compared with wild-type tomatoes M82, T2It is pure for SlTOE1::RNAi transgene tomato strain 4# Condensation material increases in Beijing yield.
Fig. 4 be the transgene tomato of SlTOE1 gene silencing in Tai'an determination of yield as a result, wherein A is yield phenotype, B is Yield data statistics, it can be seen that compared with wild-type tomatoes M82, T2It is pure for SlTOE1::RNAi transgene tomato strain 4# Condensation material increases in Tai'an yield.
Wild-type tomatoes M82 and T2In generation, turns empty carrier tomato result without significant difference.
The above results show that yield and Blooming can be improved in SlTOE1 gene silencing.
Sequence table
<110>Inst. of Genetics and Development Biology, CAS
<120>application of the SlTOE1 gene in regulation tomato flowering time and yield
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 1425
<212> DNA
<213>tomato (Solanum lycopersicum)
<400> 1
atgttggatc tcaatgtaag cgtaatctac aataatgacc ttccacaagt ttctctactt 60
gatgaatcag ccacctccaa ttcatcctta cgaaatgcgg aagctacaac cagtgccggt 120
gacgaagatt cgtgcgccgg tgagttgttc gctttcaatt ttggaatcct caaagttgaa 180
ggagctgaga ctagtaggag cagcaacaac gatgatgagg aaggatacgg taagaatcag 240
agagttactc attctcaatt cgtgactagg cagctgtttc ccgttgatga tggtgagttg 300
aaccggaaac aaaccgatcg ggtcattctc tcctccgctc gatccggtac ttctatcggt 360
tttggagatg tgcggataat acaacagcaa caaacggagc aaccgaaaca acaagtgaag 420
aagagtagga gaggcccaag gtcaagaagt tcacagtaca gaggtgtcac tttctaccgt 480
agaactggta gatgggaatc acatatatgg gactgtggga aacaagtata tttgggtggt 540
tttgatactg ctcacacagc agcaagagct tatgacagag ctgcaattaa atttaggggt 600
gttgatgctg atatcaactt tagcttaagt gattacgagg aggatatgca acagatgaaa 660
aaccttggta aagaagaatt tgtgcacttg ctgcgacgcc atagcactgg tttctcaaga 720
gggagctcca aattcagagg agtgacgcta cataaatgtg gcagatggga ggctcggatg 780
ggacagttcc tcgggaaaaa gtatatatat cttgggctgt tcgacagcga agtagaagct 840
gcaagggcct acgataaggc ggcaattaaa actagcggaa gggaagctgt taccaacttt 900
gagccaagta gctatgaagg ggaaacaatg tctttaccac agagtgaagg tagccaacat 960
gatcttgatc tgaacttggg gatatcgacc acttcttcaa aggaaaatga caggttggga 1020
ggttctcgct atcatcctta cgatatgcaa gacgcaacaa aacctaagat ggataaacct 1080
ggttcagtaa tagttggaag ttcacatctc aagggactac caatgtcgtc ccaacaagct 1140
caattgtgga ctggaatcta ttctaatttc tcttccagct atgagggaag agcatatgac 1200
aagagaaagg acacaggttc atcacaagga cctccaaatt gggcactgca aatgcctagt 1260
caggttgata caaacagccc attgacaatg ttctgcacgg cagcatcatc aggattcttc 1320
attccatcta ctacttctat cacttcatca acatctgcat tagcaacttc aacaaatgcc 1380
tcgcagtgct tttaccagat taatccccgc ctaccacttc cataa 1425
<210> 2
<211> 474
<212> PRT
<213>tomato (Solanum lycopersicum)
<400> 2
Met Leu Asp Leu Asn Val Ser Val Ile Tyr Asn Asn Asp Leu Pro Gln
1 5 10 15
Val Ser Leu Leu Asp Glu Ser Ala Thr Ser Asn Ser Ser Leu Arg Asn
20 25 30
Ala Glu Ala Thr Thr Ser Ala Gly Asp Glu Asp Ser Cys Ala Gly Glu
35 40 45
Leu Phe Ala Phe Asn Phe Gly Ile Leu Lys Val Glu Gly Ala Glu Thr
50 55 60
Ser Arg Ser Ser Asn Asn Asp Asp Glu Glu Gly Tyr Gly Lys Asn Gln
65 70 75 80
Arg Val Thr His Ser Gln Phe Val Thr Arg Gln Leu Phe Pro Val Asp
85 90 95
Asp Gly Glu Leu Asn Arg Lys Gln Thr Asp Arg Val Ile Leu Ser Ser
100 105 110
Ala Arg Ser Gly Thr Ser Ile Gly Phe Gly Asp Val Arg Ile Ile Gln
115 120 125
Gln Gln Gln Thr Glu Gln Pro Lys Gln Gln Val Lys Lys Ser Arg Arg
130 135 140
Gly Pro Arg Ser Arg Ser Ser Gln Tyr Arg Gly Val Thr Phe Tyr Arg
145 150 155 160
Arg Thr Gly Arg Trp Glu Ser His Ile Trp Asp Cys Gly Lys Gln Val
165 170 175
Tyr Leu Gly Gly Phe Asp Thr Ala His Thr Ala Ala Arg Ala Tyr Asp
180 185 190
Arg Ala Ala Ile Lys Phe Arg Gly Val Asp Ala Asp Ile Asn Phe Ser
195 200 205
Leu Ser Asp Tyr Glu Glu Asp Met Gln Gln Met Lys Asn Leu Gly Lys
210 215 220
Glu Glu Phe Val His Leu Leu Arg Arg His Ser Thr Gly Phe Ser Arg
225 230 235 240
Gly Ser Ser Lys Phe Arg Gly Val Thr Leu His Lys Cys Gly Arg Trp
245 250 255
Glu Ala Arg Met Gly Gln Phe Leu Gly Lys Lys Tyr Ile Tyr Leu Gly
260 265 270
Leu Phe Asp Ser Glu Val Glu Ala Ala Arg Ala Tyr Asp Lys Ala Ala
275 280 285
Ile Lys Thr Ser Gly Arg Glu Ala Val Thr Asn Phe Glu Pro Ser Ser
290 295 300
Tyr Glu Gly Glu Thr Met Ser Leu Pro Gln Ser Glu Gly Ser Gln His
305 310 315 320
Asp Leu Asp Leu Asn Leu Gly Ile Ser Thr Thr Ser Ser Lys Glu Asn
325 330 335
Asp Arg Leu Gly Gly Ser Arg Tyr His Pro Tyr Asp Met Gln Asp Ala
340 345 350
Thr Lys Pro Lys Met Asp Lys Pro Gly Ser Val Ile Val Gly Ser Ser
355 360 365
His Leu Lys Gly Leu Pro Met Ser Ser Gln Gln Ala Gln Leu Trp Thr
370 375 380
Gly Ile Tyr Ser Asn Phe Ser Ser Ser Tyr Glu Gly Arg Ala Tyr Asp
385 390 395 400
Lys Arg Lys Asp Thr Gly Ser Ser Gln Gly Pro Pro Asn Trp Ala Leu
405 410 415
Gln Met Pro Ser Gln Val Asp Thr Asn Ser Pro Leu Thr Met Phe Cys
420 425 430
Thr Ala Ala Ser Ser Gly Phe Phe Ile Pro Ser Thr Thr Ser Ile Thr
435 440 445
Ser Ser Thr Ser Ala Leu Ala Thr Ser Thr Asn Ala Ser Gln Cys Phe
450 455 460
Tyr Gln Ile Asn Pro Arg Leu Pro Leu Pro
465 470
<210> 3
<211> 3917
<212> DNA
<213>tomato (Solanum lycopersicum)
<400> 3
gtcgagcggc cgctcgacga attaattcca atcccacaaa aatctgagct taacagcaca 60
gttgctcctc tcagagcaga atcgggtatt caacaccctc atatcaacta ctacgttgtg 120
tataacggtc cacatgccgg tatatacgat gactggggtt gtacaaaggc ggcaacaaac 180
ggcgttcccg gagttgcaca caagaaattt gccactatta cagaggcaag agcagcagct 240
gacgcgtaca caacaagtca gcaaacagac aggttgaact tcatccccaa aggagaagct 300
caactcaagc ccaagagctt tgctaaggcc ctaacaagcc caccaaagca aaaagcccac 360
tggctcacgc taggaaccaa aaggcccagc agtgatccag ccccaaaaga gatctccttt 420
gccccggaga ttacaatgga cgatttcctc tatctttacg atctaggaag gaagttcgaa 480
ggtgaaggtg acgacactat gttcaccact gataatgaga aggttagcct cttcaatttc 540
agaaagaatg ctgacccaca gatggttaga gaggcctacg cagcaggtct catcaagacg 600
atctacccga gtaacaatct ccaggagatc aaataccttc ccaagaaggt taaagatgca 660
gtcaaaagat tcaggactaa ttgcatcaag aacacagaga aagacatatt tctcaagatc 720
agaagtacta ttccagtatg gacgattcaa ggcttgcttc ataaaccaag gcaagtaata 780
gagattggag tctctaaaaa ggtagttcct actgaatcta aggccatgca tggagtctaa 840
gattcaaatc gaggatctaa cagaactcgc cgtgaagact ggcgaacagt tcatacagag 900
tcttttacga ctcaatgaca agaagaaaat cttcgtcaac atggtggagc acgacactct 960
ggtctactcc aaaaatgtca aagatacagt ctcagaagac caaagggcta ttgagacttt 1020
tcaacaaagg ataatttcgg gaaacctcct cggattccat tgcccagcta tctgtcactt 1080
catcgaaagg acagtagaaa aggaaggtgg ctcctacaaa tgccatcatt gcgataaagg 1140
aaaggctatc attcaagatc tctctgccga cagtggtccc aaagatggac ccccacccac 1200
gaggagcatc gtggaaaaag aagacgttcc aaccacgtct tcaaagcaag tggattgatg 1260
tgacatctcc actgacgtaa gggatgacgc acaatcccac tatccttcgc aagacccttc 1320
ctctatataa ggaagttcat ttcatttgga gaggacacgc tcgagacgat gatgaggaag 1380
gatacggtaa gaatcagaga gttactcatt ctcaattcgt gactaggcag ctgtttcccg 1440
ttgatgatgg tgagttgaac cggaaacaaa ccgatcgggt cattctctcc tccgctcgat 1500
ccggtacttc tatcggtttt ggagatgtgc ggataataca acagcaacaa acggagcaac 1560
cgaaacaaca agtgaagaag agtaggagag gcccaaggtc aagaagttca cagtacagag 1620
gtgtcacttt ctaccgtaga actggtagat gggaatcaca tatatgggac tgtgggaaac 1680
aagtatattt gggtggtttt gatactgctc acacagcagc aagagcttat gacagagctg 1740
caattaaatt taggggtgtt gatgctgata tcaactttag cttaagtgat tacgaggagg 1800
atatgcaaca gatgaaaaac cttggtaaag aagaatttgt gcacttgctg cgacgccata 1860
gcactggtac cccaattggt aaggaaataa ttattttctt ttttcctttt agtataaaat 1920
agttaagtga tgttaattag tatgattata ataatatagt tgttataatt gtgaaaaaat 1980
aatttataaa tatattgttt acataaacaa catagtaatg taaaaaaata tgacaagtga 2040
tgtgtaagac gaagaagata aaagttgaga gtaagtatat tatttttaat gaatttgatc 2100
gaacatgtaa gatgatatac tagcattaat atttgtttta atcataatag taattctagc 2160
tggtttgatg aattaaatat caatgataaa atactatagt aaaaataaga ataaataaat 2220
taaaataata tttttttatg attaatagtt tattatataa ttaaatatct ataccattac 2280
taaatatttt agtttaaaag ttaataaata ttttgttaga aattccaatc tgcttgtaat 2340
ttatcaataa acaaaatatt aaataacaag ctaaagtaac aaataatatc aaactaatag 2400
aaacagtaat ctaatgtaac aaaacataat ctaatgctaa tataacaaag cgcaagatct 2460
atcattttat atagtattat tttcaatcaa cattcttatt aatttctaaa taatacttgt 2520
agttttatta acttctaaat ggattgacta ttaattaaat gaattagtcg aacatgaata 2580
aacaaggtaa catgatagat catgtcattg tgttatcatt gatcttacat ttggattgat 2640
tacagttggg aaattgggtt cgaaatcgat aagcttagtg ctatggcgtc gcagcaagtg 2700
cacaaattct tctttaccaa ggtttttcat ctgttgcata tcctcctcgt aatcacttaa 2760
gctaaagttg atatcagcat caacacccct aaatttaatt gcagctctgt cataagctct 2820
tgctgctgtg tgagcagtat caaaaccacc caaatatact tgtttcccac agtcccatat 2880
atgtgattcc catctaccag ttctacggta gaaagtgaca cctctgtact gtgaacttct 2940
tgaccttggg cctctcctac tcttcttcac ttgttgtttc ggttgctccg tttgttgctg 3000
ttgtattatc cgcacatctc caaaaccgat agaagtaccg gatcgagcgg aggagagaat 3060
gacccgatcg gtttgtttcc ggttcaactc accatcatca acgggaaaca gctgcctagt 3120
cacgaattga gaatgagtaa ctctctgatt cttaccgtat ccttcctcat catcgttcta 3180
gagtcctgct ttaatgagat atgcgagacg cctatgatcg catgatattt gctttcaatt 3240
ctgttgtgca cgttgtaaaa aacctgagca tgtgtagctc agatccttac cgccggtttc 3300
ggttcattct aatgaatata tcacccgtta ctatcgtatt tttatgaata atattctccg 3360
ttcaatttac tgattgtacc ctactactta tatgtacaat attaaaatga aaacaatata 3420
ttgtgctgaa taggtttata gcgacatcta tgatagagcg ccacaataac aaacaattgc 3480
gttttattat tacaaatcca attttaaaaa aagcggcaga accggtcaaa cctaaaagac 3540
tgattacata aatcttattc aaatttcaaa aggccccagg ggctagtatc tacgacacac 3600
cgagcggcga actaataacg ttcactgaag ggaactccgg ttccccgccg gcgcgcatgg 3660
gtgagattcc ttgaagttga gtattggccg tccgctctac cgaaagttac gggcaccatt 3720
caacccggtc cagcacggcg gccgggtaac cgacttgctg ccccgagaat tatgcagcat 3780
ttttttggtg tatgtgggcc ccaaatgaag tgcaggtcaa accttgacag tgacgacaaa 3840
tcgttgggcg ggtccagggc gaattttgcg acaacatgtc gaggctcagc aggacctgca 3900
ggcatgcaag ctagctt 3917

Claims (10)

1. following 1) -3) application of any substance in regulation flowering of plant time and/or yield in:
1) Protein S lTOE1；
2) DNA molecular of Protein S lTOE1 is encoded；
3) recombinant vector, expression cassette, transgenic cell line or the recombinant bacterium of the DNA molecular containing coding Protein S lTOE1；
The Protein S lTOE1 is following (1) or (2):
(1) protein that the amino acid sequence shown in sequence 2 in sequence table forms；
(2) amino acid sequence shown in sequence 2 in sequence table is passed through to the substitution and/or missing of one or several amino acid residues And/or addition and the protein with the same function as derived from (1).
2. inhibiting or the substance of silencing Protein S lTOE1 gene expression improving the application in plant products；
Inhibit or silencing Protein S lTOE1 gene expression substance promote plant Blooming in application；
Inhibit or silencing Protein S lTOE1 gene expression substance improve plant products and promote plant Blooming in Using.
3. application according to claim 2, it is characterised in that: the object of the inhibition or silencing Protein S lTOE1 gene expression Matter be it is following a) or b) or c):
A) the RNA segment of inhibition or silencing Protein S lTOE1 gene expression；
B) DNA fragmentation of the RNA is encoded；
C) contain recombinant vector, expression cassette, transgenic cell line or the recombinant bacterium of the DNA fragmentation.
4. application according to claim 2 or 3, it is characterised in that:
The RNA segment is the RNA of 209-708 nucleotide codings of sequence 3 or sequence 1；
The nucleotides sequence of the DNA fragmentation is classified as sequence 3.
5. the substance of inhibition or silencing Protein S lTOE1 gene expression in claim 2-4 in any application is being cultivated Application in the plant of output increased；
Or the substance of the inhibition or silencing Protein S lTOE1 gene expression in claim 2-4 in any application is being cultivated Application in early flowering plant；
Or the substance of the inhibition or silencing Protein S lTOE1 gene expression in claim 2-4 in any application is being cultivated Application in the plant of early blossoming and output increased.
6. a kind of method for cultivating output increased and/or early blossoming genetically modified plants, to reduce or eliminate Protein S lTOE1 content, And/or Protein S lTOE1 activity is reduced or eliminated, obtain gene plant；
At least one of 1) and 2) genetically modified plants have following character:
1) yield of the genetically modified plants is higher than the purpose plant；
2) flowering time of the genetically modified plants is earlier than the purpose plant.
7. according to the method described in claim 6, it is characterized by:
The method reduced or eliminated is Protein S lTOE1 gene expression in inhibition or silencing purpose plant；
Protein S lTOE1 gene expression is specially that will inhibit described in claim 3 or 4 in the inhibition or silencing purpose plant Or the DNA fragmentation of silencing Protein S lTOE1 gene expression imports in purpose plant, obtains genetically modified plants；
Or Protein S lTOE1 gene expression is specially that will press down described in claim 3 or 4 in the inhibition or silencing purpose plant System or the DNA fragmentation of silencing Protein S lTOE1 gene expression pass through the importing purpose plant of recombinant vector described in claim 3 or 4 In, obtain genetically modified plants.
8. method described in application according to any one of claims 1-4 or claim 6 or 7, it is characterised in that:
The plant is monocotyledon or dicotyledon；
Or the plant is monocotyledon or dicotyledon, the dicotyledon is tomato.
9. the substance of a kind of inhibition or silencing Protein S lTOE1 gene expression, for it is following a) or b) or c):
A) the RNA segment of inhibition or silencing Protein S lTOE1 gene expression；
B) DNA fragmentation of the RNA is encoded；
C) contain recombinant vector, expression cassette, transgenic cell line or the recombinant bacterium of the DNA fragmentation.
10. substance according to claim 9, it is characterised in that: the RNA segment is 1 209-708 of sequence 3 or sequence The RNA of position nucleotide coding；
The nucleotides sequence of the DNA fragmentation is classified as sequence 3.
CN201710717987.2A 2017-08-21 2017-08-21 Application of SlTOE1 gene in regulation and control of flowering time and yield of tomatoes Active CN109423492B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710717987.2A CN109423492B (en) 2017-08-21 2017-08-21 Application of SlTOE1 gene in regulation and control of flowering time and yield of tomatoes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710717987.2A CN109423492B (en) 2017-08-21 2017-08-21 Application of SlTOE1 gene in regulation and control of flowering time and yield of tomatoes

Publications (2)

Publication Number Publication Date
CN109423492A true CN109423492A (en) 2019-03-05
CN109423492B CN109423492B (en) 2021-01-15

Family

ID=65499026

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710717987.2A Active CN109423492B (en) 2017-08-21 2017-08-21 Application of SlTOE1 gene in regulation and control of flowering time and yield of tomatoes

Country Status (1)

Country Link
CN (1) CN109423492B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111662366A (en) * 2019-03-06 2020-09-15 中国科学院遗传与发育生物学研究所 Preparation method of early-flowering high-yield tomato material
CN112080515A (en) * 2019-06-14 2020-12-15 中国科学院分子植物科学卓越创新中心 UP gene and application thereof in plant improvement
CN113293167A (en) * 2021-04-12 2021-08-24 华中农业大学 Gene for controlling early and late flowering of tomato and application thereof
CN114957417A (en) * 2021-02-20 2022-08-30 中国农业大学 Protein related to pollen development and application of coding gene thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105949295A (en) * 2016-07-15 2016-09-21 中国农业科学院作物科学研究所 Protein relevant to plant flowering time and encoding gene and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105949295A (en) * 2016-07-15 2016-09-21 中国农业科学院作物科学研究所 Protein relevant to plant flowering time and encoding gene and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KARLOVA R,ET AL.: "NCBI Reference Sequence: NM_001246962.2", 《GENBANK》 *
RUMYANA KARLOVA,ET AL.: "Transcriptome and Metabolite Profiling Show That APETALA2a Is a Major Regulator of Tomato Fruit Ripening", 《THE PLANT CELL》 *
TAO XU,ET AL.: "Small RNA and degradome sequencing reveals microRNAs and their targets involved in tomato pedicel abscission", 《PLANTA》 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111662366A (en) * 2019-03-06 2020-09-15 中国科学院遗传与发育生物学研究所 Preparation method of early-flowering high-yield tomato material
CN112080515A (en) * 2019-06-14 2020-12-15 中国科学院分子植物科学卓越创新中心 UP gene and application thereof in plant improvement
CN112080515B (en) * 2019-06-14 2022-07-12 中国科学院分子植物科学卓越创新中心 UP gene and application thereof in plant improvement
CN114957417A (en) * 2021-02-20 2022-08-30 中国农业大学 Protein related to pollen development and application of coding gene thereof
CN114957417B (en) * 2021-02-20 2023-05-26 中国农业大学 Protein related to pollen development and application of coding gene thereof
CN113293167A (en) * 2021-04-12 2021-08-24 华中农业大学 Gene for controlling early and late flowering of tomato and application thereof
CN113293167B (en) * 2021-04-12 2022-03-01 华中农业大学 Gene for controlling early and late flowering of tomato and application thereof

Also Published As

Publication number Publication date
CN109423492B (en) 2021-01-15

Similar Documents

Publication Publication Date Title
CN113337520B (en) Upland cotton GhA0749 and GhD0744 transcription factors and application thereof in flowering regulation
CN109423492A (en) Application of the SlTOE1 gene in regulation tomato flowering time and yield
CN102643830B (en) Application of cotton gene GbMYB 5 related to drought resistance
CN104903444B (en) Highly yielding ability nucleic acid, the method for preparing the increased genetically modified plants of yield, the method for increasing the yield of plant are assigned to plant
CN115896045A (en) Application of birch pear E3 ubiquitin ligase gene PbrATL18 in genetic improvement of plant drought resistance and anthracnose
CN107325162A (en) SPL genes and its application in enhancing Heat Resistance of Plant performance
CN103288943B (en) Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof
CN115851821B (en) Application of BBX16 gene in improving plant salt tolerance
CN102477435A (en) Method for improving plant drought resistance using Poncirus trifoliata transcription factor gene PtrABF
CN103183731A (en) Dendrobe DnMYB type transcription factor, coding gene, carrier and engineering bacteria and application thereof
CN110904106A (en) Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity
CN102732553B (en) Improve the gene engineering method and material of plant products
CN107573411A (en) Application of the wheat TaZIM1 7A albumen in crop heading stage is regulated and controled
CN106801062A (en) It is a kind of to turn the method that NtZFP8 genes improve Plant Tissue Breeding differentiation efficiency
JP2011239684A (en) Improvement of material productivity of plant using transcription factor
CN101906426B (en) Method for regulating plant photoperiod by combining soybean gibberellin with protein gene
CN104946663A (en) Cotton draught-resistant gene GhSNAC1 and applications thereof
CN110951771A (en) Application of cymbidium goeringii miR390a in control of plant root system development
CN116622725B (en) Hybrid tulip tree LhMFT2 gene and application
CN114230649B (en) Tn1 protein related to rice tillering force, related biological material and application thereof
CN104371023A (en) Application of CDS sequence of paddy rice transcription factor Os01g36630 gene
CN116121298B (en) Application of inhibiting expression of HSRP1 gene in improving heat resistance of plants
CN103254299B (en) Method for acquiring anti-fungal-disease plant
CN104341491B (en) Drought tolerant associated protein for plant OsERF62 and its encoding gene and application
CN102181477A (en) Application of anti-sense expression of rice OsPDCD5 (Oryza sativa Programmed Cell Death 5) gene to improving yield character of rice

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant