CN109423492B

CN109423492B - Application of SlTOE1 gene in regulation and control of flowering time and yield of tomatoes

Info

Publication number: CN109423492B
Application number: CN201710717987.2A
Authority: CN
Inventors: 李传友; 朱强; 邓磊; 李常保; 蒋红玲
Original assignee: Institute of Genetics and Developmental Biology of CAS; Beijing Academy of Agriculture and Forestry Sciences
Current assignee: Institute of Genetics and Developmental Biology of CAS; Beijing Academy of Agriculture and Forestry Sciences
Priority date: 2017-08-21
Filing date: 2017-08-21
Publication date: 2021-01-15
Anticipated expiration: 2037-08-21
Also published as: CN109423492A

Abstract

The invention discloses an application of a SlTOE1 gene in regulation and control of flowering time and yield of tomatoes. The invention provides the use of the plants of any one of the following 1) to 3) in flowering time and/or yield: 1) protein SlTOE 1; 2) a DNA molecule encoding the protein SlTOE 1; 3) a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing a DNA molecule encoding the protein SlTOE 1. The SlTOE1 gene is found to be related to the flowering time and yield of tomatoes; the SlTOE1 protein and part of coding genes thereof can be used for cultivating and identifying early-flowering and high-yield plant varieties, play an important role in the fields of plant flowering time and yield breeding, and realize the effects of promoting early flowering and high yield of tomatoes.

Description

Application of SlTOE1 gene in regulation and control of flowering time and yield of tomatoes

Technical Field

The invention belongs to the field of plant genetic engineering and genetic modification, and particularly relates to application of a SlTOE1 gene in regulation and control of flowering time and yield of tomatoes.

Background

At present, the problem of grain safety is more and more urgent, and the cultivation of high-yield crop varieties is a fundamental measure for solving the problem of grain safety. The yield per unit is improved, so that the land utilization rate can be effectively improved, the land use is reduced, and the ever-increasing requirements of people are met. Flowering is an extremely important physiological process in most plants. The flowering time of the plants is controlled to avoid the peak period of maturity, so that the economic value is higher, the planting range can be widened, and the early-maturing variety can adapt to regions with shorter frost-free period. Breeding early-maturing and high-yielding varieties is an important goal in breeding many crops.

The Arabidopsis TOE1 transcription factor inhibits flowering by inhibiting the expression of florigen gene FT, and plants flower early after the Arabidopsis TOE1 gene completely loses function, but the plants are thin and weak, and the seed yield is greatly reduced. The early flowering and yield increasing effect can be achieved by properly reducing the expression level of the Arabidopsis TOE1 homologous gene in the crops. However, it is difficult to precisely control the expression level of a specific gene using a conventional breeding method.

RNAi (RNA interference) technology is a genetic manipulation technology for inhibiting gene expression at the transcriptional level, and the cultivation of new varieties by using the RNAi technology has become a powerful means for breaking through the traditional breeding limitation. The principle of RNAi technology is to express an antisense sequence on the exon of an endogenous gene in a plant body, and the sequence is combined with in vivo endonuclease, exonuclease, helicase and the like to form an RNA-induced silencing complex (RISC). RISC and mRNA homologous region expressed by endogenous gene carry out specific combination, and mRNA is cut at the combination position by utilizing the nuclease function of RISC, and the cut broken mRNA is immediately degraded, thereby reducing the gene expression level. This technique does not completely inhibit gene expression, but partially inhibits the expression level. This technique is well established and has been successful in suppressing gene expression in many species.

Disclosure of Invention

An object of the present invention is to provide use of any one of the following 1) to 3).

The invention provides an application of any substance of the following 1) -3) in regulating and controlling flowering time and/or yield of plants:

1) protein SlTOE 1;

2) a DNA molecule encoding the protein SlTOE 1;

3) a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing a DNA molecule encoding the protein SlTOE 1;

the protein SlTOE1 is (1) or (2) as follows:

(1) a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table;

(2) and (b) the protein which is derived from the protein (1) and has the same function and is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2 in the sequence table.

The application of the substance for inhibiting or silencing the expression of the SlTOE1 gene in improving the yield of plants is also within the protection scope of the invention;

or the application of the substance for inhibiting or silencing the expression of the SlTOE1 gene in promoting the early flowering of plants is also within the protection scope of the invention;

or inhibiting or silencing SlTOE1 gene expression in plant yield and promoting plant blooming.

In the above application, the substance for inhibiting or silencing expression of the protein SlTOE1 gene is a) or b) or c) as follows:

a) an RNA fragment that inhibits or silences the expression of the SlTOE1 gene;

b) a DNA fragment encoding the RNA;

c) recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the DNA fragments.

In the above application, the RNA fragment is RNA encoded by nucleotides 209-708 of the

sequence

3 or 1;

the nucleotide sequence of the DNA fragment is sequence 3.

The application of the substance for inhibiting or silencing the expression of the SlTOE1 gene in cultivating plants with improved yield is also within the protection scope of the invention;

or the application of the substance for inhibiting or silencing the expression of the SlTOE1 gene in the cultivation of early flowering plants is also within the protection scope of the invention;

or the application of the substance for inhibiting or silencing the expression of the SlTOE1 gene in cultivating early-flowering plants with improved yield is also within the protection scope of the invention.

It is another object of the present invention to provide a method for breeding transgenic plants with improved yield and/or early flowering.

The method provided by the invention is used for reducing or eliminating the content of the protein SlTOE1 and/or reducing or eliminating the activity of the protein SlTOE1 to obtain a gene plant;

the transgenic plant has at least one of the following 1) and 2):

1) the transgenic plant has higher yield than the target plant;

2) the transgenic plant blooms earlier than the target plant.

In the above method, the reduction or elimination is carried out by inhibiting or silencing the expression of the SlTOE1 gene in the plant of interest.

In the method, the step of inhibiting or silencing the expression of the protein SlTOE1 gene in the target plant is specifically to introduce a DNA fragment for inhibiting or silencing the expression of the protein SlTOE1 gene into the target plant to obtain a transgenic plant;

or the expression of the protein SlTOE1 gene in the target plant is inhibited or silenced, in particular the DNA fragment for inhibiting or silencing the expression of the protein SlTOE1 gene is introduced into the target plant through the recombinant vector to obtain a transgenic plant.

In the above, the plant is a monocotyledon or dicotyledon;

or the plant is a monocotyledon or a dicotyledon, and the dicotyledon is tomato.

The 3 rd object of the invention is to provide a substance for inhibiting or silencing the expression of the SlTOE1 gene.

The substance provided by the invention is a) or b) or c):

a) an RNA fragment that inhibits or silences the expression of the SlTOE1 gene;

b) a DNA fragment encoding the RNA;

In the above-mentioned material, the RNA fragment is the RNA encoded by the 209 nd and 708 th nucleotides of the

sequence

3 or 1;

the nucleotide sequence of the DNA fragment is sequence 3.

The promotion of the early flowering of the plants is realized by reducing the number of leaves before first-order flowering and/or increasing the number of flowering plants of the plants.

The early blossoming is that the flowering time is advanced.

The application is realized by selecting a part of coding genes of tomato TOE1 protein (SLTOE1 protein) to construct an RNAi (RNA interference) silencing vector and introducing the RNAi (RNA interference) silencing vector into a starting plant; in the embodiment of the invention, the RNAi silencing vector is a vector obtained by constructing a segment interfering with the expression of SlTOE1 into a SlTOE1 hairpin silencing unit driven by a CaMV 35S promoter and introducing the hairpin silencing unit into a corresponding enzyme cutting site of a plant binary expression vector (Gateway binary vector) pBIN19, and is named as SlTOE1: RNAi.

Experiments prove that the transgenic tomatoes which partially silence genes SlTOE1 and SlTOE1 in the tomatoes have shorter flowering time, less leaves before first-order flowers and remarkably improved yield compared with starting plants by utilizing RNAi technology. Therefore, the SlTOE1 gene is related to tomato flowering time, yield; the SlTOE1 protein and part of coding genes thereof can be used for cultivating and identifying early-flowering and high-yield plant varieties, play an important role in the fields of plant flowering time and yield breeding, and realize the effects of promoting early flowering and high yield of tomatoes.

Drawings

FIG. 1 shows phenotypic results of premature flowering of transgenic tomatoes with silenced SlTOE1 gene.

FIG. 2 shows the statistical result of the flowering time of transgenic tomatoes with SlTOE1 gene silenced.

FIG. 3 shows the results of yield determination of transgenic tomatoes with a silenced SlTOE1 gene in Beijing.

FIG. 4 shows the results of Takara production assay of transgenic tomatoes with a silenced SlTOE1 gene.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The quantitative experiments in the examples below were repeated three times in average and the results averaged.

In the following examples, the nucleotide sequence of the SlTOE1 gene is shown as sequence 1, and the amino acid sequence of the protein SlTOE1 coded by the gene is shown as sequence 2.

The following examples tomato was obtained from the tomato general variety M82 (hereinafter also referred to as wild type tomato) purchased from the American tomato genetic resource center (TGRC, http:// TGRC. ucdavis. edu /)

Example 1 plant binary expression vector for SlTOE1 Gene silencing

SlTOE1 gene silencing plant binary recombinant vector pBIN19:: SlTOE1I (SlTOE1:: RNAi) is a vector obtained by replacing the SlTOE1 hairpin silencing unit shown in sequence 3 with a fragment between Sac I and Xba I cleavage sites on a pBIN19 plasmid (described in Bevan M. binary Agrobacterium vectors for plant transformation. nucleic Acids Res.1984.12(22):8711-8721, publicly available from institute of genetics and developmental biology), and expressed by a CaMV 35S promoter (sequence 3, 1012. sup. 1357).

The SlTOE1 hairpin silencing unit shown in sequence 3, wherein the 1366 th-1865 th position of the sequence 3 is the 209 th-708 th position of the SlTOE1 gene sequence 1, the 2677 th-3176 th position of the sequence 3 is the reverse complement sequence of the 209 th-708 th position of the SlTOE1 gene sequence 1, and the 1879 th-2645 th position of the sequence 3 is an intron.

The recombinant vector is prepared by the following method:

1. SlTOE1 acquisition of RNAi fragments

Total RNA of tomato (Solanum lycopersicum) variety M82 was extracted, and the cDNA obtained by reverse transcription was used as a template, and PCR amplification was performed using primer 1 and primer 2.

SlTOE1 i-F: 5' CCGCTCGAGTCTAGAACGATGATGAGGAAGGATAC 3 (upstream primer)

SlTOE1 i-R: 5' CGGGGTACCAAGCTTAGTGCTATGGCGTCGCAGCA 3 (downstream primer)

Obtaining a 530bp PCR product, purifying the product by using an Omega DNA purification kit for later use, and sequencing the product, wherein the nucleotide sequence of the PCR product is the nucleotide shown in the 209 nd-708 th site of the sequence 1, and the PCR product is named as SlTOE1 & ltRNAi fragment.

2. Obtaining intermediate vectors containing hairpin structures

Hind III & Xba I double digested the original pHANNIBAL plasmid (described in Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, Waterhouse PM.structural design for efficacy, efficacy and high-throughput gene cloning in plants J.2001.27:581-590, available from institute of genetics and developmental biology) and the 530bp PCR product, respectively, to give 5816bp pHANNIBAL vector backbone and 510bp PCR product cleavage product;

the 5816bp pHANNIBAL vector skeleton and the 510bp PCR product enzyme digestion product are connected to obtain pHANNIBAL as the vector skeleton and SlTOE 1.

Kpn I and Xho I respectively double-enzyme-cut pHANNIBAL:. SlTOE1 plasmid and the PCR product of 530bp, collect 6310bp pHANNIBAL:. SlTOE1 plasmid enzyme-cut product and 522bp PCR product enzyme-cut product, and connect to obtain pHANNIBAL:. SlTOE 1I.

3. Obtaining of recombinant vectors

The plasmid SlTOE1I is digested by Sac I and Spe I to obtain a 3927bp digestion product (sequence 3);

sac I & Xba I (isocaudarner of Spe I) double enzyme digestion pBIN19 plasmid, getting 11760bp pBIN19 carrier skeleton;

the 3927bp restriction enzyme product was ligated to the 11760bp pBIN19 vector backbone to obtain the recombinant vector pBIN19: SlTOE1i (also named SlTOE1: RNAi).

Example 2 acquisition of transgenic tomato with SlTOE1 Gene silencing and genetic control of flowering time and yield

First, transgenic tomato with SlTOE1 gene silencing is obtained

1. Obtaining of recombinant bacteria with SlTOE1 gene silencing

RNAi-transformed Agrobacterium AGL0 (described in Li C, Liu G, Xu C, Lee GI, Bauer P, Ling HQ, Ganal MW, Howe GA. the tomato substrate of the protocol 2gene codes a fat acid purified enzyme required for the biological study of the jasmonic acid and the protein of the system, microorganism gene expression. plant.2003.15 (7):1646-1661. publicly available from national academy of genetics and development biology research) was cultured in LB liquid medium containing kanamycin and antibiotic at 28 ℃ overnight with shaking.

Transformants were identified by PCR from bacterial fluid (primers SlTOE1i-F and SlTOE1i-R, resulting in 477bp positive), positive recombinant bacteria were named AGL0/SlTOE1: RNAi, and stored at-70 ℃ for future use.

2. Transgenic tomato acquisition with SlTOE1 gene silencing

1) Preparation of tomato transformation-related culture medium

Liquid MS medium: mixing 4.4g of MS salt, 30g of cane sugar and water, diluting to 1L with water, adjusting the pH value to 5.8-6.0 with 1mol/L of KOH, and sterilizing under high pressure.

Seed growth medium (1/2MS medium): mixing 2.2g of MS salt, 30g of sucrose and water, diluting to 1L with water, adjusting the pH to 5.8-6.0 with 1mol/L of KOH, adding 0.8% of agar, and autoclaving.

Pre (co) culture medium (D1): dissolving 4.4g of MS, 1.0mg of Zeatin (Zeatin) and 30g of sucrose in water, fixing the volume to 1L with water, adjusting the pH to 5.8-6.0 with 1mol/L of KOH, adding 0.8% of agar, and autoclaving.

Screening differentiation medium (2Z): dissolving 4.4g of MS salt, 2.0mg of zeatin, 50mg of kanamycin, 100mg of inositol, 0.5mg of folic acid and 20g of sucrose in water, fixing the volume to 1L by using water, adjusting the pH to be 5.8-6.0 by using 1mol/L of KOH, adding 0.8% of agar, and carrying out autoclaving.

Rooting culture medium: dissolving 4.4g of MS salt, 50mg of kanamycin, 0.5mg of folic acid, 0.5mg of indolebutyric acid and 30g of sucrose in water, fixing the volume to 1L by using water, adjusting the pH to be between 5.8 and 6.0 by using 1mol/L of KOH, adding 0.8 percent of agar, and autoclaving.

2) Preparation of transgenic tomato with SlTOE1 gene silencing function

(1) Preparation of transformed explants

Selecting a wild tomato (variety M82), selecting plump and large-grain seeds, soaking for 2min by using 75% ethanol, then soaking for 10min by using 10% NaClO, washing for 7 times by using sterile water, sowing on a seed growth culture medium, and carrying out light culture under the conditions of 25 ℃ and 16h light/8 h dark. After 8 days of germination, cotyledons were cut into small squares (faster action) with sharp scissors under sterile conditions, the cotyledons were inoculated into a preculture medium and cultured at 25 ℃ under 16h light/8 h dark conditions, and after 2 days, they were available for tomato transformation.

(2) Preparation of the invaded liquor

The AGL0/SlTOE1 was stored as ready and RNAi inoculated in LB liquid medium containing the corresponding antibiotic and cultured overnight at 200rpm at 28 ℃. The next day, transferring into new LB liquid culture medium at a ratio of 1:100, culturing at 28 deg.C and 200rpm to OD₆₀₀0.7. The bacterial solution was centrifuged at 5000rpm for 10min, the supernatant was discarded, and the cells were collected. Resuspending the cells in a liquid MS medium, diluting to OD₆₀₀After the concentration is 0.4, 50uL of 0.074mol/L acetosyringone is added for standby.

(3) Explant transformation, selection and rooting

And (3) respectively immersing the cotyledon blocks obtained in the step (1) into the prepared infection liquid in the step (2) for 10min, then inoculating the cotyledon blocks on a D1 culture medium (filter paper is placed on the culture medium) for 2 days of co-culture, transferring the cotyledon blocks into a screening differentiation culture medium (2Z) for screening culture, carrying out subculture once every 2 weeks, and generating resistant buds after 8 weeks of culture. When the adventitious bud is elongated to 3cm, cutting off the resistant bud with scalpel, transferring to rooting culture medium, performing rooting culture, and allowing rooted T₀Transferring the transgenic plant into soil for conventional management, and harvesting T₁Generation SlTOE1, transgenic tomato seeds for RNAi.

The conditions of the co-culture, the screening culture and the rooting culture are as follows: the temperature is 25 ℃, 16h light/8 h dark.

3) Identification of transgenic tomato with SlTOE1 gene silencing

T of 18-day-old two-leaf one-heart stage₁In the SlTOE1 generation, the aerial parts of the plants of the RNAi transgenic tomatoes are cut and quickly frozen by liquid nitrogen, and the plants are preserved at the temperature of minus 80 ℃. Extracting total RNA, reverse transcribing to obtain cDNA, and performing RT-reaction with wild tomato M82 as controlPCR。

The primers used for RT-PCR detection of the expression level of SlTOE1 are as follows:

primer 3: 5'-ACGGCAGCATCATCAGGAT-3'

Primer 4: 5'-CAGATCCTGAAGCAGTTCT-3'

The method takes actin2 as an internal reference, and RT-PCR primers for amplifying internal reference genes are as follows:

primer 5: 5'-TTGCTGACCGTATGAGCAAG-3'

Primer 6: 5'-GGACAATGGATGGACCAGAC-3'

Results T₁Generation SlTOE1, wherein the relative expression quantity of SlTOE1 genes in RNAi transgenic tomatoes is 0.0048;

the relative expression amount of the SlTOE1 gene in the wild tomato M82 is 0.0125;

it can be seen that T is compared to the wild type tomato M82₁And (3) generation SlTOE1, wherein the expression levels of SlTOE1 genes in RNAi transgenic tomatoes are about 38.4% of wild types, and the plants are positive usable SlTOE1 gene silencing transgenic plants.

4) Obtaining homozygous transgenic tomato

T positive in the above-mentioned identification₁Generation SlTOE1 that obtaining T by harvesting single plant of RNAi transgenic tomato plant₂Generation of seeds, 30-40 seeds were respectively sterilized and selected on 1/2MS medium containing 75mg/L kanamycin (wild type M82 growth on this medium is severely inhibited, as shown by short main roots and basically no lateral roots, while transgenic material growth is basically not inhibited due to kanamycin resistance, generation of main roots and lateral roots is normal), if a certain T is selected₁Generation SlTOE 1-seeds harvested from RNAi transgenic plants all showed resistance to kanamycin, and this T was₁The generation transgenic plants are homozygote, and the harvested seeds are homozygote, so that the generation transgenic plants can be used for subsequent experiments. Identified as positive T₁Generation SlTOE1 seeds harvested from RNAi transgenic tomato line 4# all showed resistance to kanamycin, T₂Generation SlTOE 1RNAi transgenic tomato line 4# is homozygote.

The empty vector pBIN19 was transferred into wild type tomato M82 by the same method to obtain T₀Transferring the tomato with empty carrier, collecting seeds, sowing until T is obtained₂The empty carrier tomato is substituted. The relative expression level of the SlTOE1 gene is detected by the same method, and the result shows that T₂Compared with the wild tomato M82, the expression level of SlTOE1 in the leaves of the tomato with the empty vector has no significant difference.

Second, SlTOE1 gene-silenced transgenic tomato genetic control on flowering time and yield

The flowering time and yield determination test method is as follows:

in 2016, wild tomato M82 and T are cultured in Beijing and Shandong Taian, respectively₂Generation SlTOE 1RNAi transgenic tomato line 4# homozygous material (TOE1RNAi-4) and T₂Transferring empty carrier tomatoes and simultaneously growing seedlings in 32-hole plug trays in a greenhouse, wherein half of the empty carrier tomatoes are respectively cultured in each plug tray at 25 ℃ for 20 days under 16h illumination/8 h dark condition. 20 seedlings with consistent growth vigor are selected and transplanted into a greenhouse, the plant spacing and the row spacing are more than 60cm, and the two materials are randomly distributed. Normal water and fertilizer management ensures that the water and fertilizer conditions of all plants are basically consistent. The plants are not forked and are allowed to grow naturally. The complete opening of the first flower of the first inflorescence is denoted as flowering, and the time from germination to flowering is the flowering time. And counting the number of leaves before the first-sequence flowers after the flowers bloom, wherein the smaller the number of leaves before the first-sequence flowers is, the earlier the flowering time is. Fruits were harvested after approximately 90% of the fruits turned red, and individual plant yields were measured and recorded by photography. By T₂Tomato with empty vector was used as control.

The results are shown in figures 1-4,

FIG. 1 shows the phenotypic results of early flowering of transgenic tomatoes with SlTOE1 gene silencing (A is field early flowering phenotype, B is plant flowering mode), and it can be seen that T is compared with wild tomato M82₂Generation SlTOE 1RNAi transgenic tomato line 4# homozygous material bloomed earlier (FIG. 1A), please teach, FIG. 1B shows that bloomes earlier and inflorescences are more dense.

FIG. 2 shows the statistical result of the flowering time of transgenic tomatoes with SlTOE1 gene silenced, wherein A is the number of leaves before first-sequenced flowers and B is the statistical result of the number of flowering plants, and it can be seen that T is compared with the wild tomato M82₂Generation SlTOE1 first of homozygous Material of RNAi transgenic tomato line # 4The number of leaves before flowering is small, and the number of flowering plants is increased, which indicates that T₂And generation SlTOE1 shows that the flowering time of the homozygous material of RNAi transgenic tomato line 4# is early.

FIG. 3 shows the results of yield determination of transgenic tomato with SlTOE1 gene silencing in Beijing, wherein A is the yield phenotype and B is the statistics of yield data, and it can be seen that T is compared with wild tomato M82₂Generation SlTOE 1RNAi transgenic tomato line 4# homozygous material increased yield in Beijing.

FIG. 4 shows the results of Takara yield determination of transgenic tomato with SlTOE1 gene silencing, wherein A is the yield phenotype and B is the statistics of yield data, and it can be seen that T is compared with wild tomato M82₂Generation SlTOE 1RNAi transgenic tomato line 4# homozygous material increased yield in Taian.

Wild type tomatoes M82 and T₂The results of the tomato with the empty vector are not obviously different.

The above results indicate that SlTOE1 gene silencing can improve yield and promote flowering.

Sequence listing

<110> institute of genetics and developmental biology of Chinese academy of sciences

Application of <120> SlTOE1 gene in regulation and control of flowering time and yield of tomatoes

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 1425

<212> DNA

<213> tomato (Solanum lycopersicum)

<400> 1

atgttggatc tcaatgtaag cgtaatctac aataatgacc ttccacaagt ttctctactt 60

gatgaatcag ccacctccaa ttcatcctta cgaaatgcgg aagctacaac cagtgccggt 120

gacgaagatt cgtgcgccgg tgagttgttc gctttcaatt ttggaatcct caaagttgaa 180

ggagctgaga ctagtaggag cagcaacaac gatgatgagg aaggatacgg taagaatcag 240

agagttactc attctcaatt cgtgactagg cagctgtttc ccgttgatga tggtgagttg 300

aaccggaaac aaaccgatcg ggtcattctc tcctccgctc gatccggtac ttctatcggt 360

tttggagatg tgcggataat acaacagcaa caaacggagc aaccgaaaca acaagtgaag 420

aagagtagga gaggcccaag gtcaagaagt tcacagtaca gaggtgtcac tttctaccgt 480

agaactggta gatgggaatc acatatatgg gactgtggga aacaagtata tttgggtggt 540

tttgatactg ctcacacagc agcaagagct tatgacagag ctgcaattaa atttaggggt 600

gttgatgctg atatcaactt tagcttaagt gattacgagg aggatatgca acagatgaaa 660

aaccttggta aagaagaatt tgtgcacttg ctgcgacgcc atagcactgg tttctcaaga 720

gggagctcca aattcagagg agtgacgcta cataaatgtg gcagatggga ggctcggatg 780

ggacagttcc tcgggaaaaa gtatatatat cttgggctgt tcgacagcga agtagaagct 840

gcaagggcct acgataaggc ggcaattaaa actagcggaa gggaagctgt taccaacttt 900

gagccaagta gctatgaagg ggaaacaatg tctttaccac agagtgaagg tagccaacat 960

gatcttgatc tgaacttggg gatatcgacc acttcttcaa aggaaaatga caggttggga 1020

ggttctcgct atcatcctta cgatatgcaa gacgcaacaa aacctaagat ggataaacct 1080

ggttcagtaa tagttggaag ttcacatctc aagggactac caatgtcgtc ccaacaagct 1140

caattgtgga ctggaatcta ttctaatttc tcttccagct atgagggaag agcatatgac 1200

aagagaaagg acacaggttc atcacaagga cctccaaatt gggcactgca aatgcctagt 1260

caggttgata caaacagccc attgacaatg ttctgcacgg cagcatcatc aggattcttc 1320

attccatcta ctacttctat cacttcatca acatctgcat tagcaacttc aacaaatgcc 1380

tcgcagtgct tttaccagat taatccccgc ctaccacttc cataa 1425

<210> 2

<211> 474

<212> PRT

<213> tomato (Solanum lycopersicum)

<400> 2

Met Leu Asp Leu Asn Val Ser Val Ile Tyr Asn Asn Asp Leu Pro Gln

1 5 10 15

Val Ser Leu Leu Asp Glu Ser Ala Thr Ser Asn Ser Ser Leu Arg Asn

20 25 30

Ala Glu Ala Thr Thr Ser Ala Gly Asp Glu Asp Ser Cys Ala Gly Glu

35 40 45

Leu Phe Ala Phe Asn Phe Gly Ile Leu Lys Val Glu Gly Ala Glu Thr

50 55 60

Ser Arg Ser Ser Asn Asn Asp Asp Glu Glu Gly Tyr Gly Lys Asn Gln

65 70 75 80

Arg Val Thr His Ser Gln Phe Val Thr Arg Gln Leu Phe Pro Val Asp

85 90 95

Asp Gly Glu Leu Asn Arg Lys Gln Thr Asp Arg Val Ile Leu Ser Ser

100 105 110

Ala Arg Ser Gly Thr Ser Ile Gly Phe Gly Asp Val Arg Ile Ile Gln

115 120 125

Gln Gln Gln Thr Glu Gln Pro Lys Gln Gln Val Lys Lys Ser Arg Arg

130 135 140

Gly Pro Arg Ser Arg Ser Ser Gln Tyr Arg Gly Val Thr Phe Tyr Arg

145 150 155 160

Arg Thr Gly Arg Trp Glu Ser His Ile Trp Asp Cys Gly Lys Gln Val

165 170 175

Tyr Leu Gly Gly Phe Asp Thr Ala His Thr Ala Ala Arg Ala Tyr Asp

180 185 190

Arg Ala Ala Ile Lys Phe Arg Gly Val Asp Ala Asp Ile Asn Phe Ser

195 200 205

Leu Ser Asp Tyr Glu Glu Asp Met Gln Gln Met Lys Asn Leu Gly Lys

210 215 220

Glu Glu Phe Val His Leu Leu Arg Arg His Ser Thr Gly Phe Ser Arg

225 230 235 240

Gly Ser Ser Lys Phe Arg Gly Val Thr Leu His Lys Cys Gly Arg Trp

245 250 255

Glu Ala Arg Met Gly Gln Phe Leu Gly Lys Lys Tyr Ile Tyr Leu Gly

260 265 270

Leu Phe Asp Ser Glu Val Glu Ala Ala Arg Ala Tyr Asp Lys Ala Ala

275 280 285

Ile Lys Thr Ser Gly Arg Glu Ala Val Thr Asn Phe Glu Pro Ser Ser

290 295 300

Tyr Glu Gly Glu Thr Met Ser Leu Pro Gln Ser Glu Gly Ser Gln His

305 310 315 320

Asp Leu Asp Leu Asn Leu Gly Ile Ser Thr Thr Ser Ser Lys Glu Asn

325 330 335

Asp Arg Leu Gly Gly Ser Arg Tyr His Pro Tyr Asp Met Gln Asp Ala

340 345 350

Thr Lys Pro Lys Met Asp Lys Pro Gly Ser Val Ile Val Gly Ser Ser

355 360 365

His Leu Lys Gly Leu Pro Met Ser Ser Gln Gln Ala Gln Leu Trp Thr

370 375 380

Gly Ile Tyr Ser Asn Phe Ser Ser Ser Tyr Glu Gly Arg Ala Tyr Asp

385 390 395 400

Lys Arg Lys Asp Thr Gly Ser Ser Gln Gly Pro Pro Asn Trp Ala Leu

405 410 415

Gln Met Pro Ser Gln Val Asp Thr Asn Ser Pro Leu Thr Met Phe Cys

420 425 430

Thr Ala Ala Ser Ser Gly Phe Phe Ile Pro Ser Thr Thr Ser Ile Thr

435 440 445

Ser Ser Thr Ser Ala Leu Ala Thr Ser Thr Asn Ala Ser Gln Cys Phe

450 455 460

Tyr Gln Ile Asn Pro Arg Leu Pro Leu Pro

465 470

<210> 3

<211> 3917

<212> DNA

<213> tomato (Solanum lycopersicum)

<400> 3

gtcgagcggc cgctcgacga attaattcca atcccacaaa aatctgagct taacagcaca 60

gttgctcctc tcagagcaga atcgggtatt caacaccctc atatcaacta ctacgttgtg 120

tataacggtc cacatgccgg tatatacgat gactggggtt gtacaaaggc ggcaacaaac 180

ggcgttcccg gagttgcaca caagaaattt gccactatta cagaggcaag agcagcagct 240

gacgcgtaca caacaagtca gcaaacagac aggttgaact tcatccccaa aggagaagct 300

caactcaagc ccaagagctt tgctaaggcc ctaacaagcc caccaaagca aaaagcccac 360

tggctcacgc taggaaccaa aaggcccagc agtgatccag ccccaaaaga gatctccttt 420

gccccggaga ttacaatgga cgatttcctc tatctttacg atctaggaag gaagttcgaa 480

ggtgaaggtg acgacactat gttcaccact gataatgaga aggttagcct cttcaatttc 540

agaaagaatg ctgacccaca gatggttaga gaggcctacg cagcaggtct catcaagacg 600

atctacccga gtaacaatct ccaggagatc aaataccttc ccaagaaggt taaagatgca 660

gtcaaaagat tcaggactaa ttgcatcaag aacacagaga aagacatatt tctcaagatc 720

agaagtacta ttccagtatg gacgattcaa ggcttgcttc ataaaccaag gcaagtaata 780

gagattggag tctctaaaaa ggtagttcct actgaatcta aggccatgca tggagtctaa 840

gattcaaatc gaggatctaa cagaactcgc cgtgaagact ggcgaacagt tcatacagag 900

tcttttacga ctcaatgaca agaagaaaat cttcgtcaac atggtggagc acgacactct 960

ggtctactcc aaaaatgtca aagatacagt ctcagaagac caaagggcta ttgagacttt 1020

tcaacaaagg ataatttcgg gaaacctcct cggattccat tgcccagcta tctgtcactt 1080

catcgaaagg acagtagaaa aggaaggtgg ctcctacaaa tgccatcatt gcgataaagg 1140

aaaggctatc attcaagatc tctctgccga cagtggtccc aaagatggac ccccacccac 1200

gaggagcatc gtggaaaaag aagacgttcc aaccacgtct tcaaagcaag tggattgatg 1260

tgacatctcc actgacgtaa gggatgacgc acaatcccac tatccttcgc aagacccttc 1320

ctctatataa ggaagttcat ttcatttgga gaggacacgc tcgagacgat gatgaggaag 1380

gatacggtaa gaatcagaga gttactcatt ctcaattcgt gactaggcag ctgtttcccg 1440

ttgatgatgg tgagttgaac cggaaacaaa ccgatcgggt cattctctcc tccgctcgat 1500

ccggtacttc tatcggtttt ggagatgtgc ggataataca acagcaacaa acggagcaac 1560

cgaaacaaca agtgaagaag agtaggagag gcccaaggtc aagaagttca cagtacagag 1620

gtgtcacttt ctaccgtaga actggtagat gggaatcaca tatatgggac tgtgggaaac 1680

aagtatattt gggtggtttt gatactgctc acacagcagc aagagcttat gacagagctg 1740

caattaaatt taggggtgtt gatgctgata tcaactttag cttaagtgat tacgaggagg 1800

atatgcaaca gatgaaaaac cttggtaaag aagaatttgt gcacttgctg cgacgccata 1860

gcactggtac cccaattggt aaggaaataa ttattttctt ttttcctttt agtataaaat 1920

agttaagtga tgttaattag tatgattata ataatatagt tgttataatt gtgaaaaaat 1980

aatttataaa tatattgttt acataaacaa catagtaatg taaaaaaata tgacaagtga 2040

tgtgtaagac gaagaagata aaagttgaga gtaagtatat tatttttaat gaatttgatc 2100

gaacatgtaa gatgatatac tagcattaat atttgtttta atcataatag taattctagc 2160

tggtttgatg aattaaatat caatgataaa atactatagt aaaaataaga ataaataaat 2220

taaaataata tttttttatg attaatagtt tattatataa ttaaatatct ataccattac 2280

taaatatttt agtttaaaag ttaataaata ttttgttaga aattccaatc tgcttgtaat 2340

ttatcaataa acaaaatatt aaataacaag ctaaagtaac aaataatatc aaactaatag 2400

aaacagtaat ctaatgtaac aaaacataat ctaatgctaa tataacaaag cgcaagatct 2460

atcattttat atagtattat tttcaatcaa cattcttatt aatttctaaa taatacttgt 2520

agttttatta acttctaaat ggattgacta ttaattaaat gaattagtcg aacatgaata 2580

aacaaggtaa catgatagat catgtcattg tgttatcatt gatcttacat ttggattgat 2640

tacagttggg aaattgggtt cgaaatcgat aagcttagtg ctatggcgtc gcagcaagtg 2700

cacaaattct tctttaccaa ggtttttcat ctgttgcata tcctcctcgt aatcacttaa 2760

gctaaagttg atatcagcat caacacccct aaatttaatt gcagctctgt cataagctct 2820

tgctgctgtg tgagcagtat caaaaccacc caaatatact tgtttcccac agtcccatat 2880

atgtgattcc catctaccag ttctacggta gaaagtgaca cctctgtact gtgaacttct 2940

tgaccttggg cctctcctac tcttcttcac ttgttgtttc ggttgctccg tttgttgctg 3000

ttgtattatc cgcacatctc caaaaccgat agaagtaccg gatcgagcgg aggagagaat 3060

gacccgatcg gtttgtttcc ggttcaactc accatcatca acgggaaaca gctgcctagt 3120

cacgaattga gaatgagtaa ctctctgatt cttaccgtat ccttcctcat catcgttcta 3180

gagtcctgct ttaatgagat atgcgagacg cctatgatcg catgatattt gctttcaatt 3240

ctgttgtgca cgttgtaaaa aacctgagca tgtgtagctc agatccttac cgccggtttc 3300

ggttcattct aatgaatata tcacccgtta ctatcgtatt tttatgaata atattctccg 3360

ttcaatttac tgattgtacc ctactactta tatgtacaat attaaaatga aaacaatata 3420

ttgtgctgaa taggtttata gcgacatcta tgatagagcg ccacaataac aaacaattgc 3480

gttttattat tacaaatcca attttaaaaa aagcggcaga accggtcaaa cctaaaagac 3540

tgattacata aatcttattc aaatttcaaa aggccccagg ggctagtatc tacgacacac 3600

cgagcggcga actaataacg ttcactgaag ggaactccgg ttccccgccg gcgcgcatgg 3660

gtgagattcc ttgaagttga gtattggccg tccgctctac cgaaagttac gggcaccatt 3720

caacccggtc cagcacggcg gccgggtaac cgacttgctg ccccgagaat tatgcagcat 3780

ttttttggtg tatgtgggcc ccaaatgaag tgcaggtcaa accttgacag tgacgacaaa 3840

tcgttgggcg ggtccagggc gaattttgcg acaacatgtc gaggctcagc aggacctgca 3900

ggcatgcaag ctagctt 3917

Claims

1. The application of a substance for inhibiting or silencing the expression of a protein SlTOE1 gene in improving the yield of tomatoes;

the substance for inhibiting or silencing the expression of the SlTOE1 gene is a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing a DNA fragment;

the protein SlTOE1 is a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table;

the nucleotide sequence of the DNA fragment is sequence 3.

2. A method for cultivating transgenic tomato with improved yield comprises reducing or eliminating the content of protein SlTOE1 in target tomato to obtain transgenic tomato;

the transgenic tomato has at least one of the following 1) and 2):

1) the yield of the transgenic tomato is higher than that of the target tomato;

2) the flowering time of the transgenic tomato is earlier than that of the target tomato;

the protein SlTOE1 is a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table.

3. The method of claim 2, wherein:

the method for reducing or eliminating is to inhibit or silence the expression of the SlTOE1 gene, a protein in tomato of interest;

the method for inhibiting or silencing the expression of the target tomato protein SlTOE1 gene specifically comprises the steps of introducing the DNA segment in claim 1 into a target tomato to obtain a transgenic tomato;

or the inhibition or silencing of the expression of the target tomato protein SlTOE1 gene is to introduce the DNA segment in claim 1 into a target tomato through the recombinant vector in claim 1 to obtain a transgenic tomato.