CN111304222B - Cymbidium CgWRKY11 gene and application thereof - Google Patents

Abstract

The invention discloses a Chinese cymbidiumCgWRKY11A coding gene and an application thereof,CgWRKY11the nucleotide sequence of the gene is shown as SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown as SEQ ID NO. 2. The invention relates to a cymbidium goeringii cultivated variety 'Songmei'CgWRKY11Cloning and identification of genes, analysis of gene expression, and verification of their function, discoveryCgWRKY11At the seedling stage, compared with the wild arabidopsis WT,CgWRKY11the whole plant is short and weak, the growth vigor is the weakest, the plant is shown to be small in leaf, the leaf is slightly yellow and has the tendency of premature senility, the vegetative growth period is prolonged, the gene is proved to possibly inhibit the vegetative growth of the plant, the vegetative growth is caused to be lack, the flowering is delayed, and the gene is seen to possibly have wide application in the aspect of orchid character improvement.

Description

CgWRKY11 gene of cymbidium goeringii and application thereof

Technical Field

The invention belongs toThe technical field of plant genetic engineering, in particular to cymbidium goeringiiCgWRKY11Genes and their use.

Background

The orchid family (Orchidaceae) is one of the largest of flowering plants, and contains 25000 varieties worldwide, accounting for about 10% of all flowering plants. Goering cymbidium (A. fern)Cymbidium goeringii) Belongs to the species of floret type Geshenlan in orchid family, and has peculiar flower type, light flower color, delicate flower fragrance, beautiful leaf appearance and high ornamental value and economic value. The cymbidium goeringii has high requirements on the growth environment, is very easily influenced by severe environments such as high temperature, low temperature, drought and the like in the growth process, and can cause the reduction of the ornamental quality of gardening and even the death of plants in severe cases. Therefore, the research on the molecular mechanism of plants for coping with abiotic stress and the identification of genes with stress resistance function are of great significance to the breeding and production of cymbidium goeringii. In a plant cell signal transduction pathway, the WRKY transcription factor is considered as a key pivot of plant growth and various stress responses, and provides an important basis for genetic improvement of plants.

WRKY transcription factors are one of the largest families of regulatory proteins in plants, involved in a variety of physiological processes, the most prominent of which are stress responses to biotic and abiotic stresses. The WRKY gene is reported to enhance the tolerance of plants to adversity stress. The sunflower HaWRKY76 transgenic plant shows stronger stress resistance to waterlogging stress, and the yield is also obviously increased.AtWRKY25The overexpression of (a) enhances the salt tolerance of Arabidopsis thaliana.AtWRKY57The over-expression in rice not only improves the drought resistance of rice, but also enhances the tolerance of the rice to salt and PEG. Therefore, it is obtained by cloning from cymbidium goeringii by using genetic engineering technologyCgWRKY11The gene has obvious expression difference under ABA stress, so the gene will be expressedCgWRKY11The gene is transferred into plants, and has great application prospect.

Different plants have different gene sequences even if they are of the same gene family, and even if more than 80% of the gene sequences are identical, the functions of transferring some genes into plants are different because of different insertion sites. When a foreign gene enters a chromosome, a foreign protein encoded by the gene is generated, the foreign protein or enzyme causes the activity of other enzymes or proteins to be enhanced or reduced through a series of reactions, and when the foreign gene is embedded in a certain segment of the chromosome, the whole chromosome is influenced, so that the activity or the regulation mechanism of other genes is influenced.

Even if the same gene is inserted, the same gene is inevitably influenced on the chromosome due to different insertion sites or different chromosome groups, and further influences the gene on the chromosome, and slight changes of the gene can influence the regulation mechanism, so that the changes of gene inactivation, activity reduction, activity enhancement and the like can be caused, and the gene action is different, and the gene action can be obtained only by verification and can not be obtained by inference.

Disclosure of Invention

The purpose of the invention is as follows: aiming at the defects in the prior breeding technology, the invention aims to provide the cymbidium goeringiiCgWRKY11A gene. Another object of the present invention is to provide cymbidium goeringiiCgWRKY11The application of the gene in orchid breeding.

The technical scheme is as follows: in order to achieve the purpose of the invention, the technical scheme adopted by the invention is as follows:

a kind of Chinese cymbidiumCgWRKY11The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

The cymbidium goeringiiCgWRKY11The amino acid sequence of the gene expression protein is shown in SEQ ID NO. 2.

The Chinese cymbidiumCgWRKY11The use of genes in plant production and breeding.

Contains the cymbidium goeringiiCgWRKY11A vector for the gene.

Contains the Chinese cymbidiumCgWRKY11A host cell for the gene.

Has the advantages that: compared with the prior art, the invention has the advantages that the cymbidium goeringii is treatedCgWRKY11Cloning and identification of gene, expression analysis of gene, verification of its function, finding over-expressionCgWRKY11In the seedling stage, the transgenic Arabidopsis plants are compared with wild type Arabidopsis WT and wild type Arabidopsis WT,CgWRKY11plant integral shortThe gene has small size and weakest growth vigor, shows that the leaf is small, the leaf is slightly yellow and has the tendency of premature senility, the vegetative growth cycle is prolonged, and the gene has wide application in the production and breeding of orchids and other plants.

Drawings

FIG. 1 is cymbidium goeringiiCgWRKY11Gene cloning and constructed over-expression vector map;

FIG. 2a is a drawingCgWRKY11Expression in cymbidium goeringii tissues, wherein R represents roots, P represents pseudobulbs, L represents leaves, and F represents flowers; panel b is cymbidium under ABA stressCgWRKY11The expression of the gene;

FIG. 3a is a diagram showing the results of enzyme digestion, wherein M: DL2000 Marker;CgWRKY11after being linked with pBI121XbaIAndSnaBIdouble enzyme digestion; panel b is a screening panel for positive recombinants, where M: DL2000 Marker, the size of the target band is 996 bp;

FIG. 4 is a plot of the PCR results of transgenic Arabidopsis plants, where M: DL2000 Marker; 1: taking vector plasmid DNA as a positive control; 2: wild type DNA is negative control;

FIG. 5 is a view of a rotary tableCgWRKY11The plant types of the gene plant and the wild type arabidopsis thaliana plant are compared, wherein WT and the wild type arabidopsis thaliana are shown in the figure; 11, turn toCgWRKY11Different strains of genes;

FIG. 6 is a view of a rotary tableCgWRKY11The expression quantity of the gene plant and the wild type arabidopsis thaliana under the stress of ABA;

FIG. 7 is a view of a rotary drumCgWRKY11The root length variation graph of the gene plant; WT: common wild type Arabidopsis thaliana; the abscissa represents the gene number; the ordinate represents the root length (cm); concentration units of ABA (. mu.M).

Detailed Description

The present invention will be further described with reference to the following specific examples.

Example 1

The material used in this example was the "songmei" leaf of cymbidium goeringii, which was snap frozen in liquid nitrogen after harvesting and stored in an ultra-low temperature freezer (-80 ℃).

1) Extraction of total RNA from cymbidium goeringii leaves

The method is carried out according to the instruction of a TaKaRa plant total RNA extraction kit, and comprises the following specific operations:

rapidly transferring the frozen cymbidium goeringii leaves at ultralow temperature to a mortar precooled by liquid nitrogen, grinding tissues by a pestle, and continuously adding the liquid nitrogen until the tissues are ground into powder; adding the sample ground into powder into 1.5mL of sterilized tube containing 450 μ l of Buffer PE, and repeatedly blowing and beating by using a pipette until no obvious precipitate exists in the lysate; the lysate is centrifuged at 12,000 rpm for 5min at 4 ℃; the supernatant was carefully pipetted into a fresh 1.5mL sterile tube. Adding 1/10 volumes of Buffer NB into the supernatant, Vortex mixing, centrifuging at 12,000 rpm at 4 ℃ for 5 min; carefully sucking the supernatant into a new 1.5mL sterilized tube, adding 450. mu.L Buffer RL, and uniformly mixing the solution by using a pipette; adding anhydrous ethanol with the volume of 1/2 mixed solution, uniformly mixing the solution by using a liquid-transferring gun, and immediately transferring the mixed solution into an RNA Spin Column; centrifuging at 12,000 rpm for 1min, discarding the filtrate, and returning the RNA Spin Column to 2ml Collection Tube; add 500. mu.L of Buffer RWA into RNA Spin Column, centrifuge at 12,000 rpm for 30s, discard the filtrate; 600 μ L of Buffer RWB was added to the RNA Spin Column, centrifuged at 12,000 rpm for 30s, and the filtrate was discarded; adding 50 mu L of DNase I reaction solution into the center of an RNA Spin Column membrane, and standing for 15min at room temperature; adding 350 mu L of Buffer RWB to the center of an RNA Spin Column membrane, centrifuging at 12,000 rpm for 30s, and discarding the filtrate; the RNA Spin Column was re-mounted on a 2mL Collection Tube and centrifuged at 12,000 rpm for 2 min; the RNA Spin Column was mounted on a 1.5mL RNase Free Collection Tube, and 50. mu.L of RNase Free dH was added to the center of the RNA Spin Column membrane₂O is left to stand at room temperature for 5min and centrifuged at 12,000 rpm for 2min to elute RNA. The obtained RNA is stored in a refrigerator at the temperature of minus 80 ℃ for standby after concentration and purity detection.

The result of taking 2. mu.L of RNA and detecting by 1% agarose gel electrophoresis shows that 28S and 18S bands are clearer, the brightness of the 28S band is about twice of that of the 18S band, and the RNA quality is better. Detection of RNA purity, OD by means of a micro-accounting protein assay₂₆₀/OD₂₈₀Is 2.05, OD₂₆₀/OD₂₃₀2.03, better integrity, can be used for reverse transcription.

2) Synthesis of first Strand cDNA

The total RNA obtained was used as a template, reverse transcription was performed using a TaKaRa reverse transcription kit, and oligo (dT) was used as an anchor primer, and first strand cDNA was synthesized by reverse transcription. The specific operation is as follows:

the following template RNA/primer mixture was prepared in the order of 10. mu.L: mu.g template, 1. mu.L oligo (dT) Primer (50. mu.M), 1. mu.L dNTP mix (10mM each), and the remaining volume with RNase-free ddH₂And (4) supplementing and finishing. Keeping the temperature at 65 ℃ for 5min, and then rapidly cooling on ice; the tube was centrifuged to allow the mixture to settle to the bottom of the tube. Prepare reverse transcription reaction solution (20 μ L) in a new centrifuge tube: the above denatured reaction solution was 10. mu.L, 5 XPrimeScript Buffer 4. mu.L, RNase Inhibitor (40U/. mu.L) 0.5. mu.L, PrimeScript RTase (200U/. mu.L) 1. mu.L, RNase Free dH₂The total amount of O is 20 mu L. Slowly shaking, keeping the temperature on a PCR instrument for 10min at 30 ℃, 30min at 42 ℃ and 5min at 95 ℃ to inactivate the enzyme, and placing on ice to obtain the cDNA solution.

3) Design and cloning of target gene primer

Based on existing sequencing data for the cymbidium transcriptome, using other speciesWRKYBlast homology alignment is carried out on related gene sequences. Corresponding primers are designed by utilizing Oligo6.0 and Prime5.0, and the sequences of the primers are as follows:

CgWRKY11-F：5'- ATGGCAGTTGATCTAATCGGCTA -3'，

CgWRKY11-R：5'- TCAGATCTGGCGATGGGTGT -3'。

performing cymbidium goeringii by using PrimerStar Max high fidelity enzyme by using cDNA first strand as templateCgWRKY11Cloning of the gene. The PCR amplification system (50. mu.L) was: mu.l PrimerStar Max, 2. mu.l Forward Primer, 2. mu.l Reverse Primer, 2. mu.l Template DNA, 19. mu.l ddH₂And O. The PCR procedure was: the reaction conditions are pre-denaturation at 94 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 5s, extension at 72 ℃ for 30s, 32 cycles, total extension at 72 ℃ for 5min and heat preservation at 16 ℃.

After the PCR reaction is finished, all PCR products are taken to be detected and cut into target fragments through 1.5 percent agarose gel electrophoresis, and the target PCR amplification products are recovered and purified through gel. DNA gel recovery kit adopting Tiangen corporationAnd carrying out purification and recovery on the target fragment, and specifically operating as follows: adding 500 μ L of balance liquid BL into adsorption column CA2 (placing adsorption column into collection tube), centrifuging at 12000rpm for 1min, pouring off waste liquid in the collection tube, and placing adsorption column back into the collection tube; cutting a single target strip from the agarose gel, putting the cut single target strip into a clean centrifugal tube, and weighing the cut single target strip; adding equal volume of solution PN (if the gel is 0.1g, the volume can be regarded as 100 μ L, then 100 μ L of PN solution) into the gel block, placing in a water bath at 50 ℃, and continuously and gently turning the centrifugal tube up and down until the gel block is completely dissolved; adding the solution obtained in the previous step into an adsorption column CA2, standing at room temperature for 2min, centrifuging at 12000rpm for 1min, pouring off waste liquid in the collection tube, and placing adsorption column CA2 into the collection tube; adding 600 μ L of rinsing liquid W into adsorption column CA2, centrifuging at 12000rpm for 1min, pouring off waste liquid in the collection tube, and placing the adsorption column back into the collection tube; centrifuging at 12000rpm for 2min, removing rinsing solution as much as possible, standing the adsorption column at room temperature for 5min, and air drying completely; placing the adsorption column into a clean centrifuge tube, suspending and dropwise adding 30 μ L ddH to the middle position of the adsorption film₂O, standing at room temperature for 2min, and centrifuging at 12000rpm for 2min to collect the DNA solution. The purified product was recovered in 2. mu.L, and detected by gel electrophoresis using 1% agarose.

4) Ligation of the fragment of interest to the vector

The cloning vector is pEASY-Blunt vector of the whole formula gold company, and the ligation reaction is carried out, wherein the ligation system (5 mu L): mu.L of the PCR-purified product, 1. mu.L of pEASY-Blunt Vector, was gently pipetted and mixed, and then left at room temperature for 5min, and the centrifuge tube was placed on ice.

5) Conversion of ligation products

Competent cell Trans5 α strain was removed from the ultra-low temperature refrigerator and thawed on ice. Pipette 5. mu.L of overnight ligation into 100. mu.L of competent cells; placing the centrifugal tube on ice for ice bath for 30 min; heating in water bath at 42 deg.C for 90 s without shaking; immediately placing on ice for ice bath for 2 min; adding 800 μ L of liquid culture medium without antibiotics into a super clean bench, and resuscitating at 37 deg.C under shaking at 180 rpm for 1 h; centrifuging at 4000 rpm for 3min, and sucking 800 μ L of supernatant; the precipitated cells were resuspended, plated on LB plates (Amp concentration: 100 mg/L), and cultured overnight at 37 ℃.

6) Screening and verification of recombinant plasmids

A single colony grown overnight on LB solid medium containing an antibiotic (Amp) was picked and inoculated into 750. mu.L of LB liquid medium containing the same antibiotic. 200 rpm, 37 ℃ overnight culture.

The PCR amplification system is as follows: 10uL Green TaqMix, 1 mu L M13-F/R, 1 mu L bacterial liquid, 7 mu L ddH₂O was supplemented to 20. mu.L.

The PCR procedure was: 10min at 94 ℃; 30 cycles at 94 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 1 min; 5min at 72 ℃; at 16 ℃ forever.

And sucking 5 muL of PCR products for agarose gel electrophoresis detection analysis. After verification, the bacterial liquid sample with the correct strip size is subjected to sequencing by Nanjing Kingsrey Biotech Co., Ltd, and the sequencing primer is the universal primer M13F/R. The sequencing results were analyzed by alignment at the NCBI.

According to the analysis of the sequencing result, 1 cymbidium can be finally obtained by determining the cloneWRKYThe coding gene is namedCgWRKY11The nucleotide sequence of the gene is shown as SEQ ID NO.1,CgWRKY11the gene coding length is 996bp, the ATG start codon and the TGA stop codon are contained, wherein the ORF total length is 996bp, 331 amino acid proteins are coded, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.

Example 2

The research result shows thatWRKY11The gene is expressed in various tissues and organs in cymbidium (FIG. 2 a), but the expression level of the gene is the highest in cymbidium, which indicates that the gene is active in flower function. Expression analysis of cymbidium ABA stress treated leaves (FIG. 2 b) demonstratedCgWRKY11The gene plays an important regulation role in the ABA stress response of the cymbidium goeringii leaves.

The plant material used in this example was Arabidopsis thaliana (Arabidopsis thaliana) Col (Columbia) wild type seeds.

The E.coli strain used in this example was Trans5 α; the agrobacterium strains are GV3101 and are respectively used for transforming arabidopsis; the plant expression vector used in the experiments was pBI 121. The strains used were purchased from holotype gold and prism, respectively.

1）CgWRKY11Construction of Gene overexpression vectors

Obtained in example 1CgWRKY11The full-length sequence of the gene ORF is connected with a plant expression vector pBI121, and the constructed vector is shown in figure 1.

2) And (3) plasmid extraction:

extracting plasmids according to the specification of the small-extraction medium-volume kit of the Tiangen plasmids, and specifically comprising the following steps:

taking 10mL of overnight cultured bacterial liquid, centrifuging at 12000rpm for 1min, and removing supernatant; adding 500 mu L P1 solution (containing RNase A) into a centrifuge tube with the thallus precipitate, and completely suspending the thallus precipitate by using a vortex apparatus; adding 500 mu L P2 solution into a centrifuge tube, carrying out full thallus lysis when the centrifuge tube is turned up and down gently, adding 700 mu L P3 solution into the centrifuge tube, immediately turning the centrifuge tube up and down gently, mixing the solution fully and evenly, and centrifuging the mixture at 12000rpm for 10min when white flocculent precipitate appears; adding 500 μ L of equilibrium liquid BL into adsorption column CP4, centrifuging at 12000rpm for 1min, discarding waste liquid in the collection tube, returning the adsorption column to the collection tube, adding collected supernatant into filtration column CS in batches, centrifuging at 12000rpm for 2min, carefully adding solution collected in the collection tube into adsorption column CP4 in batches, centrifuging at 12000rpm for 1min, discarding waste liquid in the collection tube, and returning adsorption column CP4 to the collection tube; adding 500 μ L deproteinized solution PD into adsorption column CP4, centrifuging at 12000rpm for 1min, discarding waste liquid in the collection tube, and replacing adsorption column CP4 into the collection tube; adding 600 μ l rinsing solution PW (containing anhydrous ethanol) into adsorption column CP4, centrifuging at 12000rpm for 1min, discarding waste liquid in the collection tube, placing adsorption column CP4 back into the collection tube, centrifuging at 12000rpm for 2min, and removing residual rinsing solution in the adsorption column; the adsorption column CP4 was transferred to a new 1.5ml centrifuge tube, and 60. mu.L ddH was added to the middle of the adsorption membrane₂O; standing at room temperature for 2min, centrifuging at 12000rpm for 1min, and collecting the solution in the centrifuge tube as plasmid. Finally, the plasmid concentration was determined and prepared for the next experiment.

3) Addition of specific cleavage sites

cDNA is taken as a template, and specific enzyme cutting sites are added on two sides of a target gene by a PCR method. Spring made of Chinese herbal medicineBlueCgWRKY11XbaI and SnaBI cleavage sites are added on both sides of the gene. The PCR reaction system, procedure and primers used were as follows:

PCR amplification System (50. mu.L): 25 μ L PrimerStar Max, 2 μ L Forward Primer, 2 μ L Reverse Primer, 2 μ L Template DNA, 19 μ L ddH₂And O. The PCR procedure was: the reaction conditions are pre-denaturation at 94 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 5s, extension at 72 ℃ for 30s, 32 cycles, total extension at 72 ℃ for 5min and heat preservation at 16 ℃.

The primer sequences used were:

CgWRKY11-XbaI-F：5'-GAGAACACGGGGGACTCTAGAATGGCAGTTGATCTAATCGGCT -3'，

CgWRKY11-SnaBI-R：5'- TCACACAAACGGTGATACGTAGATCTGGCGATGGGTGTCG-3'。

the obtained PCR product was separated by 1.5% agarose gel electrophoresis, recovered and purified using a Tiangen agarose gel DNA recovery kit, and the recovered product was ligated with the pBI121 vector to construct an expression vector.

4) Double enzyme digestion reaction

The extracted pBI121 plasmid is digested by XbaI and SnaBI at 37 ℃ for 15min, and the linear vector is recovered by electrophoresis and stored at-20 ℃ for later use. The double enzyme digestion reaction system is 50 mu L: pBI121 plasmid 20. mu.L, 5 XBuffer 5. mu.L, XbaI 1. mu.L, SnaBI 1. mu.L, ddH₂O23. mu.L. The cleavage result is shown in FIG. 3a, wherein M: DL2000 Marker; 1:CgWRKY11after ligation with pBI121, the DNA fragment was digested simultaneously with XbaI and SnaBI.

5) Ligation reaction

Agarose gel electrophoresis is used for detecting the target gene and the vector pBI121 recovered after enzyme digestion, and reagents are added according to a connection system according to the detected purity and concentration. Wherein, the number of target fragment molecules is: the number of carrier molecules =3:1-5:1, and the connection reaction system is as follows: the pBI121 vector was linearized in 7. mu.L, the insert was 3. mu.L, 5 × CE II buffer 4. mu.L, Exnase II 2. mu.L, ddH2O Up to 20. mu.L. Reacting at 37 deg.C for 30min, cooling on ice.

6) Transfer of the ligation product into E.coli

The product of the ligation of the desired fragment with the vector pBI121 was transferred into E.coli Trans 5. alpha. competent cells in the same manner as in example 1.

7) Identification of recombinants

Single colonies on the plates were picked and inoculated into LB liquid medium containing antibiotic (kanamycin) and shake-cultured overnight at 37 ℃ at 200 rpm. The target gene full-length primer is used for bacterial liquid PCR to screen positive clones. The positive clones after screening were sequenced by Nanjing Kingsry. Meanwhile, extracting plasmids by using a Tiangen plasmid extraction kit, carrying out enzyme digestion verification, and judging whether the sizes of the fragments after enzyme digestion are consistent. As a result, as shown in FIG. 3b, the band size was 996bp as a result of PCR using the objective primer.

8) Preparation and transformation of Agrobacterium-infected competent cells

In the embodiment, agrobacterium GV3101 is used for preparing agrobacterium competence for carrying out an infection experiment of arabidopsis; the preparation process of the agrobacterium infection is as follows: selecting an activated agrobacterium single colony, inoculating the agrobacterium single colony in 5mL of liquid LB culture medium, and performing shake culture at 28 ℃ and 250 rpm for 20-24 h; sucking 2mL of the cell suspension, inoculating the cell suspension into a flask containing 50mL of liquid LB medium, shaking the cell suspension at 28 ℃ and 250 rpm to OD₆₀₀The value is about 0.8; placing the expanded bacterial solution on ice for ice bath for 30min, centrifuging at 4 ℃ and 5000 rpm for 5min, and removing the supernatant; 10mL of precooled 0.1 mo1/L CaCl was added₂A solution to fully suspend the precipitated bacteria; centrifuging at 4 deg.C and 5000 rpm for 5min, and discarding supernatant; 1mL of pre-cooled 20 mmo1/L CaCl was added₂The solution fully suspends the thalli to obtain GV3101 competent cells to be prepared, the competent cells are subpackaged into 100 mu L/tube by a centrifuge tube, 20% of sterile glycerol is rapidly added, and the competent cells are placed and stored at minus 80 ℃.

Agrobacterium transformation of recombinants: ice-bath is carried out to melt the agrobacterium tumefaciens competent cells, 1-5 mul of recovered and purified plasmid is added into 200 mul of agrobacterium tumefaciens competent cells, and the mixture is mixed gently and ice-bath is carried out for 30 min; quickly freezing with liquid nitrogen for l min, hot shocking in water bath at 37 deg.C for 1-5 min, and rapidly standing on ice for 1-2 min; adding 800 μ l LB culture medium without any antibiotic, and resuscitating at 28 deg.C and 100 rpm for 2-4 h; centrifuging at 4000 rpm for 3min, and sucking off part of the culture medium; mixing the rest bacteria solution with a pipette, and smearing on solid LB medium containing 50 mg/L kanamycin and 50 mg/L streptomycin (EHA 105) or 100 mg/L gentamicin (GV 3101); performing inverted culture at 28 deg.C for 30-48 h.

Identification of Agrobacterium recombinants: picking out single colony from the plate culture medium, and inoculating the single colony in a liquid culture medium containing corresponding antibiotics; culturing at 28 deg.C and 220 rpm overnight; carrying out PCR of the bacterial liquid by respectively matching 35S-F with the following primers, wherein the primer sequences are as follows:

35S-F：5'-GATAGTGGAAAAGGAAGGTG-3'，

35S-CgWRKY11-R：5'- TCACACAAACGGTGATACGTAGATCTGGCGATGGGTGTCG -3'。

detecting the PCR product by 1% agarose gel electrophoresis to identify whether the PCR product contains a target fragment; identifying positive clones, performing amplification culture, extracting plasmids by an alkaline lysis method, and performing double enzyme digestion verification; and adding a proper amount of sterile glycerol into the identified positive clone, and storing at-80 ℃ for later use.

9) Agrobacterium-mediated transformation of Arabidopsis thaliana

The method is characterized in that a target gene is transferred into arabidopsis thaliana by adopting an inflorescence infection method, and the specific operation method comprises the following steps: arabidopsis (col wild type) maintained healthy growth until flowering; activating the Agrobacterium EHA105 strain carrying the gene of interest. Picking a single colony, inoculating the single colony on 5mL LB culture medium containing kanamycin and streptomycin, shaking the colony at the speed of 250 rpm at the temperature of 28 ℃ until the bacterial liquid just turns turbid, and taking about 8-10 h; 1mL of bacterial liquid is sucked and inoculated into a triangular flask (50 mL) for shaking bacteria for 24 hours until the OD value is about 0.8; centrifuging the bacterial liquid at 5000 rpm at room temperature for 5min, removing supernatant, collecting thalli, and suspending with 5% sucrose solution; before soaking, adding Silwet L-77 with the concentration of 0.05% (500 mul/L), and shaking out foams; soaking the overground part of the arabidopsis in the agrobacterium suspension solution for 15-30 s, and gently shaking the overground part of the arabidopsis; laying the soaked arabidopsis thaliana in a tray, covering the tray with a preservative film, sealing the tray with tinfoil paper in the dark, and standing the tray for 24 hours at the temperature of 4 ℃; the tinfoil paper is uncovered, the culture is carried out under a normal condition, and watering is stopped when the seeds are mature.

The 5% sucrose solution resuspension had the following composition: adding 50g/L of sucrose, 0.5g/L of MES and Silwet-77500 mu L/L into an MS culture medium. (Note: after preparation, pH was adjusted to 5.8, and after centrifugation and resuspension of the bacterial solution, Silwet L-77 was added, and the conversion relationship between the resuspension solution and the bacterial solution was that the amount of the resuspension solution was OD of the bacterial solution volume =0.8 of the bacterial solution volume).

10) Screening of transgenic plants

The collected seeds of transgenic arabidopsis of T1 generation are sterilized by alcohol and mercuric chloride, and the steps are as follows: placing a proper amount of the obtained transgenic seeds in a 1.5mL centrifuge tube, and soaking the seeds in 75% alcohol for 30 s; sterilizing with 10% sodium hypochlorite for 2min and 30 s; washing with sterile water for 3-4 times, and replacing sterilized new centrifuge tube after the first washing; the suspension was made up in 0.1% agarose solution.

The sterilized transgenic Arabidopsis seeds were sown on 1/2MS solid medium containing antibiotics (kanamycin 50 mg/L and cefamycin 100 mg/L). Culturing at 22 deg.C under illumination. After about one week, Arabidopsis thaliana which can grow normally on the medium is transplanted into soil and continues to grow.

11) Detection of transgenic plants

Taking a proper amount of arabidopsis thaliana and young leaves of transgenic plants, and extracting DNA by adopting a CTAB method, wherein the specific operation steps are as follows: placing a proper amount of leaves in a sterilized 2mL centrifuge tube, adding 700 mul of CTAB solution, thoroughly grinding by using a ball mill, and standing for 10min at 65 ℃; equal volume of chloroform was added: inverting isoamyl alcohol several times to mix uniformly, and centrifuging at 14000 rpm for 10 min; transferring the supernatant into a new sterile centrifuge tube, adding isopropanol with the same volume, reversing and uniformly mixing for several times, standing at room temperature for 2min, centrifuging at 14000 rpm for 10min, and pouring off the supernatant; adding 70% anhydrous ethanol, blowing and washing twice by using a liquid transfer gun, centrifuging at 14000 rpm for 1min, and removing the supernatant; drying surface liquid, and adding 20 mu L ddH₂And dissolving the O. Taking the DNA of the above-mentioned extracted transgenic and wild type Arabidopsis thaliana, and usingCgWRKY11PCR detection is carried out by specific primers of the gene.

ChunlanCgWRKY11After gene transformation of Arabidopsis thaliana, overexpression is obtainedCgWRKY11A transgenic Arabidopsis line. The PCR results are shown in FIG. 4 with the recombinant plasmid as positive control, wild type as negative control, and water as blank control, and the positive control asCgWRKY11The result of gene carrier PCR, negative control using water as template, WT using wild type quasiThe Arabidopsis DNA was used as template.

12) Phenotypic observations

Obtaining transgenic plants of different generations: the harvested transgenic T1 generation seeds are sterilized, screened and cultured, and then transplanted into nutrient soil to be cultured at 22 ℃ for 16 h in light/8 h in darkness; after detection, retaining the preliminarily confirmed transgenic plants, harvesting seeds of T1 generations after the plants are mature, and numbering to obtain T2 generations; like the T1 generation, seeds of the T2 generation are sterilized and then coated on a screening culture medium containing antibiotics, and the culture medium is placed at 22 ℃ for continuous illumination; performing survival rate statistics on T2 generation seeds with different numbers for about 10 days, selecting plants with 75% survival rate, transplanting the plants into nutrient soil, culturing the plants in the nutrient soil at 22 ℃ for 16 h in light/8 h in dark, and taking leaves for positive detection; continuously numbering positive T2 generation plants, and collecting seeds to obtain T3 generation seeds; sterilizing the seeds, screening by using a screening culture medium, and placing under the light for continuous illumination culture; around 10d, different numbered T3 generation plants were observed, all survived and no segregating homozygous plants for the T3 generation appeared.

The obtained transgenic lines were observed in batches.

(1) Selecting a transgenic plant with an obvious phenotype for observation, and finding that the transgenic arabidopsis plant grows slowly compared with the wild arabidopsis as shown in figure 5,CgWRKY11compared with wild arabidopsis WT in the seedling stage of the transgenic plant,CgWRKY11the whole plant is short and weak, the growth vigor is the weakest, the leaf is small, the leaf is yellow and has the tendency of premature senility, the vegetative growth period is prolonged, and the genes can inhibit the vegetative growth of the plant, so that the vegetative growth is possibly caused, and the flowering is delayed due to the lack of nutrition.

(2) ABA stress treatment is carried out on transgenic Arabidopsis, the disinfected transgenic Arabidopsis seeds and wild Arabidopsis seeds are sown on 1/2MS culture medium to grow for about four days, the seeds are transferred to 1/2MS culture medium added with 100 MuM ABA, the root length of Arabidopsis is observed by photographing for about 10 days, data is recorded, see figure 6, the result shows that,CgWRKY11the expression level of (A) is increased and then decreased, and the expression level of (A) is differentially expressed at different times in transgenic Arabidopsis plants, but is differentially expressed in common wild Arabidopsis plantsThe expression level in the plant (WT) is almost 0, and the experimental result proves thatCgWRKY11The gene has been successfully transferred into arabidopsis; as shown in FIG. 7, under ABA stress conditions, the root length of WT was reduced by about 11mm, CgWRKY11the average decrease is 18 mm, and the result shows thatCgWRKY11The root length of transgenic Arabidopsis has larger reduction amplitude than WT, which shows thatCgWRKY11Is sensitive to ABA and can accelerate the inhibiting effect of ABA on root development.

This example shows cymbidium goeringii to be overexpressedCgWRKY1135S:CgWRKY11transferring into model plant Arabidopsis thaliana, and performing phenotype observation and analysis. As can be seen from the results, 35S was overexpressed:CgWRKY11the arabidopsis T2 generation plants have slow growth and development, and the leaves of the plants become small;CgWRKY11overexpression can promote the root development inhibition effect of ABA by regulating and controlling the expression of ABA signal pathway related genes.

Sequence listing

<110> Nanjing university of forestry

<120> cymbidium CgWRKY11 gene and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 996

<212> DNA

<213> Cymbidium goeringii

<400> 1

atggcagttg atctaatcgg ctacgcgaag atggacgacc agatcacaat ccaggaggcg 60

gcggctgccg gtatccggag catggaaaac ctaatctttc agctcaatcg ccaacatcag 120

aagtccacgt catcttcagc agctgcagcg accatcgatt gccgggaaat tgccgatcac 180

accgtctcaa agttcaagaa gatgatctcc attctaaatc gcaccggcca cgcccgattc 240

cgccgcggcc cttccgtcca aattcttccc gcttctgtaa cacctgcgcc gcaggtagcg 300

gctccgcatc tggcgccagt gatggcggct ccggtcgtcc ctttacagag cctgacgtta 360

gattttacca agccaagctc cgtcggcggc ggatccactg atctagccat cgttgccgca 420

tcatcgggaa aatacgttaa ggagagcttc agcatctcga cgccaatctc ttcggcgaac 480

tcatccttta tgtcatcaat cactggcgat ggaagtgtct ccaatggtcg ccagggcgga 540

acgacctctc ttcttctccc ttcagtgccc gccatctctg ccggcggcgt cgttgccgga 600

aaacctccgc tagcagccta caagaaacgc tgccacagcc acgcccactc agaagatttt 660

actgggaagt tcaccgccaa cggcggtcgc tgccactgtt ccaagcggcg aaagaatcgc 720

gtgaagagga cgatacgggt tccagcaatc agcgcaaaga tggccgatat cccgtccgac 780

gaatactcat ggcgaaagta tggtcagaag ccgataaagg gctctccata cccgagaggc 840

tactacaagt gcagcagcct gcgcggttgc ccggccagga aacacgtgga acgcgcgccg 900

gacgatccct cgatgctaat cgtcacctac gagggcgagc accgccactc ccagccctcc 960

gatgctctcg tcttcgacac ccatcgccag atctga 996

<210> 2

<211> 331

<212> PRT

<213> Cymbidium goeringii

<400> 2

Met Ala Val Asp Leu Ile Gly Tyr Ala Lys Met Asp Asp Gln Ile Thr

1 5 10 15

Ile Gln Glu Ala Ala Ala Ala Gly Ile Arg Ser Met Glu Asn Leu Ile

20 25 30

Phe Gln Leu Asn Arg Gln His Gln Lys Ser Thr Ser Ser Ser Ala Ala

35 40 45

Ala Ala Thr Ile Asp Cys Arg Glu Ile Ala Asp His Thr Val Ser Lys

50 55 60

Phe Lys Lys Met Ile Ser Ile Leu Asn Arg Thr Gly His Ala Arg Phe

65 70 75 80

Arg Arg Gly Pro Ser Val Gln Ile Leu Pro Ala Ser Val Thr Pro Ala

85 90 95

Pro Gln Val Ala Ala Pro His Leu Ala Pro Val Met Ala Ala Pro Val

100 105 110

Val Pro Leu Gln Ser Leu Thr Leu Asp Phe Thr Lys Pro Ser Ser Val

115 120 125

Gly Gly Gly Ser Thr Asp Leu Ala Ile Val Ala Ala Ser Ser Gly Lys

130 135 140

Tyr Val Lys Glu Ser Phe Ser Ile Ser Thr Pro Ile Ser Ser Ala Asn

145 150 155 160

Ser Ser Phe Met Ser Ser Ile Thr Gly Asp Gly Ser Val Ser Asn Gly

165 170 175

Arg Gln Gly Gly Thr Thr Ser Leu Leu Leu Pro Ser Val Pro Ala Ile

180 185 190

Ser Ala Gly Gly Val Val Ala Gly Lys Pro Pro Leu Ala Ala Tyr Lys

195 200 205

Lys Arg Cys His Ser His Ala His Ser Glu Asp Phe Thr Gly Lys Phe

210 215 220

Thr Ala Asn Gly Gly Arg Cys His Cys Ser Lys Arg Arg Lys Asn Arg

225 230 235 240

Val Lys Arg Thr Ile Arg Val Pro Ala Ile Ser Ala Lys Met Ala Asp

245 250 255

Ile Pro Ser Asp Glu Tyr Ser Trp Arg Lys Tyr Gly Gln Lys Pro Ile

260 265 270

Lys Gly Ser Pro Tyr Pro Arg Gly Tyr Tyr Lys Cys Ser Ser Leu Arg

275 280 285

Gly Cys Pro Ala Arg Lys His Val Glu Arg Ala Pro Asp Asp Pro Ser

290 295 300

Met Leu Ile Val Thr Tyr Glu Gly Glu His Arg His Ser Gln Pro Ser

305 310 315 320

Asp Ala Leu Val Phe Asp Thr His Arg Gln Ile

325 330

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence (artiartiartifical sequence)

<400> 3

atggcagttg atctaatcgg cta 23

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (artiartiartifical sequence)

<400> 4

tcagatctgg cgatgggtgt 20

<210> 5

<211> 43

<212> DNA

<213> Artificial sequence (artiartiartifical sequence)

<400> 5

gagaacacgg gggactctag aatggcagtt gatctaatcg gct 43

<210> 6

<211> 40

<212> DNA

<213> Artificial sequence (artiartiartifical sequence)

<400> 6

tcacacaaac ggtgatacgt agatctggcg atgggtgtcg 40

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (artiartiartifical sequence)

<400> 7

gatagtggaa aaggaaggtg 20

<210> 8

<211> 40

<212> DNA

<213> Artificial sequence (artiartiartifical sequence)

<400> 8

tcacacaaac ggtgatacgt agatctggcg atgggtgtcg 40

Claims (2)

1. The application of CgWRKY11 in controlling the growth of seedlings of Arabidopsis thaliana 'Columbia' has a nucleotide sequence shown as SEQ ID number 1; the method comprises the following steps: connecting the gene containing CgWRKY11 of cymbidium to a vector, transforming the gene into wild arabidopsis thaliana 'Columbia' through agrobacterium mediation, screening and culturing to obtain a transgenic plant.

2. The application of CgWRKY11 in controlling the growth of root system of Arabidopsis thaliana 'Columbia' has a nucleotide sequence shown as SEQ ID number 1; the method comprises the following steps: connecting the gene containing CgWRKY11 of cymbidium to a vector, transforming the gene to wild arabidopsis thaliana 'Columbia' through agrobacterium-mediated transformation, screening and culturing to obtain a transgenic plant.

Images