CN111424040B - Cymbidium CgWRKY21 gene and application thereof - Google Patents

Cymbidium CgWRKY21 gene and application thereof Download PDF

Info

Publication number
CN111424040B
CN111424040B CN202010298792.0A CN202010298792A CN111424040B CN 111424040 B CN111424040 B CN 111424040B CN 202010298792 A CN202010298792 A CN 202010298792A CN 111424040 B CN111424040 B CN 111424040B
Authority
CN
China
Prior art keywords
cgwrky21
gene
cymbidium
growth
arabidopsis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010298792.0A
Other languages
Chinese (zh)
Other versions
CN111424040A (en
Inventor
胡凤荣
王连平
徐子涵
黎猛
苗大鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Forestry University
Original Assignee
Nanjing Forestry University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Forestry University filed Critical Nanjing Forestry University
Priority to CN202010298792.0A priority Critical patent/CN111424040B/en
Publication of CN111424040A publication Critical patent/CN111424040A/en
Application granted granted Critical
Publication of CN111424040B publication Critical patent/CN111424040B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/827Flower development or morphology, e.g. flowering promoting factor [FPF]

Abstract

The invention discloses a Chinese cymbidiumCgWRKY21A coding gene and an application thereof,CgWRKY21the nucleotide sequence of the gene is shown as SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown as SEQ ID NO. 2. The invention relates to a cymbidium goeringii cultivated variety 'Songmei'CgWRKY21Cloning and identification of genes, analysis of gene expression, and verification of their function, discoveryCgWRKY21Compared with wild Arabidopsis WT in seedling stage, the growth and narrowing of different lotus plumule leaves in different strains of transgenic Arabidopsis WT have peculiar leaf shape, but the leaf shape gradually returns to normal with the growth period, which is similar to wild type, thus showing that the transgenic plant may cause dysplasia due to insufficient nutrition absorbed by roots in the early growth process, and simultaneouslyCgWRKY21The transgenic plants underwent early stem-forming and flowering, which indicates thatCgWRKY21It is possible to shorten the vegetative growth cycle and promote reproductive growth, and thus the gene may have wide application in improving orchid flower character.

Description

CgWRKY21 gene of cymbidium goeringii and application thereof
Technical Field
The invention belongs to the technical field of plant genetic engineering, and particularly relates to cymbidium goeringiiCgWRKY21Genes and their use.
Background
The orchid family (Orchidaceae) is one of the largest of the flowering plants, and contains 25000 or more species worldwide, accounting for about 10% of all flowering plants. Goering cymbidium (A. fern)Cymbidium goeringii) Belonging to the genus OrchidaceaeThe floret type Geshenlan has peculiar flower type, elegant flower color, delicate flower fragrance, beautiful leaf appearance and high ornamental value and economic value. The cymbidium goeringii has high requirements on the growth environment, is very easily influenced by severe environments such as high temperature, low temperature, drought and the like in the growth process, and can cause the reduction of the ornamental quality of gardening and even the death of plants in severe cases. Therefore, the research on the molecular mechanism of plants for coping with abiotic stress and the identification of genes with stress resistance function are of great significance to the breeding and production of cymbidium goeringii. In a plant cell signal transduction pathway, the WRKY transcription factor is considered as a key pivot of plant growth and various stress responses, and provides an important basis for genetic improvement of plants.
WRKY transcription factors are one of the largest families of regulatory proteins in plants, involved in a variety of physiological processes, the most prominent of which are stress responses to biotic and abiotic stresses. The WRKY gene is reported to enhance the tolerance of plants to adversity stress. The sunflower HaWRKY76 transgenic plant shows stronger stress resistance to waterlogging stress, and the yield is also obviously increased.AtWRKY25The overexpression of (a) enhances the salt tolerance of Arabidopsis thaliana.AtWRKY57The over-expression in rice not only improves the drought resistance of rice, but also enhances the tolerance of the rice to salt and PEG. Therefore, it is obtained by cloning from cymbidium goeringii by using genetic engineering technologyCgWRKY21The gene has obvious expression difference under low temperature stress, so it will be used in treating diabetesCgWRKY21The gene is transferred into plants, and has great application prospect.
Different plants have different gene sequences even in the same gene family, and even if more than 80% of the gene sequences are the same, the partial genes are inserted into different sites, so that the partial genes have different functions when transferred into the plants. When a foreign gene enters a chromosome, a foreign protein encoded by the gene is generated, the foreign protein or enzyme causes the activity of other enzymes or proteins to be enhanced or reduced through a series of reactions, and when the foreign gene is embedded in a certain segment of the chromosome, the whole chromosome is influenced, so that the activity or the regulation mechanism of other genes is influenced.
Even if the same gene is inserted, the same gene is inevitably influenced on the chromosome due to different insertion sites or different chromosome groups, and further influences the gene on the chromosome, and slight changes of the gene can influence the regulation mechanism, so that the changes of gene inactivation, activity reduction, activity enhancement and the like can be caused, and the gene action is different, and the gene action can be obtained only by verification and can not be obtained by inference.
Disclosure of Invention
The purpose of the invention is as follows: aiming at the defects in the prior breeding technology, the invention aims to provide the cymbidium goeringiiCgWRKY21A gene. Another object of the present invention is to provide cymbidium goeringiiCgWRKY21The application of the gene in orchid breeding.
The technical scheme is as follows: in order to achieve the purpose of the invention, the technical scheme adopted by the invention is as follows:
a kind of Chinese cymbidiumCgWRKY21The nucleotide sequence of the gene is shown in SEQ ID NO. 1.
The cymbidium goeringiiCgWRKY21The amino acid sequence of the gene expression protein is shown in SEQ ID NO. 2.
The cymbidium goeringiiCgWRKY21The use of genes in plant production and breeding.
Contains the cymbidium goeringiiCgWRKY21A vector for the gene.
Contains the cymbidium goeringiiCgWRKY21A host cell for the gene.
Has the advantages that: compared with the prior art, the invention has the advantages that the cymbidium goeringii is treatedCgWRKY21Cloning and identification of gene, expression analysis of gene, verification of its function, finding over-expressionCgWRKY21Compared with wild Arabidopsis WT, the different lotus seed young leaf strains of the transgenic Arabidopsis plant in the seedling stage have the phenomenon of growth and narrowing, the leaf shape is peculiar, but the leaf shape gradually returns to normal along with the extension of the growth period, and the similar wild Arabidopsis plant shows that the transgenic plant can cause dysplasia due to insufficient nutrition absorbed by roots in the early growth process, and simultaneouslyCgWRKY21The transgenic plant shoots and blooms in advance, so that the gene has wide application in the production and breeding of orchid and other plants.
Drawings
FIG. 1 is cymbidium goeringiiCgWRKY21Gene cloning and constructed over-expression vector map;
FIG. 2a is a drawingCgWRKY21Expression in cymbidium goeringii tissues, wherein R represents roots, P represents pseudobulbs, L represents leaves, and F represents flowers; b is cymbidium under low temperature stressCgWRKY21The expression of the gene;
FIG. 3a is a diagram showing the results of enzyme digestion, wherein M: DL2000 Marker;CgWRKY21after being connected with pBI121, SmaI and SnaBI are used for double enzyme digestion; panel b is a screening panel for positive recombinants, where M: DL2000 Marker, the size of the target band is 1026 bp;
FIG. 4 is a plot of the PCR results for transgenic Arabidopsis plants, where M: DL2000 Marker; CK (CK)+: taking vector plasmid DNA as a positive control; CK (CK)-: wild type DNA is negative control; water: blank control;
FIG. 5 is a view of a rotary tableCgWRKY21Comparing the plant type of the gene plant with that of a wild type arabidopsis plant, wherein WT is shown in the figure, and the wild type arabidopsis is shown in the figure; 1-3, turningCgWRKY21Different strains of genes;
FIG. 6 is a view of a rotary tableCgWRKY21Comparing the plant type of the gene plant with that of a wild type arabidopsis plant, wherein WT is shown in the figure, and the wild type arabidopsis is shown in the figure; 1-3, turningCgWRKY21Different strains of genes;
FIG. 7 is a view of a rotary drumCgWRKY21The gene plant and wild arabidopsis thaliana are subjected to cold stress and related gene expression conditions under low temperature stress.
Detailed Description
The present invention will be further described with reference to the following specific examples.
Example 1
The material used in this example was the "songmei" leaf of cymbidium goeringii, which was snap frozen in liquid nitrogen after harvesting and stored in an ultra-low temperature freezer (-80 ℃).
1) Extraction of total RNA from cymbidium goeringii leaves
The method is carried out according to the instruction of a TaKaRa plant total RNA extraction kit, and comprises the following specific operations:
quickly transferring the frozen cymbidium leaves at ultralow temperature into a mortar precooled by liquid nitrogenGrinding the tissue with a pestle while continuously adding liquid nitrogen until the tissue is ground into powder; adding the sample ground into powder into 1.5mL of sterilized tube containing 450 μ l of Buffer PE, and repeatedly blowing and beating by using a pipette until no obvious precipitate exists in the lysate; the lysate is centrifuged at 12,000 rpm for 5min at 4 ℃; the supernatant was carefully pipetted into a fresh 1.5mL sterile tube. Adding Buffer NB with the volume of 1/10 of the supernatant, Vortex, mixing evenly, centrifuging at 12,000 rpm and 4 ℃ for 5 min; carefully sucking the supernatant into a new 1.5mL sterilized tube, adding 450. mu.L Buffer RL, and uniformly mixing the solution by using a pipette; adding anhydrous ethanol with the volume of 1/2 mixed solution, uniformly mixing the solution by using a liquid-transferring gun, and immediately transferring the mixed solution into an RNA Spin Column; centrifuging at 12,000 rpm for 1min, discarding the filtrate, and returning the RNA Spin Column to 2ml Collection Tube; add 500. mu.L of Buffer RWA into RNA Spin Column, centrifuge at 12,000 rpm for 30s, discard the filtrate; 600 μ L of Buffer RWB was added to the RNA Spin Column, centrifuged at 12,000 rpm for 30s, and the filtrate was discarded; adding 50 mu L of DNase I reaction solution into the center of the RNA Spin Column membrane, and standing for 15min at room temperature; adding 350 mu L of Buffer RWB to the center of an RNA Spin Column membrane, centrifuging at 12,000 rpm for 30s, and discarding the filtrate; the RNA Spin Column was re-mounted on a 2mL Collection Tube and centrifuged at 12,000 rpm for 2 min; the RNA Spin Column was mounted on a 1.5mL RNase Free Collection Tube, and 50. mu.L of RNase Free dH was added to the center of the RNA Spin Column membrane2O is left to stand at room temperature for 5min and centrifuged at 12,000 rpm for 2min to elute RNA. The obtained RNA is stored in a refrigerator at minus 80 ℃ for later use after concentration and purity detection.
The result of taking 2. mu.L of RNA and detecting by 1% agarose gel electrophoresis shows that 28S and 18S bands are clearer, the brightness of the 28S band is about twice of that of the 18S band, and the RNA quality is better. Detection of RNA purity, OD by means of a micro-accounting protein assay260/OD280Is 2.01, OD260/OD2302.03, better integrity, can be used for reverse transcription.
2) Synthesis of first Strand cDNA
The total RNA obtained was used as a template, reverse transcription was performed using a TaKaRa reverse transcription kit, and oligo (dT) was used as an anchor primer, and first strand cDNA was synthesized by reverse transcription. The specific operation is as follows:
prepare a mixture in the centrifuge tube in the following template RNA/primer order, total 10 μ Ι _: mu.g template, 1. mu.L oligo (dT) Primer (50. mu.M), 1. mu.L dNTP mix (10mM each), and the remaining volume with RNase-free ddH2And (4) supplementing and finishing. Keeping the temperature at 65 ℃ for 5min, and then rapidly cooling on ice; the tube was centrifuged to allow the mixture to settle to the bottom of the tube. Prepare reverse transcription reaction solution (20 μ L) in a new centrifuge tube: the above denatured reaction solution was 10. mu.L, 5 XPrimeScript Buffer 4. mu.L, RNase Inhibitor (40U/. mu.L) 0.5. mu.L, PrimeScript RTase (200U/. mu.L) 1. mu.L, RNase Free dH2The total amount of O is 20 mu L. Slowly shaking, keeping the temperature on a PCR instrument for 10min at 30 ℃, 30min at 42 ℃ and 5min at 95 ℃ to inactivate the enzyme, and placing on ice to obtain the cDNA solution.
3) Design and cloning of target gene primer
Based on existing sequencing data for the cymbidium transcriptome, using other speciesWRKYBlast homology alignment is carried out on related gene sequences. Corresponding primers are designed by utilizing Oligo6.0 and Prime5.0, and the sequences of the primers are as follows:
CgWRKY21-F:
5'- ATGGAGGAGGTGGAGGC -3',
CgWRKY21-R:
5'- TCAGGTCTGAGCGGACTG -3'。
performing cymbidium goeringii by using PrimerStar Max high fidelity enzyme by using cDNA first strand as templateCgWRKY2Cloning of the gene. The PCR amplification system (50. mu.L) was: mu.l PrimerStar Max, 2. mu.l Forward Primer, 2. mu.l Reverse Primer, 2. mu.l Template DNA, 19. mu.l ddH2And (O). The PCR procedure was: the reaction conditions are pre-denaturation at 94 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 5s, extension at 72 ℃ for 30s, 32 cycles, total extension at 72 ℃ for 5min and heat preservation at 16 ℃.
After the PCR reaction is finished, all PCR products are taken to be detected and cut into target fragments through 1.5 percent agarose gel electrophoresis, and the target PCR amplification products are recovered and purified through gel. The DNA gel recovery kit of Tiangen company is adopted to purify and recover the target fragment, and the specific operation is as follows: into an adsorption column CA2 (adsorption column put in)Collecting tube) is added with 500 mul of balancing liquid BL, centrifuged for 1min at 12000rpm, the waste liquid in the collecting tube is poured out, and the adsorption column is replaced into the collecting tube again; cutting a single target strip from the agarose gel, putting the cut single target strip into a clean centrifugal tube, and weighing the cut single target strip; adding equal volume of solution PN (if the gel is 0.1g, the volume can be regarded as 100 μ L, then 100 μ L of PN solution) into the gel block, placing in a water bath at 50 ℃, and continuously and gently turning the centrifugal tube up and down until the gel block is completely dissolved; adding the solution obtained in the previous step into an adsorption column CA2, standing at room temperature for 2min, centrifuging at 12000rpm for 1min, pouring off waste liquid in the collection tube, and placing adsorption column CA2 into the collection tube; adding 600 μ L of rinsing liquid W into adsorption column CA2, centrifuging at 12000rpm for 1min, pouring off waste liquid in the collection tube, and placing the adsorption column back into the collection tube; centrifuging at 12000rpm for 2min, removing rinsing liquid as much as possible, standing the adsorption column at room temperature for 5min, and air drying completely; placing the adsorption column into a clean centrifuge tube, suspending and dropwise adding 30 μ L ddH to the middle position of the adsorption film2O, standing at room temperature for 2min, and centrifuging at 12000rpm for 2min to collect the DNA solution. The recovered and purified product (2. mu.L) was collected and examined by gel electrophoresis using 1% agarose.
4) Ligation of the fragment of interest to the vector
The cloning vector is pEASY-Blunt vector of the whole formula gold company, and the ligation reaction is carried out, wherein the ligation system (5 mu L): mu.L of the PCR-purified product, 1. mu.L of pEASY-Blunt Vector, was gently pipetted and mixed, and then left at room temperature for 5min, and the centrifuge tube was placed on ice.
5) Conversion of ligation products
Competent cell Trans5 α strain was removed from the ultra-low temperature refrigerator and thawed on ice. Pipette 5. mu.L of overnight ligation into 100. mu.L of competent cells; placing the centrifugal tube on ice for ice bath for 30 min; heating in water bath at 42 deg.C for 90 s without shaking; immediately placing on ice for ice bath for 2 min; adding 800 μ L of liquid culture medium without antibiotics into a super clean bench, and resuscitating at 37 deg.C under shaking at 180 rpm for 1 h; centrifuging at 4000 rpm for 3min, and sucking 800 μ L of supernatant; the precipitated cells were resuspended, plated on LB plates (Amp concentration: 100 mg/L), and cultured overnight at 37 ℃.
6) Screening and validation of recombinant plasmids
A single colony grown overnight on LB solid medium containing an antibiotic (Amp) was picked and inoculated into 750. mu.L of LB liquid medium containing the same antibiotic. 200 rpm, 37 ℃ overnight culture.
The PCR amplification system is as follows: 10uL Green TaqMix, 1 mu L M13-F/R, 1 mu L bacterial liquid, 7 mu L ddH2O was supplemented to 20. mu.L.
The PCR procedure was: 10min at 94 ℃; 30 cycles at 94 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 1 min; 5min at 72 ℃; at 16 ℃ forever.
And sucking 5 muL of PCR products for agarose gel electrophoresis detection analysis. After verification, the bacterial liquid sample with the correct strip size is subjected to sequencing by Nanjing Kingsrey Biotech Co., Ltd, and the sequencing primer is the universal primer M13F/R. The sequencing results were analyzed by alignment at the NCBI.
According to the analysis of the sequencing result, 1 cymbidium can be finally obtained by determining the cloneWRKYThe coding gene is namedCgWRKY21The nucleotide sequence of the gene is shown as SEQ ID NO.1,CgWRKY21the gene coding length is 1026bp, the ATG start codon and the TGA stop codon are contained, wherein the total length of the ORF is 1026bp, 341 amino acid proteins are coded, and the amino acid sequence of the proteins is shown as SEQ ID NO. 2.
Example 2
The research result shows thatWRKY21The gene is expressed in various tissues and organs in cymbidium (FIG. 2 a), but the expression level of the gene is the highest in cymbidium, which indicates that the gene is active in flower function. Expression analysis of low temperature stress treated leaves of cymbidium goeringii (FIG. 2 b) demonstratedCgWRKYThe 21 gene plays an important regulatory role in the low-temperature stress response of cymbidium goeringii leaves.
The plant material used in this example was Arabidopsis thaliana (Arabidopsis thaliana) Col (Columbia) wild type seeds.
The E.coli strain used in this example was Trans5 α; the agrobacterium strains are GV3101 and are respectively used for transforming arabidopsis; the plant expression vector used in the experiments was pBI 121. The strains used were purchased from holotype gold and prism, respectively.
1)CgWRKY21Construction of Gene overexpression vectors
Obtained in example 1CgWRKY21The full-length sequence of the gene ORF is connected with a plant expression vector pBI121, and the constructed vector is shown in figure 1.
2) And (3) plasmid extraction:
extracting plasmids according to the specification of the small and medium-sized Tiangen plasmid kit, and specifically comprising the following steps:
taking 10mL of overnight cultured bacterial liquid, centrifuging at 12000rpm for 1min, and removing supernatant; adding 500 mu L P1 solution (containing RNase A) into a centrifuge tube with the thallus precipitate, and completely suspending the thallus precipitate by using a vortex apparatus; adding 500 mu L P2 solution into a centrifuge tube, fully cracking thalli when turning the solution gently up and down, adding 700 mu L P3 solution into the centrifuge tube, immediately turning the solution gently up and down, fully mixing the solution, and centrifuging the solution at 12000rpm for 10min when white flocculent precipitates appear; adding 500 μ L of equilibrium liquid BL into adsorption column CP4, centrifuging at 12000rpm for 1min, discarding waste liquid in the collection tube, returning the adsorption column to the collection tube, adding collected supernatant into filtration column CS in batches, centrifuging at 12000rpm for 2min, carefully adding solution collected in the collection tube into adsorption column CP4 in batches, centrifuging at 12000rpm for 1min, discarding waste liquid in the collection tube, and returning adsorption column CP4 to the collection tube; adding 500 μ L deproteinized solution PD into adsorption column CP4, centrifuging at 12000rpm for 1min, discarding waste liquid in the collection tube, and replacing adsorption column CP4 into the collection tube; adding 600 μ l rinsing solution PW (containing anhydrous ethanol) into adsorption column CP4, centrifuging at 12000rpm for 1min, discarding waste liquid in the collection tube, placing adsorption column CP4 back into the collection tube, centrifuging at 12000rpm for 2min, and removing residual rinsing solution in the adsorption column; the adsorption column CP4 was transferred to a new 1.5ml centrifuge tube, and 60. mu.L ddH was added to the middle of the adsorption membrane2O; standing at room temperature for 2min, centrifuging at 12000rpm for 1min, and collecting the solution in the centrifuge tube as plasmid. Finally, the plasmid concentration was determined and prepared for the next experiment.
3) Addition of specific cleavage sites
cDNA is taken as a template, and specific enzyme cutting sites are added on two sides of a target gene by a PCR method. Chinese cymbidiumCgWRKY21SmaI and SnaBI enzyme cutting sites are added on both sides of the gene. A PCR reaction system,The procedure and primers used were as follows:
PCR amplification System (50. mu.L): 25 μ L PrimerStar Max, 2 μ L Forward Primer, 2 μ L Reverse Primer, 2 μ L Template DNA, 19 μ L ddH2And O. The PCR procedure was: the reaction conditions are pre-denaturation at 94 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 5s, extension at 72 ℃ for 30s, 32 cycles, total extension at 72 ℃ for 5min and heat preservation at 16 ℃.
The primer sequences used were:
CgWRKY21-SmaI-F:5'- CCCGGGATGGAGGAGGTGGAGGC -3',
CgWRKY21-SnaBI-R:5'- TACGTAGGTCTGAGCGGACTGAGT -3'
the obtained PCR product was separated by 1.5% agarose gel electrophoresis, recovered and purified using a Tiangen agarose gel DNA recovery kit, and the recovered product was ligated with the pBI121 vector to construct an expression vector.
4) Double enzyme digestion reaction
The extracted pBI121 plasmid is digested by SmaI and SnaBI at 37 ℃ for 15min, and the linear vector is recovered by electrophoresis and stored at-20 ℃ for later use. The double enzyme digestion reaction system is 50 mu L: pBI121 plasmid 20. mu.L, 5 XBuffer 5. mu.L, SmaI 1. mu.L, SnaBI 1. mu.L, ddH2O23. mu.L. The cleavage result is shown in FIG. 3a, wherein M: DL2000 Marker; 1:CgWRKY21after ligation with pBI121, SmaI and SnaBI were used for double digestion.
5) Ligation reaction
Agarose gel electrophoresis is used for detecting the target gene and the vector pBI121 recovered after enzyme digestion, and reagents are added according to a connection system according to the detected purity and concentration. Wherein, the number of target fragment molecules is: the number of carrier molecules =3:1-5:1, and the connection reaction system is as follows: the pBI121 vector was linearized in 7. mu.L, the insert was 3. mu.L, 5 × CE II buffer 4. mu.L, Exnase II 2. mu.L, ddH2O Up to 20. mu.L. Reacting at 37 deg.C for 30min, cooling on ice.
6) Transfer of the ligation product into E.coli
The product of the ligation of the desired fragment with the vector pBI121 was transferred into E.coli Trans 5. alpha. competent cells in the same manner as in example 1.
7) Identification of recombinants
Single colonies on the plates were picked and inoculated into LB liquid medium containing antibiotic (kanamycin) and shake-cultured overnight at 37 ℃ at 200 rpm. The target gene full-length primer is used for bacterial liquid PCR to screen positive clones. The positive clones after screening were sequenced by Nanjing Kingsry. Meanwhile, extracting plasmids by using a Tiangen plasmid extraction kit, carrying out enzyme digestion verification, and judging whether the sizes of the fragments after enzyme digestion are consistent. The result is shown in FIG. 3b, and the band size is 1026bp for the PCR result of the target primer.
8) Preparation and transformation of Agrobacterium-infected competent cells
In the embodiment, agrobacterium GV3101 is used for preparing agrobacterium competence for carrying out an infection experiment of arabidopsis; the preparation process of the agrobacterium infection is as follows: selecting an activated agrobacterium single colony, inoculating the agrobacterium single colony in 5mL of liquid LB culture medium, and performing shake culture at 28 ℃ and 250 rpm for 20-24 h; 2mL of the bacterial suspension was aspirated, inoculated into a flask containing 50mL of liquid LB medium, and shaken at 28 ℃ and 250 rpm to OD600The value is about 0.8; placing the expanded bacterial solution on ice for ice bath for 30min, centrifuging at 4 ℃ and 5000 rpm for 5min, and removing the supernatant; 10mL of precooled 0.1 mo1/L CaCl was added2A solution to fully suspend the precipitated bacteria; centrifuging at 4 deg.C and 5000 rpm for 5min, and discarding supernatant; 1mL of pre-cooled 20 mmo1/L CaCl was added2The solution fully suspends the thalli to obtain GV3101 competent cells to be prepared, the competent cells are subpackaged into 100 mu L/tube by a centrifuge tube, 20% of sterile glycerol is rapidly added, and the competent cells are placed and stored at minus 80 ℃.
Agrobacterium transformation of recombinants: ice-bath is carried out to melt the agrobacterium tumefaciens competent cells, 1-5 mul of recovered and purified plasmid is added into 200 mul of agrobacterium tumefaciens competent cells, and the mixture is mixed gently and ice-bath is carried out for 30 min; quickly freezing with liquid nitrogen for l min, hot shocking in water bath at 37 deg.C for 1-5 min, and rapidly placing on ice for 1-2 min; adding 800 μ l LB culture medium without any antibiotic, and resuscitating at 28 deg.C and 100 rpm for 2-4 h; centrifuging at 4000 rpm for 3min, and sucking off part of the culture medium; mixing the rest bacteria solution with a pipette, and smearing on solid LB medium containing 50 mg/L kanamycin and 50 mg/L streptomycin (EHA 105) or 100 mg/L gentamicin (GV 3101); performing inverted culture at 28 deg.C for 30-48 h.
Identification of Agrobacterium recombinants: picking out single colony from the plate culture medium, and inoculating the single colony in a liquid culture medium containing corresponding antibiotics; culturing at 28 deg.C and 220 rpm overnight; carrying out PCR on the bacterial liquid by respectively matching 35S-F with the following primers, wherein the sequences of the primers are as follows:
35S-F:5'-GATAGTGGAAAAGGAAGGTG-3',
35S-CgWRKY21-R:5'- TACGTAGGTCTGAGCGGACTGAGT -3'。
detecting the PCR product by 1% agarose gel electrophoresis to identify whether the PCR product contains a target fragment; identifying positive clones, performing amplification culture, extracting plasmids by an alkaline lysis method, and performing double enzyme digestion verification; and adding a proper amount of sterile glycerol into the identified positive clone, and storing at-80 ℃ for later use.
9) Agrobacterium-mediated transformation of Arabidopsis thaliana
The method is characterized in that a target gene is transferred into arabidopsis thaliana by adopting an inflorescence infection method, and the specific operation method comprises the following steps: arabidopsis (col wild type) maintained healthy growth until flowering; activating the Agrobacterium EHA105 strain carrying the gene of interest. Picking a single colony, inoculating the single colony on 5mL LB culture medium containing kanamycin and streptomycin, shaking the colony at the speed of 250 rpm at the temperature of 28 ℃ until the bacterial liquid just turns turbid, and taking about 8-10 h; 1mL of bacterial liquid is sucked and inoculated into a triangular flask (50 mL) for shaking bacteria for 24 hours until the OD value is about 0.8; centrifuging the bacterial liquid at 5000 rpm at room temperature for 5min, removing supernatant, collecting thalli, and suspending with 5% sucrose solution; before soaking, adding Silwet L-77 with the concentration of 0.05% (500 mul/L), and shaking out foams; soaking the overground part of the arabidopsis in the agrobacterium suspension solution for 15-30 s, and gently shaking the overground part of the arabidopsis; laying the soaked arabidopsis thaliana in a tray, covering the tray with a preservative film, sealing the tray with tinfoil paper in the dark, and standing the tray for 24 hours at the temperature of 4 ℃; the tinfoil paper is uncovered, the culture is carried out under a normal condition, and watering is stopped when the seeds are mature.
The 5% sucrose solution resuspension had the following composition: adding 50g/L of sucrose, 0.5g/L of MES and Silwet-77500 mu L/L into an MS culture medium. (Note: after preparation, pH was adjusted to 5.8, and after centrifugation and resuspension of the bacterial solution, Silwet L-77 was added, and the conversion relationship between the resuspension solution and the bacterial solution was that the amount of the resuspension solution was OD of the bacterial solution volume =0.8 of the bacterial solution volume).
10) Screening of transgenic plants
The collected seeds of transgenic arabidopsis of T1 generation are sterilized by alcohol and mercuric chloride, and the steps are as follows: placing a proper amount of the obtained transgenic seeds in a 1.5mL centrifuge tube, and soaking the seeds in 75% alcohol for 30 s; sterilizing with 10% sodium hypochlorite for 2min and 30 s; washing with sterile water for 3-4 times, and replacing sterilized new centrifuge tube after the first washing; the suspension was suspended in 0.1% agarose solution.
The sterilized transgenic Arabidopsis seeds were sown on 1/2MS solid medium containing antibiotics (kanamycin 50 mg/L and cefamycin 100 mg/L). Culturing at 22 deg.C under illumination. After about one week, Arabidopsis thaliana which can grow normally on the medium is transplanted into soil and continues to grow.
11) Detection of transgenic plants
Taking a proper amount of arabidopsis thaliana and young leaves of transgenic plants, and extracting DNA by adopting a CTAB method, wherein the specific operation steps are as follows: placing a proper amount of leaves in a sterilized 2mL centrifuge tube, adding 700 mul of CTAB solution, thoroughly grinding by using a ball mill, and standing for 10min at 65 ℃; equal volume of chloroform was added: inverting isoamyl alcohol several times to mix uniformly, and centrifuging at 14000 rpm for 10 min; transferring the supernatant into a new sterile centrifuge tube, adding isopropanol with the same volume, reversing and uniformly mixing for several times, standing at room temperature for 2min, centrifuging at 14000 rpm for 10min, and pouring off the supernatant; adding 70% anhydrous ethanol, blowing and washing twice by using a liquid transfer gun, centrifuging at 14000 rpm for 1min, and removing the supernatant; drying surface liquid, and adding 20 mu L ddH2And dissolving the O. Taking the DNA of the above-mentioned extracted transgenic and wild type Arabidopsis thaliana, and usingCgWRKY21PCR detection is carried out by specific primers of the gene.
ChunlanCgWRKY21After transgenic Arabidopsis thaliana, a total of 5 over-expressions were obtainedCgWRKY21A transgenic Arabidopsis line. The PCR results are shown in FIG. 4 with the recombinant plasmid as positive control, wild type as negative control, and water as blank control, and the positive control asCgWRKY21As for the result of gene vector PCR, water was used as a template for negative control, and wild type Arabidopsis DNA was used as a template for WT.
12) Phenotypic observations
Obtaining transgenic plants of different generations: the harvested transgenic T1 generation seeds are sterilized, screened and cultured, and then transplanted into nutrient soil to be cultured at 22 ℃ for 16 h in light/8 h in darkness; after detection, retaining the preliminarily confirmed transgenic plants, harvesting seeds of T1 generations after the plants are mature, and numbering to obtain T2 generations; like the T1 generation, seeds of the T2 generation are sterilized and then coated on a screening culture medium containing antibiotics, and the culture medium is placed at 22 ℃ for continuous illumination; performing survival rate statistics on T2 generation seeds with different numbers for about 10 days, selecting plants with 75% survival rate, transplanting the plants into nutrient soil, culturing the plants in the nutrient soil at 22 ℃ for 16 h in light/8 h in dark, and taking leaves for positive detection; continuously numbering positive T2 generation plants, and collecting seeds to obtain T3 generation seeds; sterilizing the seeds, screening by using a screening culture medium, and placing under the light for continuous illumination culture; around 10d, different numbered T3 generation plants were observed, all survived and no segregating homozygous plants for the T3 generation appeared.
The obtained transgenic lines were observed in batches.
(1) Selecting 3 transgenic plants with obvious phenotype for observation, as shown in figures 5 and 6, finding that compared with wild arabidopsis, the transgenic arabidopsis plants grow slowly,CgWRKY21compared with wild Arabidopsis WT, the different lotus plumule leaves in seedling stage have the phenomenon of growth and narrowing, the leaf shape is peculiar, but the leaf shape gradually returns to normal with the extension of growth period, which is similar to wild type, thus showing that the transgenic plant may cause dysplasia due to insufficient nutrition absorbed by roots in the early growth process, and simultaneouslyCgWRKY21The transgenic plants underwent early stem-forming and flowering, which indicates thatCgWRKY21It is possible to shorten the vegetative growth cycle and promote reproductive growth.
(2) Carrying out low-temperature stress treatment at 4 ℃ on transgenic arabidopsis thaliana, and detecting low-temperature related genesAtCOR47AtCOR15AAndAtRD29Athe expression quantity is shown in figure 7, and the result shows that 3 genes are obviously up-regulated under low-temperature stress in wild type arabidopsis thaliana and transgenic arabidopsis thaliana, but the expression level is obviously lower than that of WT, which indicates that CgWRKY21The over-expression of the gene has an inhibitory effect on the expression of the gene. In transgenesisCgWRKY21Plants andin WT, the AtCOR47 gene has no obvious change trend within 6h of low-temperature treatment, the expression is obviously up-regulated after 12h of treatment, but the expression level in WT is higher. AtCOR15A and AtRD29A genes were overexpressed in WTCgWRKY21The expression change patterns in the plants are similar, both are continuous up-regulation expression, the expression level reaches the peak value after 24 hours of treatment, and the expression level in an over-expression strain is obviously lower than that of the WT, which indicates thatCgWRKY21Overexpression of the genes suppressed the expression of the AtCOR47, AtCOR15A and AtRD29A genes. The expression quantity of the ABF4 gene in the over-expressed CgWRKY21 plant and WT is increased in different degrees, the change trend is up-regulated expression, the expression quantity is the highest at 24h, however, the expression quantity of the ABF4 gene in WT is obviously higher than that of the over-expressed geneCgWRKY21 And (5) plant growing. Over-expression of ABI5 GeneCgWRKY21Plants and WT are upregulated. The ABI5 gene is over-expressed within 12h of low-temperature treatmentCgWRKY21The expression level in the plant is obviously higher than that of WT, and the expression level is obviously lower than that of WT at 24 h.
This example shows cymbidium goeringii to be overexpressedCgWRKY2135S:CgWRKY21transferring into model plant Arabidopsis thaliana, and performing phenotype observation and analysis. As can be seen from the results, 35S was overexpressed: CgWRKY21the arabidopsis T2 generation plants have slow growth and development, the transgenic plants bloom in advance in the flowering period, and the plant height is larger than that of the wild plants;CgWRKY21overexpression of genes related to cold signal probably through regulationAtCOR47AtCOR15AAndAtRD29Athe expression of the gene affects the cold resistance of the plant.
Sequence listing
<110> Nanjing university of forestry
<120> cymbidium CgWRKY21 gene and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1026
<212> DNA
<213> Cymbidium goeringii
<400> 1
atggaggagg tggaggcggc taatagggct gccgtggaaa gcggccacag gctccttagc 60
ttgcttgcat cgaaggcgga agatgaggtc cagcatagaa gaaacgtcgt ggcggagact 120
ggggaagctg tttccagatt tagaaagtta gccgctttgc ttgggaatgg tgtgggacac 180
gcgagagtga ggagggcgaa actatctccg caacaaactc catttagtca tcaaaagctc 240
gtcttagatt cggcattagc ggcaaaggct agtcccagcg ccaatttgtt accacgaacg 300
ggagatttgg accgaagaat ctttctcgag aacaaaccag tggcacaaat cctttccgct 360
cctccgaatc ccgtccagct tgccgcacag ttccaatata ttcatcagca acagcaacaa 420
cagcaaaatc atgctttcca gcttcagcaa cacatcaagt tccaggctga aatgctaaga 480
agaggaaata gtggcggcat aaaccttaag tttgacactc ctagctgctc gcagaccatg 540
tcatcgacaa cacgatcttt tctatcatct ctgagcatgg atgcgagtgg gagtgtgtct 600
gggttagatg gcaagtcatt taacttgatt ggtggaccgc agtcatcgga gccatccaat 660
ctgcacacaa atccacggag gaggtgcact ggtagaggag aagatgggag tggaaaatgc 720
tctagcagtg gaagatgcca ctgctcgaag aaaaggaagt tgagagtgaa gagatccatt 780
aaggttcctg ccattagtaa taagcttgct gatatacctc ctgatgagta ttcttggagg 840
aagtacgggc agaagccaat caagggttct cctcatccta ggggatacta taagtgtagc 900
agcatgagag gctgtcctgc aagaaagcat gtggagaggt gcttggaaga cccttccatg 960
cttattgtta cttatgaagg tgagcacaat cacaccaggt taatgactca gtccgctcag 1020
acctga 1026
<210> 2
<211> 341
<212> PRT
<213> Cymbidium goeringii
<400> 2
Met Glu Glu Val Glu Ala Ala Asn Arg Ala Ala Val Glu Ser Gly His
1 5 10 15
Arg Leu Leu Ser Leu Leu Ala Ser Lys Ala Glu Asp Glu Val Gln His
20 25 30
Arg Arg Asn Val Val Ala Glu Thr Gly Glu Ala Val Ser Arg Phe Arg
35 40 45
Lys Leu Ala Ala Leu Leu Gly Asn Gly Val Gly His Ala Arg Val Arg
50 55 60
Arg Ala Lys Leu Ser Pro Gln Gln Thr Pro Phe Ser His Gln Lys Leu
65 70 75 80
Val Leu Asp Ser Ala Leu Ala Ala Lys Ala Ser Pro Ser Ala Asn Leu
85 90 95
Leu Pro Arg Thr Gly Asp Leu Asp Arg Arg Ile Phe Leu Glu Asn Lys
100 105 110
Pro Val Ala Gln Ile Leu Ser Ala Pro Pro Asn Pro Val Gln Leu Ala
115 120 125
Ala Gln Phe Gln Tyr Ile His Gln Gln Gln Gln Gln Gln Gln Asn His
130 135 140
Ala Phe Gln Leu Gln Gln His Ile Lys Phe Gln Ala Glu Met Leu Arg
145 150 155 160
Arg Gly Asn Ser Gly Gly Ile Asn Leu Lys Phe Asp Thr Pro Ser Cys
165 170 175
Ser Gln Thr Met Ser Ser Thr Thr Arg Ser Phe Leu Ser Ser Leu Ser
180 185 190
Met Asp Ala Ser Gly Ser Val Ser Gly Leu Asp Gly Lys Ser Phe Asn
195 200 205
Leu Ile Gly Gly Pro Gln Ser Ser Glu Pro Ser Asn Leu His Thr Asn
210 215 220
Pro Arg Arg Arg Cys Thr Gly Arg Gly Glu Asp Gly Ser Gly Lys Cys
225 230 235 240
Ser Ser Ser Gly Arg Cys His Cys Ser Lys Lys Arg Lys Leu Arg Val
245 250 255
Lys Arg Ser Ile Lys Val Pro Ala Ile Ser Asn Lys Leu Ala Asp Ile
260 265 270
Pro Pro Asp Glu Tyr Ser Trp Arg Lys Tyr Gly Gln Lys Pro Ile Lys
275 280 285
Gly Ser Pro His Pro Arg Gly Tyr Tyr Lys Cys Ser Ser Met Arg Gly
290 295 300
Cys Pro Ala Arg Lys His Val Glu Arg Cys Leu Glu Asp Pro Ser Met
305 310 315 320
Leu Ile Val Thr Tyr Glu Gly Glu His Asn His Thr Arg Leu Met Thr
325 330 335
Gln Ser Ala Gln Thr
340
<210> 3
<211> 17
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 3
atggaggagg tggaggc 17
<210> 4
<211> 18
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 4
tcaggtctga gcggactg 18
<210> 5
<211> 23
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 5
cccgggatgg aggaggtgga ggc 23
<210> 6
<211> 24
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 6
tacgtaggtc tgagcggact gagt 24
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 7
gatagtggaa aaggaaggtg 20
<210> 8
<211> 24
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 8
tacgtaggtc tgagcggact gagt 24

Claims (2)

1. The application of CgWRKY21 in shortening vegetative growth cycle of plants and promoting reproductive growth is disclosed, wherein the nucleotide sequence is shown as SEQ ID number 1; the method comprises the following steps: connecting the gene containing CgWRKY21 of cymbidium to a vector, transforming the gene to wild arabidopsis thaliana 'Columbia' through agrobacterium-mediated transformation, screening and culturing to obtain a transgenic plant.
2. The application of CgWRKY21 in controlling the cold sensitivity of arabidopsis thaliana is disclosed, wherein the nucleotide sequence is shown as SEQ ID number 1; the method comprises the following steps: connecting the gene containing CgWRKY21 of cymbidium to a vector, transforming the gene to wild arabidopsis thaliana 'Columbia' through agrobacterium-mediated transformation, screening and culturing to obtain a transgenic plant.
CN202010298792.0A 2020-04-16 2020-04-16 Cymbidium CgWRKY21 gene and application thereof Active CN111424040B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010298792.0A CN111424040B (en) 2020-04-16 2020-04-16 Cymbidium CgWRKY21 gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010298792.0A CN111424040B (en) 2020-04-16 2020-04-16 Cymbidium CgWRKY21 gene and application thereof

Publications (2)

Publication Number Publication Date
CN111424040A CN111424040A (en) 2020-07-17
CN111424040B true CN111424040B (en) 2022-05-13

Family

ID=71558025

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010298792.0A Active CN111424040B (en) 2020-04-16 2020-04-16 Cymbidium CgWRKY21 gene and application thereof

Country Status (1)

Country Link
CN (1) CN111424040B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109628467A (en) * 2019-01-30 2019-04-16 南京林业大学 A kind of Chunlan CgWRKY2 gene and its application

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX2019002154A (en) * 2016-08-25 2019-07-01 Univ Nagoya Nat Univ Corp Plant's character regulation method.

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109628467A (en) * 2019-01-30 2019-04-16 南京林业大学 A kind of Chunlan CgWRKY2 gene and its application

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Cymbidium ensifolium putative WRKY1 mRNA, complete cds;Yang,F.等;《GenBank Database》;20180414;Accession No.MF067542 *
Transcriptome sequence analysis and mining of SSRs in Jhar Ber (Ziziphus nummularia (Burm.f.) Wight & Arn) under drought stress;Radha Yadav等;《Scientific reports》;20180205;第8卷(第1期);第1-10页 *
低温胁迫下6种木兰科植物的生理响应及抗寒相关基因差异表达;李瑞雪等;《生态学报》;20181112(第08期);第243-258页 *
高温胁迫下文心兰对外源水杨酸的生理响应及WRKY基因的克隆;孔倩倩;《万方数据》;20180424;第1-62页 *

Also Published As

Publication number Publication date
CN111424040A (en) 2020-07-17

Similar Documents

Publication Publication Date Title
CN109628467A (en) A kind of Chunlan CgWRKY2 gene and its application
CN106834314B (en) Millet stress resistance gene SiR L K35, encoding protein and application
CN109679968A (en) A kind of Chunlan CgWRKY57 gene and its application
CN109423492B (en) Application of SlTOE1 gene in regulation and control of flowering time and yield of tomatoes
CN107630020A (en) Cotton GhTCP4 genes and its application in cotton fiber length is improved
CN111424037B (en) Cymbidium CgWRKY70 gene and application thereof
CN111304222B (en) Cymbidium CgWRKY11 gene and application thereof
CN111304220B (en) Cymbidium CgWRKY3 gene and application thereof
CN111454966B (en) Cymbidium CgWRKY4 gene and application thereof
CN111304223B (en) Cymbidium CgWRKY24 gene and application thereof
CN115851823B (en) Cymbidium CgARF18 gene and application thereof
CN110951771B (en) Chinese cymbidiummiR390aApplication in controlling plant root system development
CN111424040B (en) Cymbidium CgWRKY21 gene and application thereof
CN110904106B (en) Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity
CN108752446B (en) Myrica rubra MrLFY gene and application thereof
CN111424038B (en) Cymbidium CgWRKY40 gene and application thereof
CN111424041B (en) Cymbidium CgWRKY49 gene and application thereof
CN111424039B (en) Cymbidium CgWRKY65 gene and application thereof
CN111304221B (en) Cymbidium CgWRKY31 gene and application thereof
CN111304198B (en) Application of cymbidium goeringii miR390b in controlling plant vegetative organ development
CN110982921B (en) Application of cymbidium miR159a in accelerating plant life cycle
CN109628468A (en) A kind of Chunlan CgWRKY53 gene and its application
CN104450749A (en) Flower-specific expression vector of cucumber CsLOX1 gene and application of flower-specific expression vector
CN110964724B (en) Application of cymbidium goeringii miR390c in enhancing cold resistance of plants
CN116254288B (en) Application of cymbidium MIR156b gene in regulating and controlling flowering time of plants

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant