CN111424040A - Cymbidium CgWRKY21 gene and application thereof - Google Patents

Abstract

The invention discloses a Chinese cymbidiumCgWRKY21A coding gene and an application thereof,CgWRKY21the nucleotide sequence of the gene is shown as SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown as SEQ ID NO. 2. The invention relates to a cymbidium goeringii cultivated variety 'Songmei'CgWRKY21Cloning and identification of genes, analysis of gene expression, and verification of their function, discoveryCgWRKY21In the seedling stage of transgenic arabidopsis, different strains of rosette young leaves grow and narrow compared with wild arabidopsis WTThe leaf shape is peculiar, but the leaf shape gradually returns to normal along with the extension of the growth period, and is similar to the wild type, which indicates that the transgenic plant may cause dysplasia due to insufficient nutrition absorbed by roots in the early growth process, and simultaneouslyCgWRKY21The transgenic plants underwent early stem-forming and flowering, which indicates thatCgWRKY21It is possible to shorten the vegetative growth cycle and promote reproductive growth, and thus the gene may have wide application in improving orchid flower character.

Description

Cymbidium CgWRKY21 gene and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to cymbidium goeringiiCgWRKY21Genes and their use.

Background

The orchid family (Orchidaceae) is one of the largest of the flowering plants, and contains 25000 or more species worldwide, accounting for about 10% of all flowering plants. Goering cymbidium (A. fern)Cymbidium goeringii) Belongs to the species of floret type Geshenlan in orchid family, and has peculiar flower type, light flower color, delicate flower fragrance, beautiful leaf appearance and high ornamental value and economic value. The cymbidium goeringii has high requirements on the growth environment, is very easily influenced by severe environments such as high temperature, low temperature, drought and the like in the growth process, and can cause the reduction of the ornamental quality of gardening and even the death of plants in severe cases. Therefore, the research on the molecular mechanism of plants for coping with abiotic stress and the identification of genes with stress resistance function are of great significance to the breeding and production of cymbidium goeringii. In a plant cell signal transduction pathway, the WRKY transcription factor is considered as a key pivot of plant growth and various stress responses, and provides an important basis for genetic improvement of plants.

WRKY transcription factors are one of the largest families of regulatory proteins in plants, involved in a variety of physiological processes, the most prominent of which are stress responses to biotic and abiotic stresses. The WRKY gene is reported to enhance the tolerance of plants to adversity stress. The sunflower HaWRKY76 transgenic plant shows stronger stress resistance to waterlogging stress, and the yield is also obviously increased.AtWRKY25The overexpression of (a) enhances the salt tolerance of Arabidopsis thaliana.AtWRKY57The over-expression in rice not only improves the drought resistance of rice, but also enhances the tolerance of the rice to salt and PEG. Therefore, it is obtained by cloning from cymbidium goeringii by using genetic engineering technologyCgWRKY21The gene has obvious expression difference under low temperature stress, so it will be used in treating diabetesCgWRKY21The gene is transferred into plants, and has great application prospect.

Different plants have different gene sequences even if they are of the same gene family, and even if more than 80% of the gene sequences are identical, the functions of transferring some genes into plants are different because of different insertion sites. When a foreign gene enters a chromosome, a foreign protein encoded by the gene is generated, the foreign protein or enzyme causes the activity of other enzymes or proteins to be enhanced or reduced through a series of reactions, and when the foreign gene is embedded in a certain segment of the chromosome, the whole chromosome is influenced, so that the activity or the regulation mechanism of other genes is influenced.

Even if the same gene is inserted, the same gene is inevitably influenced on the chromosome due to different insertion sites or different chromosome groups, and further influences the gene on the chromosome, and slight changes of the gene can influence the regulation mechanism, so that the changes of gene inactivation, activity reduction, activity enhancement and the like can be caused, and the gene action is different, and the gene action can be obtained only by verification and can not be obtained by inference.

Disclosure of Invention

The purpose of the invention is as follows: aiming at the defects in the prior breeding technology, the invention aims to provide the cymbidium goeringiiCgWRKY21A gene. Another object of the present invention is to provide cymbidium goeringiiCgWRKY21The application of the gene in orchid breeding.

The technical scheme is as follows: in order to achieve the purpose of the invention, the technical scheme adopted by the invention is as follows:

a kind of Chinese cymbidiumCgWRKY21The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

The cymbidium goeringiiCgWRKY21The amino acid sequence of the gene expression protein is shown in SEQ ID NO. 2.

The cymbidium goeringiiCgWRKY21The use of genes in plant production and breeding.

Contains the cymbidium goeringiiCgWRKY21A vector for the gene.

Contains the cymbidium goeringiiCgWRKY21A host cell for the gene.

Has the advantages that: compared with the prior art, the invention has the advantages that the cymbidium goeringii is treatedCgWRKY21Cloning and identification of gene, expression analysis of gene, verification of its function, finding over-expressionCgWRKY21Compared with wild Arabidopsis WT, the different lotus seed young leaf strains of the transgenic Arabidopsis plant in the seedling stage have the phenomenon of growth and narrowing, the leaf shape is peculiar, but the leaf shape gradually returns to normal along with the extension of the growth period, and the similar wild Arabidopsis plant shows that the transgenic plant can cause dysplasia due to insufficient nutrition absorbed by roots in the early growth process, and simultaneouslyCgWRKY21The transgenic plant shoots and blooms in advance, so that the gene has wide application in the production and breeding of orchid and other plants.

Drawings

FIG. 1 is cymbidium goeringiiCgWRKY21Gene cloning and constructed over-expression vector map;

FIG. 2a is a drawingCgWRKY21Expression in various tissues of cymbidium goeringii, wherein R represents a root, P represents a pseudobulb, L represents a leaf, F represents a flower, and b represents cymbidium goeringii under low-temperature stressCgWRKY21The expression of the gene;

FIG. 3a is a diagram showing the results of the cleavage, wherein M is D L2000 Marker;CgWRKY21b, performing double enzyme digestion by SmaI and SnaBI after being connected with pBI121, wherein the picture b is a screening picture of a positive recombinant, wherein M is D L2000 Marker, and the size of a target band is 1026 bp;

FIG. 4 is a diagram showing the PCR results of transgenic Arabidopsis plants, where M: D L2000 Marker and CK⁺: taking vector plasmid DNA as a positive control; CK (CK)^-: wild type DNA is negative control; water: blank control;

FIG. 5 is a view of a rotary tableCgWRKY21Comparing the plant type of the gene plant with that of a wild type arabidopsis plant, wherein WT is shown in the figure, and the wild type arabidopsis is shown in the figure; 1-3, turningCgWRKY21Different strains of genes;

FIG. 6 is a view of a rotary tableCgWRKY21Comparing the plant type of the gene plant with that of a wild type arabidopsis plant, wherein WT is shown in the figure, and the wild type arabidopsis is shown in the figure; 1-3, turningCgWRKY21Different strains of genes;

FIG. 7 is a view of a rotary drumCgWRKY21The gene plant and wild arabidopsis thaliana are stressed at low temperature and are in cold stress phaseThe related gene expression is compared with the map.

Detailed Description

The present invention will be further described with reference to the following specific examples.

Example 1

The material used in this example was the "songmei" leaf of cymbidium goeringii, which was snap frozen in liquid nitrogen after harvesting and stored in an ultra-low temperature freezer (-80 ℃).

1) Extraction of total RNA from cymbidium goeringii leaves

The method is carried out according to the instruction of a TaKaRa plant total RNA extraction kit, and comprises the following specific operations:

rapidly transferring cryopreserved cymbidium leaves into a mortar precooled with liquid nitrogen, grinding the tissue with a pestle while continuously adding liquid nitrogen until the tissue is ground into powder, adding the ground sample into a 1.5m L sterilized Tube containing 450. mu.l Buffer PE, repeatedly blowing the Tube with a pipette until no obvious precipitate is formed in the lysate, centrifuging the lysate at 4 ℃ for 5min at 12,000 rpm, carefully sucking the supernatant into a new 1.5m L sterilized Tube, adding 1/10 volumes of Buffer NB to the supernatant, mixing with Vortex oscillation at 12,000 rpm, centrifuging at 4 ℃ for 5min, carefully sucking the supernatant into a new 1.5m L0 sterilized Tube, adding 450. mu.6. mu.1 Buffer R L, mixing the solutions uniformly using a pipetting gun, adding 1/2 volumes of absolute ethanol, transferring the solutions uniformly into a pipette gun, immediately transferring the solutions into a RNA Column at 4835 rpm, placing the filtrate at 450. mu.1 min, settling the filtrate in 300. mu.2 rpm, adding the filtrate into a 5 μm Column RNA Column Buffer DNA Column, adding the filtrate, centrifuging the filtrate at 500. mu.000 rpm, adding 2. mu.000 rpm, adding RNA to a Column RNA Column DNA Column of the filtrate, centrifuging the mixture, adding 2 Column DNA of the filtrate, adding 2 to a Column DNA Column of Column DNA Column of Column DNA Column of Column DNA Column of Column 2, adding the Column DNA Column of Column DNA, adding the Column DNA Column of Column DNA, adding 2, centrifuging at 500 rpm, adding the Column DNA Column of Column DNA Column of Column DNA Column of Column DNA, adding 2, adding the Column DNA Column of Column DNA₂Standing at room temperature for 5min at 12,000 deg.CThe RNA was eluted by centrifugation at rpm for 2 min. The obtained RNA is stored in a refrigerator at minus 80 ℃ for later use after concentration and purity detection.

2 mu L RNA is absorbed and detected by 1% agarose gel electrophoresis, the result shows that 28S and 18S bands are clearer, the brightness of the 28S band is about twice of 18S, the RNA quality is better, and the RNA purity and OD are detected by a micro-computerised protein analyzer₂₆₀/OD₂₈₀Is 2.01, OD₂₆₀/OD₂₃₀2.03, better integrity, can be used for reverse transcription.

2) Synthesis of first Strand cDNA

The total RNA obtained was used as a template, reverse transcription was performed using a TaKaRa reverse transcription kit, and oligo (dT) was used as an anchor primer, and first strand cDNA was synthesized by reverse transcription. The specific operation is as follows:

the mix was prepared in the order of template RNA/Primer in a centrifuge tube at a total of 10. mu. L for template 1. mu.g, oligo (dT) Primer (50. mu.M) 1. mu. L mix (10mM reach) 1. mu. L, and the remaining volume was treated with RNase-freeddH₂After completion of the O addition, the mixture was kept at 65 ℃ for 5min and rapidly cooled on ice, the tube was centrifuged to deposit the mixture in the tube at the bottom, and a reverse transcription reaction solution (20. mu. L) was prepared in a new tube, which was denatured, 10. mu. L, 5 × PrimeScriptBuffer 4. mu. L Inhibitor (40U/. mu.l) 0.5. mu. L RTase (200U/. mu.l) 1. mu. L FreedH₂And O is supplemented by 20 mu L, the mixture is slowly shaken up, and is put on a PCR instrument for heat preservation for 10min at the temperature of 30 ℃, for heat preservation for 30min at the temperature of 42 ℃ and for heat preservation for 5min at the temperature of 95 ℃ to inactivate the enzyme, and the cDNA solution is obtained after the mixture is placed on ice.

3) Design and cloning of target gene primer

Based on existing sequencing data for the cymbidium transcriptome, using other speciesWRKYBlast homology alignment is carried out on related gene sequences. Corresponding primers are designed by utilizing Oligo6.0 and Prime5.0, and the sequences of the primers are as follows:

CgWRKY21-F：

5'- ATGGAGGAGGTGGAGGC -3'，

CgWRKY21-R：

5'- TCAGGTCTGAGCGGACTG -3'。

using the first strand of cDNA as a template and using PriMerstar Max Hi enzyme for cymbidium goeringiiCgWRKY2The PCR amplification system (50. mu. L) was 25. mu.l L PrimerStar Max, 2. mu. L Forward Primer, 2. mu. L Reverseprimer, 2. mu. L Template DNA, 19. mu. L ddH₂And O. The PCR procedure was: the reaction conditions are pre-denaturation at 94 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 5s, extension at 72 ℃ for 30s, 32 cycles, total extension at 72 ℃ for 5min and heat preservation at 16 ℃.

After the PCR reaction is completed, taking all PCR products, detecting by 1.5% agarose gel electrophoresis, cutting target fragments, recovering and purifying PCR target amplification products by gel, adopting DNA gel recovery kit of Tiangen company to purify and recover target fragments, specifically, adding 500 mu L equilibrium liquid B L into an adsorption column CA2 (the adsorption column is placed into a collecting tube), centrifuging at 12000rpm for 1min, pouring off waste liquid in the collecting tube, placing the adsorption column back into the collecting tube again, cutting a single target strip from agarose gel, placing the cut strip into a clean centrifugal tube, weighing the weight of the cut strip, adding an isovolumetric solution PN (if the gel is 0.1g and the volume of the cut strip can be regarded as 100 mu L, adding 100 mu L PN solution), placing in a water bath at 50 ℃, turning over the centrifugal tube up and down gently until the gel block is completely dissolved, adding the obtained in the previous step into a CA2, placing the centrifugal tube at room temperature for 2min, 12000rpm for 1min, pouring off the collecting tube, placing CA 5631 into the adsorption column, placing the adsorption column into the collecting tube, placing the centrifugal tube at L min, adding a rinsing liquid, placing the centrifugal tube into a centrifugal tube, placing the centrifugal tube at 12000rpm, removing the centrifugal tube, placing the centrifugal tube for 2min, placing the centrifugal tube at the centrifugal tube, placing the centrifugal₂O, standing at room temperature for 2min, centrifuging at 12000rpm for 2min to collect DNA solution, collecting purified product of 2 μ L, and detecting by gel electrophoresis using 1% agarose.

4) Ligation of the fragment of interest to the vector

The cloning Vector was pEASY-Blunt Vector from the entire gold company, and the ligation reaction was carried out in a ligation system (5. mu. L) of 4. mu. L PCR purified product and 1. mu. L pEASY-Blunt Vector, which were gently pipetted and mixed, and then the mixture was left at room temperature for 5min, and the tube was placed on ice.

5) Conversion of ligation products

The competent cell Trans5 α strain was taken out from the ultra-low temperature refrigerator, placed on ice to melt, 5. mu. L of overnight ligation product was taken up and added to 100. mu. L of competent cells, the centrifuge tube was placed on ice for 30min, water bath was carried out in a 42 ℃ water bath kettle with heat shock for 90s without shaking, immediately placed on ice for 2min, 800. mu. L of antibiotic-free liquid medium was added to the super clean bench, thawed by shaking at 37 ℃ and 180 rpm for 1h, centrifuged at 4000rpm for 3min, 800. mu. L supernatant was aspirated, and the precipitated cells were resuspended and smeared on L B plates (Amp concentration 100 mg/L) and cultured overnight at 37 ℃.

6) Screening and validation of recombinant plasmids

Single colonies grown overnight on L B solid medium containing antibiotic (Amp) were picked and inoculated into L B liquid medium containing 750. mu. L of the same antibiotic at 200 rpm and 37 ℃ overnight.

The PCR amplification system comprises 10u L Green TaqMix, 1 mu l M13-F/R, 1 mu L bacterial liquid and 7 mu L ddH₂O was replenished to 20. mu. L.

The PCR procedure was: 10min at 94 ℃; 30 cycles at 94 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 1 min; 5min at 72 ℃; at 16 ℃ forever.

And absorbing a PCR product of 5 mu L for agarose gel electrophoresis detection analysis, verifying, entrusting the bacterial liquid sample with correct strip size to sequencing by Nanjing Kingsry Biotechnology Co., Ltd, and performing comparative analysis on the sequencing result on NCBI by using a sequencing primer which is a universal primer M13F/R.

According to the analysis of the sequencing result, 1 cymbidium can be finally obtained by determining the cloneWRKYThe coding gene is namedCgWRKY21The nucleotide sequence of the gene is shown as SEQ ID NO.1,CgWRKY21the gene coding length is 1026bp, the ATG start codon and the TGA stop codon are contained, wherein the total length of the ORF is 1026bp, 341 amino acid proteins are coded, and the amino acid sequence of the proteins is shown as SEQ ID NO. 2.

Example 2

The research result shows thatWRKY21The gene was expressed in various tissues and organs in cymbidium (FIG. 2 a), but the gene was expressed in various tissues and organsThe highest expression level in the cymbidium indicates that the gene has active function in flowers. Expression analysis of low temperature stress treated leaves of cymbidium goeringii (FIG. 2 b) demonstratedCgWRKYThe 21 gene plays an important regulatory role in the low-temperature stress response of cymbidium goeringii leaves.

The plant material used in this example was Arabidopsis thaliana (Arabidopsis thaliana) Col (Columbia) wild type seeds.

The E.coli strain used in this example was Trans5 α, the Agrobacterium strain was GV3101, which was used to transform Arabidopsis thaliana, respectively, and the plant expression vector used in the experiment was pBI121, which were purchased from holotype gold and prism, respectively.

1）CgWRKY21Construction of Gene overexpression vectors

Obtained in example 1CgWRKY21The full-length sequence of the gene ORF is connected with a plant expression vector pBI121, and the constructed vector is shown in figure 1.

2) And (3) plasmid extraction:

extracting plasmids according to the specification of the small-extraction medium-volume kit of the Tiangen plasmids, and specifically comprising the following steps:

centrifuging overnight-cultured 10m L bacteria solution at 12000rpm for 1min, removing supernatant, adding 500 μ L P1 solution (containing RNaseA) into centrifuge tube containing thallus precipitate, suspending thallus precipitate completely with vortex apparatus, adding 500 μ L P2 solution into centrifuge tube, cracking thallus fully when turning up and down gently, adding 700 μ L P3 solution into centrifuge tube, turning up and down gently, mixing well, centrifuging at 12000rpm for 10min after white flocculent precipitate appears, adding 500 μ L equilibrium solution B L into adsorption column CP4, centrifuging at 12000rpm for 1min, removing waste liquid in collection tube, returning adsorption column to collection tube, adding collected supernatant into filtration column CS in batches, centrifuging at 12000rpm for 2min, adding collected solution into adsorption column CP 632 in batches, centrifuging at 12000rpm for 1min, removing waste liquid in collection tube, returning adsorption column 4 to collection tube, removing PD 3 column, adding supernatant into adsorption column, adding supernatant into collection tube L min, adding supernatant into adsorption column CP column, centrifuging, adding supernatant into adsorption column, adding PW 4642 min, adding PW 84, centrifuging again, adding PW 465 μ 465 l water (containing no PW) and centrifugingCentrifuging at 12000rpm for 1min in adsorption column CP4, removing waste liquid in the collection tube, returning adsorption column CP4 to the collection tube, centrifuging at 12000rpm for 2min, removing residual rinse liquid in the adsorption column, transferring adsorption column CP4 to new 1.5ml centrifuge tube, adding 60 μ L ddH into the middle of adsorption membrane₂O; standing at room temperature for 2min, centrifuging at 12000rpm for 1min, and collecting the solution in the centrifuge tube as plasmid. Finally, the plasmid concentration was determined and prepared for the next experiment.

3) Addition of specific cleavage sites

cDNA is taken as a template, and specific enzyme cutting sites are added on two sides of a target gene by a PCR method. Chinese cymbidiumCgWRKY21SmaI and SnaBI enzyme cutting sites are added on both sides of the gene. The PCR reaction system, procedure and primers used were as follows:

PCR amplification System (50. mu. L) 25. mu. L PrimerStar Max, 2. mu. L Forward Primer, 2. mu. L Reverseprimer, 2. mu. L Template DNA, 19. mu. L ddH₂And O. The PCR procedure was: the reaction conditions are pre-denaturation at 94 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 5s, extension at 72 ℃ for 30s, 32 cycles, total extension at 72 ℃ for 5min and heat preservation at 16 ℃.

The primer sequences used were:

CgWRKY21-SmaI-F：5'- CCCGGGATGGAGGAGGTGGAGGC -3'，

CgWRKY21-SnaBI-R：5'- TACGTAGGTCTGAGCGGACTGAGT -3'

the obtained PCR product was separated by 1.5% agarose gel electrophoresis, recovered and purified using a Tiangen agarose gel DNA recovery kit, and the recovered product was ligated with the pBI121 vector to construct an expression vector.

4) Double enzyme digestion reaction

Digesting the extracted pBI121 plasmid with SmaI and SnaBI at 37 deg.c for 15min, electrophoretically recovering linear vector, and storing at-20 deg.c for further use, wherein the double digestion reaction system is 50 μ L, pBI121 plasmid 20 μ L, 5 × buffer 5 μ L1 μ L1 μ L, ddH₂O23 mu L, the enzyme cutting result is shown in figure 3a, wherein M is D L2000 Marker, 1:CgWRKY21after ligation with pBI121, SmaI and SnaBI were used for double digestion.

5) Ligation reaction

Agarose gel electrophoresis is used for detecting a target gene and a vector pBI121 recovered after enzyme digestion, and according to the detected purity and concentration, all reagents are added according to a connection system, wherein the number of target fragment molecules is =3:1-5:1, the connection reaction system is a linearized pBI121 vector 7 mu L, an insert fragment 3 mu L, a 5 × CE II buffer 4 mu l, an Exnase II 2 mu l and a ddH2OUp to 20 mu L, the reaction is carried out for 30min at 37 ℃, and the reaction is placed on ice for cooling.

6) Transfer of the ligation product into E.coli

The product of the ligation of the desired fragment with the vector pBI121 was transferred into competent cells of E.coli Trans5 α in the same manner as in example 1.

7) Identification of recombinants

Selecting a single colony on a plate, inoculating the single colony into L B liquid culture medium containing antibiotic (kanamycin), carrying out shake culture at 37 ℃ and 200 rpm overnight, carrying out bacterial liquid PCR by using a target gene full-length primer to screen a positive clone, sequencing the screened positive clone by Nanjing Kingsry company, extracting plasmids by using a Tiangen plasmid extraction kit, carrying out enzyme digestion verification, judging whether the sizes of fragments after enzyme digestion are consistent or not, and judging the result to be shown in figure 3B, wherein the size of a band is 1026 bp.

8) Preparation and transformation of Agrobacterium-infected competent cells

The agrobacterium is used for preparing agrobacterium-induced competence for carrying out an infection experiment of arabidopsis thaliana by using agrobacterium GV3101, and the agrobacterium-induced competence preparation process comprises the steps of selecting an activated agrobacterium single colony, inoculating the agrobacterium-induced competence in a 5m L liquid L B culture medium, carrying out shake culture at 28 ℃ and 250rpm for 20-24 h, absorbing 2m L bacterial liquid, inoculating the agrobacterium-induced competence in a triangular flask containing a 50m L liquid L B culture medium, carrying out shake culture at 28 ℃ and 250rpm to OD₆₀₀The value is about 0.8, the bacterial liquid after the propagation is put on ice and iced for 30min, the temperature is 4 ℃, the centrifugal speed is 5000 rpm for 5min, the supernatant is discarded, 10m L precooled 0.1 mo 1/L CaCl is added₂Suspending the precipitated thallus thoroughly, centrifuging at 4 deg.C and 5000 rpm for 5min, discarding supernatant, adding 1m L precooled 20 mm O1/L CaCl₂Fully suspending the thalli by the solution to obtain GV3101 competent cells to be prepared, subpackaging the competent cells into 100 mu L/tube by a centrifuge tube, and rapidly adding the competent cells into the tube20% of sterile glycerol, and storing at-80 ℃.

Agrobacterium transformation of recon, namely, thawing agrobacterium competent cells by ice bath, adding 1 to 5 mul of recovered and purified plasmid into 200 mul of agrobacterium competent cells, lightly mixing uniformly, performing ice bath for 30min, quickly freezing for l min by using liquid nitrogen, thermally shocking in a water bath kettle at 37 ℃ for 1 to 5min, quickly placing on ice for 1 to 2min, adding 800 mul of L B culture medium without any antibiotic, recovering for 2 to 4h at 28 ℃ and 100 rpm, centrifuging for 3min at 4000rpm, sucking off part of the culture medium, fully mixing the rest of bacteria liquid by using a liquid transfer gun, smearing on a solid L B culture medium added with 50 mg/L kanamycin and 50 mg/L streptomycin (EHA 105) or 100 mg/L gentamycin (GV 3101), and performing inverted culture for 30 to 48 h at 28 ℃.

Identification of Agrobacterium recombinants: picking out single colony from the plate culture medium, and inoculating the single colony in a liquid culture medium containing corresponding antibiotics; culturing at 28 deg.C and 220 rpm overnight; carrying out PCR on the bacterial liquid by respectively matching 35S-F with the following primers, wherein the sequences of the primers are as follows:

35S-F：5'-GATAGTGGAAAAGGAAGGTG-3'，

35S-CgWRKY21-R：5'- TACGTAGGTCTGAGCGGACTGAGT -3'。

detecting the PCR product by 1% agarose gel electrophoresis to identify whether the PCR product contains a target fragment; identifying positive clones, performing amplification culture, extracting plasmids by an alkaline lysis method, and performing double enzyme digestion verification; and adding a proper amount of sterile glycerol into the identified positive clone, and storing at-80 ℃ for later use.

9) Agrobacterium-mediated transformation of Arabidopsis thaliana

The method comprises the specific operation steps of maintaining healthy growth state of arabidopsis (col wild type) until the arabidopsis flowers, activating agrobacterium EHA105 strain carrying the target gene, selecting a single colony, inoculating the single colony on L B culture medium containing 5m L kanamycin and streptomycin, shaking the bacteria at 28 ℃ and 250rpm until the bacteria become turbid just and the bacteria is about 8-10 hours, sucking 1m L bacteria liquid, inoculating the bacteria liquid into a triangular flask (50m L) for shaking the bacteria for 24 hours until the OD value is about 0.8, centrifuging the bacteria liquid at 5000 rpm for 5min at room temperature, removing supernatant, collecting the bacteria, suspending the bacteria with 5% sucrose solution, adding Silwet L-77 at the concentration of 0.05% (500 mu l/L) before soaking, shaking out foams, soaking the overground part of arabidopsis in agrobacterium suspension solution for 15-30 seconds, slightly shaking, laying the soaked arabidopsis thaliana in a tray covered with a foil, sealing the foil, placing the arabidopsis thaliana in a sealed box, placing the box for 24 hours, and culturing the arabidopsis thaliana in a light-shielding condition, and watering the foil to grow.

The 5% sucrose solution resuspension comprises the following components of MS culture medium, sucrose 50 g/L0.5.5 g/L and Silwet-77500 mu l/L (note: after preparation, pH is adjusted to 5.8, after bacterial liquid is centrifugally resuspended, Silwet L-77 is added, and the conversion relation between resuspension liquid and bacterial liquid is that the dosage of resuspension liquid is bacterial liquid OD bacterial liquid volume =0.8 bacterial liquid resuspension).

10) Screening of transgenic plants

The collected seeds of transgenic Arabidopsis thaliana of T1 generation are sterilized by alcohol and mercuric chloride, and the method comprises placing appropriate amount of the obtained transgenic seeds in a centrifuge tube of 1.5m L, soaking in 75% alcohol for 30s, sterilizing with 10% sodium hypochlorite for 2min for 30s, washing with sterile water for 3-4 times, replacing the sterilized new centrifuge tube after the first washing, and suspending with 0.1% agarose solution.

The sterilized transgenic Arabidopsis seeds were sown on 1/2MS solid medium containing antibiotics (kanamycin 50 mg/L and cefamycin 100 mg/L), cultured at 22 ℃ under light, and after about one week, Arabidopsis seeds which can normally grow on the medium were transplanted into soil and continued to grow.

11) Detection of transgenic plants

Taking a proper amount of young leaves of arabidopsis thaliana and transgenic plants, and extracting DNA by adopting a CTAB method, wherein the specific operation steps comprise placing a proper amount of leaves in a sterilized 2m L centrifuge tube, adding 700 mu l of CTAB solution, thoroughly grinding by using a ball mill, standing for 10min at 65 ℃, adding chloroform and isoamylol with the same volume, reversing for several times to mix the leaves uniformly, centrifuging for 10min at 14000rpm, transferring supernatant into a new sterile centrifuge tube, adding isopropanol with the same volume, reversing for several times to mix the leaves uniformly, standing for 2min at room temperature, centrifuging for 10min at 14000rpm, pouring out supernatant, adding 70% absolute ethyl alcohol, blowing and washing twice by using a liquid transfer gun, centrifuging for 1min at 14000rpm, and discarding the supernatant;drying surface liquid, and adding 20 mu L ddH₂And dissolving the O. Taking the DNA of the above-mentioned extracted transgenic and wild type Arabidopsis thaliana, and usingCgWRKY21PCR detection is carried out by specific primers of the gene.

Chinese cymbidiumCgWRKY21After transgenic Arabidopsis thaliana, a total of 5 over-expressions were obtainedCgWRKY21A transgenic Arabidopsis line. The PCR results are shown in FIG. 4 with the recombinant plasmid as positive control, wild type as negative control, and water as blank control, and the positive control asCgWRKY21As for the result of gene vector PCR, water was used as a template for negative control, and wild type Arabidopsis DNA was used as a template for WT.

12) Phenotypic observations

Obtaining transgenic plants of different generations: the harvested transgenic T1 generation seeds are sterilized, screened and cultured, and then transplanted into nutrient soil to be cultured at 22 ℃ for 16 h in light/8 h in darkness; after detection, retaining the preliminarily confirmed transgenic plants, harvesting seeds of T1 generations after the plants are mature, and numbering to obtain T2 generations; like the T1 generation, seeds of the T2 generation are sterilized and then coated on a screening culture medium containing antibiotics, and the culture medium is placed at 22 ℃ for continuous illumination; performing survival rate statistics on T2 generation seeds with different numbers for about 10 days, selecting plants with 75% survival rate, transplanting the plants into nutrient soil, culturing the plants in the nutrient soil at 22 ℃ for 16 h in light/8 h in dark, and taking leaves for positive detection; continuously numbering positive T2 generation plants, and collecting seeds to obtain T3 generation seeds; sterilizing the seeds, screening by using a screening culture medium, and placing under the light for continuous illumination culture; around 10d, different numbered T3 generation plants were observed, all survived and no segregating homozygous plants for the T3 generation appeared.

The obtained transgenic lines were observed in batches.

(1) Selecting 3 transgenic plants with obvious phenotype for observation, as shown in figures 5 and 6, finding that compared with wild arabidopsis, the transgenic arabidopsis plants grow slowly,CgWRKY21compared with wild Arabidopsis WT, the different lotus seed young leaf strains of the transgenic plant in the seedling stage have the phenomenon of growth and narrowing, the leaf shape is peculiar, but the leaf shape gradually returns to normal along with the extension of the growth period, and the similarity with the wild type shows that the transgenic plant may be in the early stageThe growth process is accompanied by the deficiency of nutrients absorbed by the roots, which leads to dysplasia and at the same timeCgWRKY21The transgenic plants underwent early stem-forming and flowering, which indicates thatCgWRKY21It is possible to shorten the vegetative growth cycle and promote reproductive growth.

(2) Carrying out low-temperature stress treatment at 4 ℃ on transgenic arabidopsis thaliana, and detecting low-temperature related genesAtCOR47、AtCOR15AAndAtRD29Athe expression quantity is shown in figure 7, and the result shows that 3 genes are obviously up-regulated under low-temperature stress in wild type arabidopsis thaliana and transgenic arabidopsis thaliana, but the expression level is obviously lower than that of WT, which indicates thatCgWRKY21The over-expression of the gene has an inhibitory effect on the expression of the gene. In transgenesisCgWRKY21In plants and WT, the AtCOR47 gene has no obvious change trend within 6h of low-temperature treatment, the expression is obviously up-regulated after 12h of treatment, but the expression level in WT is higher. AtCOR15A and AtRD29A genes were overexpressed in WTCgWRKY21The expression change patterns in the plants are similar, both are continuous up-regulation expression, the expression level reaches the peak value after 24 hours of treatment, and the expression level in an over-expression strain is obviously lower than that of the WT, which indicates thatCgWRKY21Overexpression of the genes suppressed the expression of the AtCOR47, AtCOR15A and AtRD29A genes. The expression level of the ABF4 gene in the over-expressed CgWRKY21 plant and WT are increased to different degrees, the change trend is up-regulated expression, the expression level is highest at 24h, however, the expression level of the ABF4 gene in WT is obviously higher than that of the over-expressed geneCgWRKY21And (5) plant growing. Over-expression of ABI5 GeneCgWRKY21Plants and WT are upregulated. The ABI5 gene is over-expressed within 12h of low-temperature treatmentCgWRKY21The expression level in the plant is obviously higher than that of WT, and the expression level is obviously lower than that of WT at 24 h.

This example shows cymbidium goeringii to be overexpressedCgWRKY2135S:CgWRKY21the transgenic plants were transformed into Arabidopsis thaliana, and phenotypic observation and analysis were performed. As can be seen from the results, 35S was overexpressed:CgWRKY21the arabidopsis T2 generation plants have slow growth and development, the transgenic plants bloom in advance in the flowering period, and the plant height is larger than that of the wild plants;CgWRKY21overexpression of genes related to cold signal probably through regulationAtCOR47、AtCOR15AAndAtRD29Aexpression of genes affecting plantsThe cold resistance of (1).

Sequence listing

<110> Nanjing university of forestry

<120> cymbidium CgWRKY21 gene and application thereof

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>1026

<212>DNA

<213> Cymbidium goeringii

<400>1

atggaggagg tggaggcggc taatagggct gccgtggaaa gcggccacag gctccttagc 60

ttgcttgcat cgaaggcgga agatgaggtc cagcatagaa gaaacgtcgt ggcggagact 120

ggggaagctg tttccagatt tagaaagtta gccgctttgc ttgggaatgg tgtgggacac 180

gcgagagtga ggagggcgaa actatctccg caacaaactc catttagtca tcaaaagctc 240

gtcttagatt cggcattagc ggcaaaggct agtcccagcg ccaatttgtt accacgaacg 300

ggagatttgg accgaagaat ctttctcgag aacaaaccag tggcacaaat cctttccgct 360

cctccgaatc ccgtccagct tgccgcacag ttccaatata ttcatcagca acagcaacaa 420

cagcaaaatc atgctttcca gcttcagcaa cacatcaagt tccaggctga aatgctaaga 480

agaggaaata gtggcggcat aaaccttaag tttgacactc ctagctgctc gcagaccatg 540

tcatcgacaa cacgatcttt tctatcatct ctgagcatgg atgcgagtgg gagtgtgtct 600

gggttagatg gcaagtcatt taacttgatt ggtggaccgc agtcatcgga gccatccaat 660

ctgcacacaa atccacggag gaggtgcact ggtagaggag aagatgggag tggaaaatgc 720

tctagcagtg gaagatgcca ctgctcgaag aaaaggaagt tgagagtgaa gagatccatt 780

aaggttcctg ccattagtaa taagcttgct gatatacctc ctgatgagta ttcttggagg 840

aagtacgggc agaagccaat caagggttct cctcatccta ggggatacta taagtgtagc 900

agcatgagag gctgtcctgc aagaaagcat gtggagaggt gcttggaaga cccttccatg 960

cttattgtta cttatgaagg tgagcacaat cacaccaggt taatgactca gtccgctcag 1020

acctga 1026

<210>2

<211>341

<212>PRT

<213> Cymbidium goeringii

<400>2

Met Glu Glu Val Glu Ala Ala Asn Arg Ala Ala Val Glu Ser Gly His

1 5 10 15

Arg Leu Leu Ser Leu Leu Ala Ser Lys Ala Glu Asp Glu Val Gln His

20 25 30

Arg Arg Asn Val Val Ala Glu Thr Gly Glu Ala Val Ser Arg Phe Arg

35 40 45

Lys Leu Ala Ala Leu Leu Gly Asn Gly Val Gly His Ala Arg Val Arg

5055 60

Arg Ala Lys Leu Ser Pro Gln Gln Thr Pro Phe Ser His Gln Lys Leu

65 70 75 80

Val Leu Asp Ser Ala Leu Ala Ala Lys Ala Ser Pro Ser Ala Asn Leu

85 90 95

Leu Pro Arg Thr Gly Asp Leu Asp Arg Arg Ile Phe Leu Glu Asn Lys

100 105 110

Pro Val Ala Gln Ile Leu Ser Ala Pro Pro Asn Pro Val Gln Leu Ala

115 120 125

Ala Gln Phe Gln Tyr Ile His Gln Gln Gln Gln Gln Gln Gln Asn His

130 135 140

Ala Phe Gln Leu Gln Gln His Ile Lys Phe Gln Ala Glu Met Leu Arg

145 150 155 160

Arg Gly Asn Ser Gly Gly Ile Asn Leu Lys Phe Asp Thr Pro Ser Cys

165 170 175

Ser Gln Thr Met Ser Ser Thr Thr Arg Ser Phe Leu Ser Ser Leu Ser

180 185 190

Met Asp Ala Ser Gly Ser Val Ser Gly Leu Asp Gly Lys Ser Phe Asn

195 200 205

Leu Ile Gly Gly Pro Gln Ser Ser Glu Pro Ser Asn Leu His Thr Asn

210 215 220

Pro Arg Arg Arg Cys Thr Gly Arg Gly Glu Asp Gly Ser Gly Lys Cys

225 230 235 240

Ser Ser Ser Gly Arg Cys His Cys Ser Lys Lys Arg Lys Leu Arg Val

245 250 255

Lys Arg Ser Ile Lys Val Pro Ala Ile Ser Asn Lys Leu Ala Asp Ile

260 265 270

Pro Pro Asp Glu Tyr Ser Trp Arg Lys Tyr Gly Gln Lys Pro Ile Lys

275 280 285

Gly Ser Pro His Pro Arg Gly Tyr Tyr Lys Cys Ser Ser Met Arg Gly

290 295 300

Cys Pro Ala Arg Lys His Val Glu Arg Cys Leu Glu Asp Pro Ser Met

305 310 315 320

Leu Ile Val Thr Tyr Glu Gly Glu His Asn His Thr Arg Leu Met Thr

325 330 335

Gln Ser Ala Gln Thr

340

<210>3

<211>17

<212>DNA

<213> Artificial sequence (artiartiartifical sequence)

<400>3

atggaggagg tggaggc17

<210>4

<211>18

<212>DNA

<213> Artificial sequence (artiartiartifical sequence)

<400>4

tcaggtctga gcggactg 18

<210>5

<211>23

<212>DNA

<213> Artificial sequence (artiartiartifical sequence)

<400>5

cccgggatgg aggaggtgga ggc 23

<210>6

<211>24

<212>DNA

<213> Artificial sequence (artiartiartifical sequence)

<400>6

tacgtaggtc tgagcggact gagt 24

<210>7

<211>20

<212>DNA

<213> Artificial sequence (artiartiartifical sequence)

<400>7

gatagtggaa aaggaaggtg 20

<210>8

<211>24

<212>DNA

<213> Artificial sequence (artiartiartifical sequence)

<400>8

tacgtaggtc tgagcggact gagt 24

Claims (5)

1. A kind of Chinese cymbidiumCgWRKY21The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. The cymbidium goeringii of claim 1CgWRKY21The amino acid sequence of the gene expression protein is shown in SEQ ID NO. 2.

3. The cymbidium goeringii of claim 1CgWRKY21The use of genes in plant production and breeding.

4. Contains the cymbidium goeringii of claim 1CgWRKY21A vector for the gene.

5. Contains the cymbidium goeringii of claim 1CgWRKY21A host cell for the gene.

Images