CN116254288B - Application of cymbidium MIR156b gene in regulating and controlling flowering time of plants - Google Patents
Application of cymbidium MIR156b gene in regulating and controlling flowering time of plants Download PDFInfo
- Publication number
- CN116254288B CN116254288B CN202211693769.7A CN202211693769A CN116254288B CN 116254288 B CN116254288 B CN 116254288B CN 202211693769 A CN202211693769 A CN 202211693769A CN 116254288 B CN116254288 B CN 116254288B
- Authority
- CN
- China
- Prior art keywords
- gene
- cymbidium
- mir156b
- plants
- regulating
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Abstract
The invention discloses a cymbidium MIR156b gene and application thereof in regulating and controlling plant flowering time, wherein the gene is a precursor gene of cymbidium miR156, the nucleotide sequence of the precursor gene is shown as SEQ ID NO.1, and the nucleotide sequence of a mature body is shown as SEQ ID NO. 2. The invention clones and obtains the MIR156b gene sequence from the cymbidium culture variety Song Mei, carries out tissue expression difference analysis in the cymbidium, constructs the gene sequence into an over-expression vector to be introduced into target plants to verify the functions, discovers that the arabidopsis plant over-expressing the MIR156b gene has the phenotypes of delayed flowering, short fruits, tender leaves and the like compared with wild plants, namely, the whole plant is transformed into the juvenile form, and can be widely applied to the cultivation and the property improvement of orchid and other gardening plants.
Description
Technical Field
The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a cymbidium MIR156b gene in regulating and controlling plant flowering time.
Background
Orchid (Orchidaceae) is one of the largest families in flowering plants, and 25000 species worldwide account for about 10% of all flowering plants. The cymbidium (Cymbidium goeringii) belongs to the small-flower type ground orchid category in the orchid genus of the orchid family, has peculiar flower type, elegant flower color, delicate fragrance, she Zi, elegant appearance, extremely high ornamental value and economic value, and is a typical leaf art and flower art two-whole orchid. However, the flowering time of cymbidium goeringii is concentrated in early spring, the flowering period is single, the flower bud differentiation rate is low, the breeding period is long, and the market demand is difficult to meet. Therefore, the research of molecular mechanisms of characteristic genes for regulating and controlling plant development cycle and related traits is of great significance to the breeding, production and application of cymbidium and other plants.
MicroRNA156 is a small RNA consisting of about 21 nucleotides, and the precursor sequence of the microRNA is a plurality of MIR156 genes, and can be regulated by inhibiting a target transcription factor SPL. The role of miR156 in plant growth and development has been studied in various plants, and is mainly found to play a major role in regulating plant growth cycle transition, particularly in the transition from juvenile to adult and flower formation induction. At present, reports about functional verification of miR156 and a precursor gene thereof in plants are not found in orchid plants. Therefore, a miR156 precursor gene cloned from cymbidium goeringii, namely MIR156b, is transferred into a mode plant by utilizing a genetic engineering technology, so that the method has important significance for researching the function of the MIR156 precursor gene in the regulation of the development period, particularly the flowering time, and has a great application prospect.
Disclosure of Invention
Aiming at the defects existing in the prior art of breeding, the invention aims to provide a cymbidium MIR156b gene. It is another object of the present invention to provide the use of the cymbidium MIR156b gene in plant breeding, particularly in flowering-time regulation.
In order to achieve the above object, the present invention adopts the following technical scheme:
a nucleotide sequence of the cymbidium MIR156b gene is shown in SEQ ID NO. 1.
The nucleotide sequence of the mature body sequence contained in the cymbidium MIR156b precursor gene is shown as SEQ ID NO. 2.
The MIR156b gene of the cymbidium is applied to regulating and controlling the flowering time of plants and the morphology of partial organs.
Preferably, the plant is cymbidium goeringii Song Mei'.
The specific method comprises the following steps: the cymbidium MIR156b precursor gene is connected to a vector, and is transformed into wild arabidopsis thaliana 'Columbia' through agrobacterium mediation, and is screened and cultured to obtain a transgenic plant.
The beneficial effects are that: compared with the prior art, the invention discovers that the arabidopsis thaliana over-expressing the MIR156b gene has the advantages of delayed flowering time, increased rosette number, short and thick fruits, small and tender basal leaves and stem leaves compared with the wild type through cloning and identifying the MIR156b gene of the cymbidium, analyzing the expression of the gene and carrying out genetic transformation and verifying the functions of the gene, and can be used for specific purposes in orchid flowering phase regulation, organ morphogenesis and other plant production and breeding.
Drawings
FIG. 1 is a diagram of the bacterial detection electrophoresis of the cloning of the MIR156b gene of cymbidium, wherein M is a 2000 bp DNA Marker, and the target band length is about 200bp (91 bp of target gene+homologous arm of vector);
FIG. 2 shows the expression of MIR156b in different stages of cymbidium goeringii flower development, with the highest expression level at 3-5cm of flower buds;
FIG. 3 is a schematic diagram of the structure of an overexpression vector constructed by the MIR156b gene of cymbidium;
FIG. 4 is a diagram of PCR results of transgenic Arabidopsis plant DNA, wherein M1 represents DL2000 Marker, M2 represents 50 bp DNA Ladder, CK-lanes with wild type DNA as a template as a negative control, CK+ lanes with recombinant plasmid as a template as a positive control, and lanes 1-10 with DNAs of different strains of transgenic plants as templates;
FIG. 5 is a graph of flowering time comparison of plants overexpressing the MIR156b gene (right 2) with wild-type Arabidopsis plants (left 2);
FIG. 6 is a comparison of fruit morphology of plants overexpressing the MIR156b gene with wild-type Arabidopsis plants;
FIG. 7 is a comparison of leaf morphology of plants overexpressing the MIR156b gene with that of wild-type Arabidopsis plants prior to flowering.
Detailed Description
The invention will be further illustrated with reference to specific examples.
Example 1
The material used in this example was fresh leaves of cymbidium 'Song Mei' in vegetative growth, and the E.coli strain used was Trelief5α.
1) Extraction of cymbidium gDNA
The method is carried out according to the specification of a Takara plant DNA extraction kit, and comprises the following specific operations:
fresh leaves of cymbidium "Song Mei" were transferred to a mortar pre-cooled with liquid nitrogen, and the tissue was ground with a pestle, with continuous addition of liquid nitrogen, until ground to a powder; the ground sample was rapidly added to a 1.5. 1.5mL sterilized tube containing 500. Mu.l Buffer HS I and 10. Mu.l 50 XDTT Buffer mix, mixed well, 10. Mu.l RNase A was added thereto, mixed well by vortexing, and incubated in a metal bath at 56℃for 10min. Adding 62.5 μl of Buffer KAC into the cracked sample, repeatedly blowing with a pipette, mixing, standing on ice for 5min, and centrifuging at 12,000rpm for 5min; carefully sucking the supernatant, transferring to a new 1.5ml sterilizing tube, adding Buffer GB with the same volume as the supernatant, and uniformly mixing the two; the above-obtained mixture was transferred into Spin Column placed in a Collection tube in several times, centrifuged at 12,000rpm for 1 minute, and the filtrate was discarded; mu.l Buffer WA WAs added to Spin Column and centrifuged at 12,000rpm for 1min, and the filtrate WAs discarded; adding 700 μl Buffer WB along the periphery of the Spin Column tube wall, centrifuging at 12,000rpm for 1min, and discarding the filtrate; adding 700 μl Buffer WB along the periphery of the Spin Column tube wall, centrifuging at 12,000rpm for 1min, and discarding the filtrate; centrifuge at 12,000rpm for 2 minutes to ensure that no residual liquid remains in the Spin Column. Place Spin Column in a fresh 1.5ml sterilization tube, add 30 μl of sterile water incubated on 65℃metal bath to the center of Spin Column membrane, and stand for 5min at room temperature; centrifugation at 12,000rpm for 2 minutes to elute gDNA. The obtained gDNA is stored in a refrigerator at the temperature of minus 80 ℃ for standby after concentration and purity detection.
The 2 mu L gDNA is sucked and detected by 1.5% agarose gel electrophoresis, and the result shows that only one clear macromolecular band exists, and the whole genome DNA has better quality. gDNA purity, OD by trace nuclear protein determinator 260 /OD 280 And OD (optical density) 260 /OD 230 The whole PCR primer is 1.8-2.1, has good integrity and can be used for PCR.
2) Design and cloning of target gene primer
According to the existing high-throughput sequencing result of the cymbidium microRNA group, the CE Design is used for designing an amplification primer of the cymbidium MIR156b gene, and the primer sequence is as follows:
MIR156b-F: 5’- acgggggactctagaggatccGGTGACAGAAGAGAGTGAGCACC -3’;
MIR156b-R: 5’- ataagggactgaccacccgggGGGTGACAGATAGAGAGTGAGCACA-3’。
cloning of the cymbidium MIR156b gene was performed using PrimerStar Max Hi-Fi enzyme of Takara using gDNA as a template. The PCR amplification system (50. Mu.L) was: 25 μ lL PrimerStar Max,2 μL Forward Primer,2 μL Reverse Primer,2 μL Template cDNA,19 μL ddH 2 O. The PCR procedure was: the reaction conditions were 94℃for 3min,98℃for 10s,60℃for 15s,72℃for 30s,32 cycles, 72℃for 5min total extension, and 16℃for incubation.
After the PCR reaction is completed, all PCR products are taken, the target fragments are detected and cut through 1.8% agarose gel electrophoresis, and the PCR target amplified products are recovered and purified through gel. The DNA gel recovery kit of TransGen company is adopted to purify and recover the target fragment, and the specific operation is as follows: cutting a single target strip from agarose gel, putting the cut single target strip into a clean centrifuge tube, and weighing; adding 3 times volume of solution GSB (if the gel is 0.1g, the volume can be regarded as 100 mu L, 300 mu L of GSB solution) into the gel block, placing in a water bath at 55 ℃, and continuously gently turning the centrifuge tube up and down until the gel block is completely dissolved; the melted gel solution was cooled to room temperature, 1 volume of isopropanol (100 μl isopropanol if the gel was 0.1 g) was added, and gently mixed; adding the mixed solution into a centrifugal column, standing at room temperature for 1min, centrifuging at 12000rpm for 1min, discarding effluent, and then placing the centrifugal column into a collecting pipe; adding 650 mu L of solution WB into the centrifugal column, centrifuging at 12000rpm for 1min, and discarding effluent; centrifuging at 12000rpm for 2min, removing residual WB as far as possible, standing the adsorption column at room temperature for 5min under cover opening, and completely air drying; placing the centrifugal column into a clean centrifuge tube, and suspending and dripping 30 mu L ddH into the middle position of the adsorption film 2 O（ddH 2 O is placed in a water bath at 60-70 ℃ in advance for preheating, and kept stand at room temperature for 2min and centrifuged at 12000rpm for 2min to collect DNA solution. Taking 2 mu L of recovered and purified product, performing gel electrophoresis detection by using 1.5% agarose, and placing the rest of the product in a refrigerator at the temperature of minus 20 ℃, and subsequently connecting the product with a pBI121 vector to construct an overexpression vector.
3) Extraction of plasmids:
extracting plasmids according to the specification of a small and medium-amount kit of the Tiangen plasmids, wherein the specific steps are as follows:
taking 10mL of fungus liquid cultured overnight, centrifuging at 12000rpm for 1min, and removing supernatant; adding 500 mu L P1 solution (containing RNase A) into a centrifuge tube with bacterial sediment, and thoroughly suspending the bacterial sediment by using a vortex instrument; adding 500 mu L P solution into a centrifuge tube, fully cracking the thalli when the thalli are gently turned upside down, adding 700 mu L P solution into the centrifuge tube, immediately and gently turning upside down, fully mixing, and centrifuging at 12000rpm for 10min after white flocculent precipitation occurs; adding 500 μl of balance liquid BL into the adsorption column CP4, centrifuging at 12000rpm for 1min, discarding the waste liquid in the collection tube, placing the adsorption column back into the collection tube, adding the collected supernatant into the filtration column CS in batches, centrifuging at 12000rpm for 2min, carefully adding the solution collected in the collection tube into the adsorption column CP4 in batches, centrifuging at 12000rpm for 1min, discarding the waste liquid in the collection tube, and placing the adsorption column CP4 back into the collection tube; adding 500 μl deproteinized solution PD into an adsorption column CP4, centrifuging at 12000rpm for 1min, discarding the waste liquid in the collection tube, and placing the adsorption column CP4 back into the collection tube; adding 600 μl of rinsing solution PW (containing absolute ethanol) into an adsorption column CP4, centrifuging at 12000rpm for 1min, discarding the waste liquid in the collection tube, placing the adsorption column CP4 into the collection tube, centrifuging at 12000rpm for 2min, and removing residual rinsing solution in the adsorption column; the column CP4 was transferred to a new 1.5ml centrifuge tube, and 60. Mu.L of ddH was added to the middle of the adsorption film 2 O; standing for 2min at room temperature, and centrifuging at 12000rpm for 1min to obtain the plasmid as the solution. Finally, the plasmid concentration was determined and prepared for the next experiment.
4) Double enzyme digestion reaction
The extracted pBI121 plasmid is digested with XbaI and SmaI at 37 deg.C for 30min, and the linear vector is recovered by electrophoresis and stored at-20 deg.C for use. The double cleavage reaction system was 50. Mu.L: pBI121 plasmid 20. Mu.L, 5 Xbuffer 5. Mu.L, xbaI 1. Mu.L, smaI 1. Mu.L, ddH 2 O 23μL。
5) Recombination reactions
The target gene and vector pBI121 recovered after digestion are detected by agarose gel electrophoresis, and each reagent is added according to the detected purity and concentration and a connection system. Wherein, the molecular number of the target fragment: carrier number=3:1 to 5:1, connectionThe reaction system is as follows: 7. Mu.L of linearized pBI121 vector, 3. Mu.L of insert, 4. Mu.L of 5 XCE II buffer, 2. Mu.L of Exnase II, ddH 2 Up to 20. Mu.L. The reaction was carried out at 37℃for 30min, and the reaction was allowed to stand at room temperature (without immediately cooling) for 10min, after which the reaction was allowed to stand for E.coli.
6) Transfer of ligation products into E.coli
The competent cell Trans5α strain was taken out from the ultra-low temperature refrigerator and thawed on ice. mu.L of recombinant product was pipetted into 100. Mu.L of competent cells; placing the centrifuge tube on ice for 10min; water bath in a water bath kettle at 42 ℃ and heat shock 90 s, wherein the water bath kettle is not required to shake; immediately placing the mixture on ice for 2 min; adding 500 mu L of liquid culture medium without antibiotics into an ultra-clean bench, shaking at 37 ℃ and 200 rpm for 25min for resuscitation; 6000 Centrifuging at rpm for 1min, and sucking 350 μL of supernatant; the precipitated cells were resuspended, plated on LB plates (Kana 50 mg/L) and incubated overnight at 37 ℃.
7) Identification of recombinants
Single colonies on the plates were picked and inoculated into LB liquid medium containing antibiotics (Kana) and shake-cultured overnight at 37℃and 200 rpm. Bacterial liquid PCR is carried out by using the full-length primer of the target gene to screen positive clones, and the bacterial detection result is shown in figure 1. The positive clones after screening were sent to Nanjing Sipu gold company for sequencing. Positive clones with correct sequencing results were amplified and plasmids were extracted using the radicle plasmid extraction kit.
According to analysis of the sequencing result, the final cloning is carried out to obtain 1 cymbidium MIR156b gene, the nucleotide sequence of which is shown as SEQ ID NO.1, wherein the gene comprises a cymbidium miR156 mature body, and the nucleotide sequence of which is shown as SEQ ID NO. 2.
Example 2
The material adopted in the embodiment is flower buds of cymbidium goeringii Song Mei' in different periods, and the flower buds are quickly frozen in liquid nitrogen after being picked and stored in an ultralow temperature refrigerator (-80 ℃).
1) Small RNA extraction from tissues of cymbidium goeringii
The method is carried out according to the specification of a TaKaRa plant RNA extraction kit, and comprises the following specific operations:
quick freezing the tissue of cymbidium goeringii at ultralow temperatureTransferring to a mortar precooled by liquid nitrogen, grinding the tissue with a pestle, and continuously adding liquid nitrogen until the tissue is respectively ground into powder; adding the ground powder samples into 1.5mL sterilized tubes containing 450 μl Buffer PE respectively, and repeatedly blowing with a pipette until no obvious precipitate exists in the lysate; the lysate was centrifuged at 12,000rpm at 4℃for 5 minutes; the supernatant was carefully aspirated into a fresh 1.5. 1.5mL sterilization tube. Adding Buffer NB with the volume of 1/10 of the supernatant, shaking and mixing uniformly by Vortex, centrifuging at 12,000rpm and 4 ℃ for 5 minutes; carefully sucking the supernatant into a new 1.5. 1.5mL sterilization tube, adding 450 mu L of Buffer RL, and uniformly mixing the solution by using a pipette; adding absolute ethyl alcohol with the volume 1.5 times of that of the mixed solution, uniformly mixing the solution by using a pipetting gun, and immediately transferring the mixed solution into the RNA Spin Column; centrifugation at 12,000rpm for 1min, discarding the filtrate and returning RNA Spin Column to 2ml Collection Tube; 600 μl of 80% ethanol was added to RNA Spin Column, centrifuged at 12,000rpm for 30 seconds, and the filtrate was discarded; 50 mu L of DNase I reaction solution is added to the center of the RNA Spin Column membrane, and the mixture is kept stand for 15 minutes at room temperature; 350. Mu.L Buffer RWB was added to the center of the RNA Spin Column membrane, centrifuged at 12,000rpm for 30 seconds, and the filtrate was discarded; 600 μl of 80% ethanol was added to RNA Spin Column, centrifuged at 12,000rpm for 30 seconds, and the filtrate was discarded; RNA Spin Column was relocated to 2mL Collection Tube, centrifuged at 12,000rpm for 2 minutes; RNA Spin Column was mounted on RNase Free Collection Tube of 1.5. 1.5mL, and 30. Mu.L of RNase Free dH was added to the center of the RNA Spin Column membrane 2 O was allowed to stand at room temperature for 5 minutes, and the RNA was eluted by centrifugation at 12,000rpm for 2 minutes. The obtained Small RNA is stored in a refrigerator at-80 ℃ for standby after concentration and purity detection.
The result of sucking 2 mu L of RNA and detecting by using 1% agarose gel electrophoresis shows that 28S and 18S bands are clear, the brightness of the 28S band is about twice of that of the 18S band, and the quality of the RNA is good. RNA purity, OD, was measured by a trace accounting protein meter 260 /OD 280 And OD (optical density) 260 /OD 230 The whole cell is between 1.8 and 2.1, has better integrity and can be used for reverse transcription.
2) Synthesis of first strand cDNA
Extracting from the above-mentioned extracts of cymbidium goeringiiTotal Small RNAs of the tissue were used as templates, respectively, according to HiScript III 1 from Vazyme st Strand cDNA Synthesis Kit, the instructions of the kit are mixed to carry out cDNA reverse transcription, and the reverse transcription procedure is as follows: 15min at 37℃and 5s at 85 ℃. The obtained cDNA was used in the subsequent fluorescent quantitative experiments.
3) Real-time fluorescent quantitative PCR
The cloned cymbidium MIR156b gene is used as a reference to design a fluorescent quantitative primer, and the primer sequence is as follows:
qMIR156b-F：5’- TGAGCACTCATGGTGTTTTCTTG -3’
qMIR156b-R：5’- GAGAGTGAGCACACATAGCTTCA -3’
meanwhile, 18S is used as an internal reference gene, and the primer sequence is as follows:
18S-F：5’-GGTCCTATTGTGTTGGCT-3’
18S-R：5’-TCGCAGTGGTTCGTCTTT-3’
the preparation of the reaction solution was carried out using the instructions of the ChamQ ™ Universal SYBR Qpcr Master Mix kit (company Vazyme), and the PCR procedure was run on a Applied Biosystems type real-time fluorescence quantitative analyzer: 95 ℃ for 5min; cycling for 40 times at 95 ℃ for 10s and 60 ℃ for 30 s; 95℃15s,60℃1min,95℃15s. After the reaction is finished, an amplification curve is obtained, data is derived through StepOne Software v 2.3.3, excel is used for data analysis, the relative expression quantity is calculated by a relative quantification method of 2-delta Ct according to CT values, and the data analysis result is shown in figure 2.
The research results of the embodiment show that the expression quantity of the cymbidium MIR156b fluctuates along with the development process of cymbidium flowers (figure 2), and the expression quantity reaches a peak value in the middle stage of flower development (3-5 cm), thereby proving that the cymbidium MIR156b participates in the regulation and control of the flower forming process.
Example 3
1) Preparation and transformation of Agrobacterium competent cells
In the embodiment, agrobacterium GV3101 is utilized to prepare agrobacterium competence, and an infection experiment of arabidopsis thaliana is carried out; the preparation process of the agrobacteria competence comprises the following steps: picking an activated agrobacterium single colony, inoculating the agrobacterium single colony into 5mL of liquid LB culture medium, and culturing at 28 ℃ and 250 rpm for 20-24 h; sucking 2mL of the bacterial liquid, inoculating to the liquid containingIn a triangular flask with 50mL of liquid LB medium, shaking at 28℃and 250 rpm to OD 600 The value is about 0.8; placing the amplified bacterial liquid in ice bath for 30min at 4deg.C and 5000 rpm for centrifugation for 5min, and discarding supernatant; 10mL of precooled 0.1 mo1/L CaCl was added 2 A solution for sufficiently suspending the precipitated thalli; centrifuging at 5000 rpm for 5min at 4deg.C, and discarding supernatant; 1mL of precooled 20 mmo1/L CaCl was added 2 And fully suspending thalli by the solution to obtain GV3101 competent cells to be prepared, subpackaging the GV3101 competent cells into 100 mu L/tube by using a centrifuge tube, rapidly adding 20% sterile glycerol, and standing at-80 ℃ for preservation.
Agrobacterium transformation of recombinants: melting the agrobacteria competent cells in an ice bath, adding 600ng of the recovered and purified plasmid into 100 μl of agrobacteria competent cells, gently mixing, and carrying out ice bath for 5min; quick-freezing with liquid nitrogen for 5min, heating in 37 deg.C metal bath for 5min, and rapidly placing in ice bath for 5min; 800. Mu.l of LB medium without any antibiotics was added, and resuscitated at 28℃and 200 rpm for 2 h; centrifuging at 4000 rpm for 3min, and sucking away part of the liquid culture medium; the residual bacterial liquid is fully mixed by a liquid-transferring gun and then is coated on a solid LB culture medium added with 50 mg/L kanamycin and 200 mg/L rifampicin; and culturing for 30-48 hours at 28 ℃ in an inverted mode.
Identification of Agrobacterium recombinants: picking single colonies from the plate culture medium, and inoculating the single colonies into a liquid culture medium containing corresponding antibiotics; culturing at 28deg.C and 200 rpm overnight, performing bacterial liquid PCR, detecting PCR product by 1.5% agarose gel electrophoresis, identifying whether target fragment is contained, adding appropriate amount of sterile 50% glycerol into positive clone after identification, and preserving at-80deg.C for use.
2) Agrobacterium-mediated transformation of Arabidopsis thaliana
The inflorescence infection method is adopted to transfer the target gene into the arabidopsis, and the specific operation method is as follows: arabidopsis thaliana (Columbia type) maintains healthy growth status until flowering; activating the Agrobacterium GV3101 strain carrying the target gene. Picking single colony, inoculating in 5mL LB culture solution containing kanamycin and rifampicin, shaking at 28 ℃ and 200 rpm until the bacterial solution becomes turbid just about 8-10 h; sucking 1mL of bacterial liquid, inoculating into a triangular flask (50 mL) and shaking 24 and h until the OD value is about 0.8; centrifuging the bacterial liquid at 6000 rpm at room temperature for 5min, removing the supernatant, collecting bacterial cells, and suspending with 3% sucrose solution with pH of 5.8; before soaking, silwet L-77 (concentration: 0.03% (300. Mu.l/L)) was added and the foam shaken out; soaking aerial parts of Arabidopsis thaliana in agrobacterium suspension for 1min, and gently shaking during the soaking; placing the immersed Arabidopsis in a tray, covering with a preservative film, sealing with tinfoil paper, and placing 24 h; and (5) uncovering the tinfoil paper, culturing under normal conditions, and stopping watering when the seeds are ripe.
The 3% sucrose solution resuspension comprises the following components: MS culture medium, adding 30g/L sucrose and 300 mu L/L Silwet-77. (note: pH was adjusted to 5.8 after preparation, bacterial liquid was centrifuged and resuspended, silwet L-77 was added, and the conversion relationship between the resuspension and bacterial liquid was such that the amount of resuspension was calculated as bacterial liquid OD. Bacterial liquid volume=0.8. Resuspension).
3) Screening of transgenic plants
The collected seeds of T1 generation transgenic arabidopsis thaliana are sterilized by alcohol and sodium hypochlorite, and the steps are as follows: placing a proper amount of obtained transgenic seeds into a 1.5mL centrifuge tube, and soaking for 5min by using 8% NaClO and ethanol mixed solution (the ratio is 1:1 by volume); sterilizing with 75% alcohol for 5-6 times, each time for 2 min; washing with sterile water for 3-4 times; suspended with 0.1% agarose solution.
Sterilized transgenic Arabidopsis seeds were sown on MS solid medium containing antibiotics (kanamycin 50 mg/L and cephalosporin 100 mg/L), wrapped with tinfoil and placed in a refrigerator at 4℃for vernalization. After 2 days, the culture medium was taken out of the refrigerator and incubated at 22℃under light. After about one week, the arabidopsis thaliana which can grow normally on the culture medium is transplanted into soil and grows continuously.
4) DNA detection of transgenic plants
Taking a proper amount of tender leaves of T1 generation arabidopsis and transgenic plants, and detecting by adopting a plant DNA direct amplification kit of the family of the qing, wherein the specific operation steps are as follows: cutting a proper amount of tender leaves, placing the tender leaves into a 2mL centrifuge tube after sterilization treatment, adding 50uL Lysis Buffer A solution, heating and cracking for 10min at 95 ℃, and continuing to crack overnight at 4 ℃. The next day was centrifuged at 14000 rpm for 3min, and the supernatant was transferred to a new sterile centrifuge tube as a template for PCR reaction. PCR detection was performed using 2×T5 Direct PCR Mix and specific primers for the genes, and the results are shown in FIG. 4.
5) Obtaining of transgenic homozygous lines
Sterilizing the harvested transgenic T1 generation seeds, screening and culturing, transplanting the transgenic T1 generation seeds into nutrient soil, and culturing in 16 h light/8 h dark at the temperature of 22 ℃; after detection, retaining the preliminarily confirmed transgenic plants, harvesting the T1 generation seeds after maturation, and numbering to obtain the T2 generation; as in the T1 generation, the T2 generation seeds are sterilized and then coated on a screening culture medium containing antibiotics, and the culture medium is placed at 22 ℃ for continuous illumination; counting the survival rate of T2 generation seeds with different numbers about 10 days, selecting plants with the survival proportion of 75% to be transplanted and cultured in nutrient soil according to 22 ℃ and 16 h light/8 h darkness, and taking leaves for positive detection; numbering the positive T2 generation plants continuously, and collecting seeds to obtain T3 generation seeds; after the seeds are sterilized, screening the seeds by a screening culture medium, and placing the seeds under light for continuous illumination culture; around 10 days, different numbered T3 generation plants were observed, all survived and no segregating T3 generation homozygous plants appeared.
6) Phenotypic observation
The transgenic lines with obvious phenotypes are selected for observation, and the results show that compared with the wild type arabidopsis, the flowering time of the transgenic arabidopsis plants is delayed, and the morphology of fruits and leaves is changed.
In this example, a recombinant plasmid of the overexpressed cymbidium MIR156b gene was transferred into the model plant Arabidopsis thaliana, and phenotypically observed and analyzed. From the results, the arabidopsis plant over-expressing the MIR156b gene has the phenotypes of delayed flowering time, increased rosette number, shortened fruit length, small and tender leaves and the like compared with a wild plant, and the gene has a regulating effect on the flowering time of the plant and the morphological establishment of partial organs.
Claims (3)
1. The application of the cymbidium MIR156b gene in regulating the flowering time of Arabidopsis thaliana 'Columbia', wherein the nucleotide sequence of the cymbidium MIR156b gene is shown as SEQ ID NO. 1; the cymbidium MIR156b gene is connected to an over-expression vector, and is transformed into wild arabidopsis thaliana 'Columbia' through agrobacterium mediation, and is screened and cultured to obtain a transgenic plant with delayed flowering time.
2. The application of the cymbidium MIR156b gene in regulating and controlling the fruit morphology of Arabidopsis thaliana 'Columbia', wherein the nucleotide sequence of the cymbidium MIR156b gene is shown as SEQ ID NO. 1; the cymbidium MIR156b gene is connected to an over-expression vector, and is transformed into wild arabidopsis thaliana 'Columbia' through agrobacterium mediation, and is screened and cultured to obtain a transgenic plant with short fruits.
3. The application of the spring orchid MIR156b gene in regulating and controlling the leaf morphology of Arabidopsis thaliana 'Columbia', wherein the nucleotide sequence of the spring orchid MIR156b gene is shown as SEQ ID NO. 1; the cymbidium MIR156b gene is connected to an over-expression vector, and is transformed into wild arabidopsis thaliana 'Columbia' through agrobacterium mediation, and is screened and cultured to obtain a transgenic plant with small leaves and tender leaves.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211693769.7A CN116254288B (en) | 2022-12-28 | 2022-12-28 | Application of cymbidium MIR156b gene in regulating and controlling flowering time of plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211693769.7A CN116254288B (en) | 2022-12-28 | 2022-12-28 | Application of cymbidium MIR156b gene in regulating and controlling flowering time of plants |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116254288A CN116254288A (en) | 2023-06-13 |
| CN116254288B true CN116254288B (en) | 2023-09-22 |
Family
ID=86683499
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211693769.7A Active CN116254288B (en) | 2022-12-28 | 2022-12-28 | Application of cymbidium MIR156b gene in regulating and controlling flowering time of plants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116254288B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220330A (en) * | 2011-06-10 | 2011-10-19 | 中国科学院遗传与发育生物学研究所 | MiRNA-gma-miR56b related to drought resistance of plants and application thereof |
| CN104232682A (en) * | 2014-09-18 | 2014-12-24 | 中国科学院遗传与发育生物学研究所 | Method for cultivating high-yield plant by overexpression of gma-miR156b |
| CN105505986A (en) * | 2016-01-15 | 2016-04-20 | 湖南农业大学 | Method for producing ratooning rice tillering in advance and further increasing yield of ratooning rice |
| CN113774080A (en) * | 2020-05-21 | 2021-12-10 | 中国科学院青岛生物能源与过程研究所 | Method for creating high-anthocyanidin horticultural ornamental poplar by using miR156 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060200878A1 (en) * | 2004-12-21 | 2006-09-07 | Linda Lutfiyya | Recombinant DNA constructs and methods for controlling gene expression |
-
2022
- 2022-12-28 CN CN202211693769.7A patent/CN116254288B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220330A (en) * | 2011-06-10 | 2011-10-19 | 中国科学院遗传与发育生物学研究所 | MiRNA-gma-miR56b related to drought resistance of plants and application thereof |
| CN104232682A (en) * | 2014-09-18 | 2014-12-24 | 中国科学院遗传与发育生物学研究所 | Method for cultivating high-yield plant by overexpression of gma-miR156b |
| CN105505986A (en) * | 2016-01-15 | 2016-04-20 | 湖南农业大学 | Method for producing ratooning rice tillering in advance and further increasing yield of ratooning rice |
| CN113774080A (en) * | 2020-05-21 | 2021-12-10 | 中国科学院青岛生物能源与过程研究所 | Method for creating high-anthocyanidin horticultural ornamental poplar by using miR156 |
Non-Patent Citations (2)
| Title |
|---|
| Integrated mRNA and microRNA transcriptome variations in the multi-tepal mutant provide insights into the floral patterning of the orchid Cymbidium goeringii;Fengxi Yang 等人;BMC Genomics;第1-24页 * |
| 兜兰属植物花期调控研究进展;尹玉莹 等人;热带作物学报;第769-778页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116254288A (en) | 2023-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2020221029A1 (en) | Zea mays receptor-like kinase gene zmrlk7 and use thereof | |
| CN114369599B (en) | Long-chain non-coding RNA gene for increasing rice yield and application thereof | |
| CN111424037B (en) | Cymbidium CgWRKY70 gene and application thereof | |
| CN115851823B (en) | Cymbidium CgARF18 gene and application thereof | |
| CN108795944B (en) | Cotton long-chain non-coding RNA-lnc973 and application thereof in plant salt tolerance | |
| CN110951771B (en) | Chinese cymbidiummiR390aApplication in controlling plant root system development | |
| CN116254288B (en) | Application of cymbidium MIR156b gene in regulating and controlling flowering time of plants | |
| CN116042696B (en) | Application of cymbidium MIR156a gene in regulating and controlling plant fruit development | |
| CN112662688B (en) | Application of walnut SnRK1 protein kinase coding gene JrSnRK1 in synthesis and accumulation of oil | |
| CN110904106B (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN111304222B (en) | Cymbidium CgWRKY11 gene and application thereof | |
| CN111454966B (en) | Cymbidium CgWRKY4 gene and application thereof | |
| CN111304220B (en) | Cymbidium CgWRKY3 gene and application thereof | |
| CN111304223B (en) | Cymbidium CgWRKY24 gene and application thereof | |
| CN110042109B (en) | Gene related to tomato leaf senescence and application thereof | |
| CN116179590B (en) | Application of cymbidium miR396 gene in regulation and control of thickening of plant stems | |
| CN108752446B (en) | Myrica rubra MrLFY gene and application thereof | |
| CN111304198B (en) | Application of cymbidium goeringii miR390b in controlling plant vegetative organ development | |
| CN115927363B (en) | Cymbidium CgARF8 gene and application thereof | |
| CN110982921B (en) | Application of cymbidium miR159a in accelerating plant life cycle | |
| CN110964724B (en) | Application of cymbidium goeringii miR390c in enhancing cold resistance of plants | |
| CN111424039B (en) | Cymbidium CgWRKY65 gene and application thereof | |
| CN111304221B (en) | Cymbidium CgWRKY31 gene and application thereof | |
| CN111424041B (en) | Cymbidium CgWRKY49 gene and application thereof | |
| CN111424040B (en) | Cymbidium CgWRKY21 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |