CN104232682A - Method for cultivating high-yield plant by overexpression of gma-miR156b - Google Patents
Method for cultivating high-yield plant by overexpression of gma-miR156b Download PDFInfo
- Publication number
- CN104232682A CN104232682A CN201410478207.XA CN201410478207A CN104232682A CN 104232682 A CN104232682 A CN 104232682A CN 201410478207 A CN201410478207 A CN 201410478207A CN 104232682 A CN104232682 A CN 104232682A
- Authority
- CN
- China
- Prior art keywords
- plant
- mir156b
- gma
- seq
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses a method for cultivating a high-yield plant by gma-miR156b and a precursor gene of gma-miR156b. The method comprises steps as follows: firstly, a recombinant expression vector containing a microRNA precursor sequence expressed by SEQ ID NO:2 is established, then, a transformant is established by the recombinant expression vector and then used for infecting a target plant, and the plant with multi-branch, multi-pod and multi-grain high-yield gene than a normal plant is obtained through screening. The gma-miR156b is overexpressed on a soybean plant, the branch number of soybeans can be remarkably increased, the average two branches are increased to eight branches, the number of pods of a single plant of transgenic soybean is also increased by 59%, and the number of seeds is also increased by 2-3 times. The gma-miR156b is overexpressed on wheat plants, the tiller number of transgenic wheat is increased to 4.4 from average 3.3, and the wheatear length, the grain number per spike and the average grain weight of single spike are remarkably increased.
Description
Technical field
The present invention relates to microRNA relevant to plant type and output in a kind of plant, particularly derive from growing relevant gma-miR156b to plant type and cultivating the application in high yielding soybeans and new variety of wheat of soybean.
Background technology
Soybean and wheat are crops that is very important, that have special economic value.Plant type is the concentrated expression of soybean and wheat plant global feature, plays very important effect in soybean and Yield Potential Breeding of Wheat.Soybean and wheat plant types comprise plant height, joint number, dynamic change that stem is thick, branch/tiller number, the plant forms feature such as branch length and angle.The lodging tolerance of soybean and wheat is the essential condition (Mancuso and Caviness, 1991) of the cultivation of its eurytropy and stable high yield under difficult environmental conditions thereof aborning.Soybean and the wheat breed with ideotype have better lodging tolerance.
MiRNA is that the class length found in organism is in recent years about the noncoding microRNA of 20-24nt, be combined by the mRNA of complementary with particular target gene, degrade because causing mRNA or suppress mRNA translation and regulate and control some important physiological processs, be considered to key or the master control regulatory element (Master regulators) of important plant traits molecular regulation, become the hot-point and frontier of world's bio-science research.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of method utilizing gma-miR156b and precursor-gene thereof to cultivate multi-branched, many pods, seediness grain high yield plant.
For solving the problems of the technologies described above, the technical solution used in the present invention is as follows.
The application in cultivation multi-branched and/or many pods and/or seediness grain plant type plant of gma-miR156b shown in SEQ ID NO:1 in sequence table.
As a preferred technical solution of the present invention, in plant, the gma-miR156b shown in process LAN SEQ ID NO:1, cultivates the transgenic plant with multi-branched and/or many pods and/or seediness grain plant type.
As a preferred technical solution of the present invention, first the recombinant expression vector containing gma-miR156b precursor sequence is built, then this recombinant expression vector is utilized to build transformant, recycle this transformant and infect object plant, screening obtains the high-yield transgenic plants compared with normal plants with multi-branched, many pods, seediness grain; Described gma-miR156b precursor sequence is as shown in SEQ ID NO:2.
As a preferred technical solution of the present invention, the step building the recombinant expression vector containing polynucleotide sequence shown in SEQ ID NO:2 is:
1), first with plant leaf DNA for template, amplification obtains polynucleotide sequence shown in SEQ ID NO:2 and is also connected in carrier T, then cuts gained carrier T plasmid with restriction enzyme A ge I and BamH I enzyme, recovery digestion products;
2), then cut empty carrier pEGAD with restriction enzyme A ge I and BamH I enzyme, reclaim carrier framework;
3), finally with T4 ligase enzyme by step 1) digestion products and step 2) carrier framework be connected;
4), by step 3) connection product heat-shock transformed E. coli competent DH5 α bacterial strain, 37 DEG C of incubated overnight, picking positive colony carries out sequence verification, obtains recombinant expression vector pEGAD-35S::gma-miR156b.
As a preferred technical solution of the present invention, adopt liquid nitrogen freeze-thaw method transformation Agrobacterium EHA105 to obtain transformant, concrete operation step comprises:
A. take out 200 frozen μ l competence agrobatcerium cells, after thawing, add the plasmid DNA of 5-10 μ l recombinant expression vector, flick tube wall mixing, put 20-30min on ice;
B. take out after putting into liquid nitrogen 5min, pipe is proceeded to 37 DEG C, after 5min melts, add 800 μ lYEP liquid nutrient mediums, 28 DEG C of low-speed oscillations, 150rpm, 4-5h;
D.10000rpm, 30sec, removes supernatant, adds 100 μ lYEP liquid nutrient mediums, coated plate after suspension thalline;
E. be placed in 28 DEG C to be cultured to white transformant and to grow, picking positive monoclonal shakes bacterium, transforms for plant cotyledonary node.
As a preferred technical solution of the present invention, described object plant is soybean or wheat.
The present invention also comprises the precursor sequence of gma-miR156b, and it has the nucleotide sequence shown in SEQ ID NO:2, is sheared and expresses to obtain corresponding microRNA in vegetable cell.
The present invention also comprises the recombinant expression vector containing gma-miR156b precursor sequence.
The present invention also comprises the transformant containing gma-miR156b precursor sequence.
The present invention also comprises the primer pair of amplification gma-miR156b precursor sequence, and its nucleotide sequence is as shown in SEQ ID NO:3 and SEQ ID NO:4.
The beneficial effect adopting technique scheme to produce is: the serial experiment of applicant proves, by process LAN gma-miR156b in soybean plant strain, significantly can increase the branch amount of soybean, is increased to 8 branches by average 2 branches; In addition, the single-strain legumen number of transfer-gen plant too increases 59%, the more important thing is, individual plant pod grain number too increases 2-3 doubly; The final output that significantly improve soybean.
Accompanying drawing explanation
Fig. 1 is the test-results of embodiment 1, the display expression pattern of gma-miR156b in soybean different tissues, and its expression level in soybean leaves is higher as seen.
Fig. 2 is the Molecular Identification (embodiment 2 step 5) of gma-miR156b process LAN transfer-gen plant, identifies that the strain (Fig. 2 A) of isozygotying has carried out the analysis that careless fourth phosphine smears (Fig. 2 B) and Bar test strip (Fig. 2 C) to PCR; As seen from the figure, the transfer-gen plant of the PCR positive also present the resistance to careless fourth phosphine, and Bar gene normal expression is described, its albumen has the activity of phosphine Wheat flavone Transacetylase.
Fig. 3 is the Molecular Identification of gma-miR156b in the middle of Transgenic soybean plants and the Analysis of agronomic characters (embodiment 2 step 6) of process LAN plant; Result shows, and in Transgenic wheat line, the expression level of goal gene gma-miR156b is compared be significantly improved (Fig. 3 A) with the expression in wild-type; The transfer-gen plant of process LAN gma-miR156b is compared with contrast wild-type W82, and plant height does not have noticeable change (Fig. 3 C), but plant type generation noticeable change (Fig. 3 B); Process LAN gma-miR156b significantly can increase the branch amount of soybean, is increased to 8 branches (Fig. 3 D) by average 2 branches; In addition, the single-strain legumen number of process LAN gma-miR156b transfer-gen plant too increases 59% (Fig. 3 E); The more important thing is, individual plant pod grain number too increases 2-3 doubly (Fig. 3 F).
Fig. 4 is the detected result of Bar gene in embodiment 3 step 5-1, is identified the positive transgenic lines of 156b-2-3 and 156b-5-8 two separate source by PCR method.
Fig. 5 is the Molecular Identification of gma-miR156b in the middle of Transgenic plant of wheat and the Analysis of agronomic characters of process LAN plant; Fig. 5-A, B show Transgenic plant of wheat in embodiment 3 step 5-2 and compare with contrast wild-type section agriculture 199, and spike length significantly raises; Fig. 5-C shows Transgenic plant of wheat and compares with contrast wild-type, and tiller number is increased to 4.4 by average 3.3; Fig. 5-D shows Transgenic plant of wheat and compares with contrast wild-type, and grain number per spike significantly increases; Fig. 5-E shows Transgenic plant of wheat and compares with contrast wild-type, and single fringe averageparticle representation work increases.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Test materials used in following embodiment, if no special instructions, is and purchases available from routine biochemistry Reagent Company.% in following embodiment, if no special instructions, is mass percentage.Quantitative test in following examples, all arranges and repeats experiment for three times, results averaged.
Embodiment 1gma-miR156b in soybean expression pattern analysis
Analyze the expression characterization of gma-miR156b in Soybean Leaves, stem, root and root nodule by Real-Time Fluorescent Quantitative PCR Technique, detect the expression characterization of gma-miR156b in transfer-gen plant simultaneously.
(1) material obtains: experiment material therefor is Wilimas82 (WILLIAMS-DARLING Ton 82, hereinafter referred W82), material processes according to following flow process: soybean seeds with 70% alcohol sterilizing 30S, be seeded in vermiculite perlite (3:1) mixed-matrix of Poor nitrogen nutrition immersion bubble, cultivate in culturing room, 16h light/8h is dark, light intensity 7000LUX, temperature 26 DEG C, relative humidity is 70%.After planting 7 days, every strain inoculation Slow_growing rhizobia USDA110 bacterium liquid (OD
600: 0.08) 30ml, gets Soybean Leaves, stem, root and root nodule when 28 days after connecing bacterium;
(2) separation of RNA in soybean different tissues: the soybean different tissues getting step gained, extract RNA, concrete extracting method is as follows:
1. in mortar, material is fully ground with liquid nitrogen, powder ground for 50mg-100mg is put into 1.5ml centrifuge tube, add 1mL Redzol reagent (Vigorous company), place 10min on ice;
2. add 200 μ l chloroforms, 200 μ l RNA-free NaAC, after shaken well, room temperature leaves standstill 2-3min;
3. 4 DEG C, the centrifugal 10min of 12,000g;
4. supernatant is moved in another one centrifuge tube, add isopyknic Virahol, vibration mixing ,-20 DEG C of precipitation 30min;
5. 4 DEG C, the centrifugal 10min of 12,000g;
6. abandon supernatant, the ethanol (the sterilized water preparation of DEPC process) with 75% is washed 1-2 time;
7. carefully remove supernatant (blotting as possible), room temperature leaves standstill and makes RNA dry;
8. appropriate DEPC process water dissolution RNA is added;
9. electrophoresis detection RNA integrity.
(3) reverse transcription PCR: use FastQuant RT Kit (With gDNase) test kit (catalog number (Cat.No.): the KR106) RNA to Shang Bu gained soyabean tissue of TIANGEN Company to carry out reverse transcription clone:
1. first total serum IgE end is carried out gDNA Transformatin, in 10 μ l systems, add total serum IgE 5 μ l5 × gDNA Buffer 2 μ l, RNase-Free ddH
2o 3 μ l, the reaction solution of the thoroughly above-mentioned preparation of mixing, of short duration centrifugal after, 42 DEG C of reaction 3min, are positioned on ice;
2. then reverse transcription reaction system is configured: 10 × Fast RT Buffer 2 μ l, RT Enzyme Mix 1 μ l, miR156b RT Primer (SEQ ID NO:5) 1 μ l, miR1515a RT Primer 1 μ l, RNase-Free ddH
2o5 μ l;
3. the mix in reverse transcription reaction is added in the reaction solution of gDNA removal step (step 1.), fully mixes; 42 DEG C, hatch 15min; 95 DEG C, be put on ice after hatching 3min, the cDNA obtained can directly carry out downstream fluorescent quantitation detection, or-20 DEG C of cryopreservation.
(4) real-time fluorescence quantitative PCR analysis: the SYBR Premix Ex Tag using TaKaRa Company
tMcarry out quantitative PCR analysis;
1. add in 20 μ l systems and walk gained cDNA template 2 μ l, each 0.4 μ l of forward and reverse primer, SYBR Primix Ex taq
tM(2 ×) 10 μ l, ROX Reference Dye II (50 ×) 0.4 μ l, ddH
2o6.8 μ l;
2. amplification program is: 95 DEG C of 30s; 95 DEG C of 5s, 60 DEG C of 34s, 45cycles; 95 DEG C of 15s, 60 DEG C of 1min, 95 DEG C of 15s; Wherein, forward primer is: GGACCTGACAGAAGAGAGAG (SEQ ID NO:6); Reverse primer is: GTGCAGGGTCCGAGGT (SEQ ID NO:7);
(5) as shown in Figure 1, the expression level of result display gma-miR156b in soybean leaves is higher for the expression pattern of result: gma-miR156b in soybean different tissues.
The cultivation of embodiment 2, desirable high yield plant type soybean
1, the extraction of Wilimas82 soy bean DNA
A. soyabean tissue is by liquid nitrogen grinding in mortar, is moved to by the powder fully ground in 1.5mL centrifuge tube; Add 500 μ LCTAB extracting solutions (100mM, Tris-HCl (pH8.0), 4mol/L NaCl, 20mmol/L EDTA (pH8.0), 2%CTAB, add 2mL/100mL beta-mercaptoethanol before using), mixing;
B.65 DEG C water-bath 30min, middle slight oscillatory is several times;
C. 5min is on ice placed in;
D. isopyknic chloroform is added: primary isoamyl alcohol (24:1), mixes gently;
E. room temperature, leaves standstill 10min, 12000rpm frozen centrifugation 15min, gets supernatant;
F. 2 times of volume ice ethanol are added, mixing ,-20 DEG C of standing 30min;
G. centrifugal, discharge supernatant liquor;
H.70% ethanol 1mL rinsing 2 times, dries;
I. sterilized water 100 μ l dissolves, and-20 DEG C of refrigerators are preserved for a long time.
2, recombinant expression vector is built
(1) clone of gma-miR156b gene
The precursor sequence 181bp (SEQ ID NO:2) altogether of gma-miR156b, according to this primers pair, according to carrier pEGAD multiple clone site, prime end introduces Age I respectively and BamH I enzyme cuts recognition site, with the DNA of soybean varieties W82 for template carries out PCR, the precursor sequence of amplification gma-miR156b; Primer sequence is:
gma-miR156b-F：5'-TGCACCGGTGGGTTCTATTGGTGGTTG-3'(SEQ?ID?NO：3)
gma-miR156b-R：5'-CGGGATCCCGTCTACTTTGGCTAGAAAG-3'(SEQ?ID?NO：4)
Amplification program is: 95 DEG C 5 minutes; 95 DEG C 30 seconds, 57 DEG C 30 seconds, 72 DEG C 40 seconds, 26 circulations; 72 DEG C 30 seconds;
Pcr amplification product carries out 1% agarose gel electrophoresis, adopts the raw work glue in Shanghai to reclaim the band that test kit reclaims purifying 181bp size;
The DNA fragmentation reclaimed is connected with pMD19-T carrier (Takara company), T vector 1 μ l is added in 10 μ l systems, solution I 5 μ l, reclaim fragment 4 μ l, mixing mixed solution, 16 DEG C of connections are spent the night, thermal shock method proceeds to E.coli competent escherichia coli cell, incubated overnight, chooses positive colony, delivers the order-checking of invitrogen company.
(2) structure of recombinant expression vector
1), extract the carrier T plasmid containing the correct gma-miR156b precursor-gene sequence checked order, cut with restriction enzyme A ge I and BamH I enzyme, reclaim digestion products;
2), with restriction enzyme A ge I and BamH I enzyme cut empty carrier pEGAD, reclaim carrier framework;
3), with T4 ligase enzyme, the digestion products of step 1 is connected with the carrier framework of step 2;
4), by the connection product heat-shock transformed E. coli competent DH5 α bacterial strain of step 3,37 DEG C of incubated overnight, picking positive colony checks order; Sequencing result shows, obtains recombinant plasmid pEGAD-35S::gma-miR156b.
3. the conversion of Agrobacterium EHA105
Adopt liquid nitrogen freeze-thaw method transformation Agrobacterium, concrete operations are as follows:
A. take out 200 frozen μ l competent cells, after thawing, add 5-10 μ l plasmid DNA, flick tube wall mixing, put 20-30min on ice;
B. take out after putting into liquid nitrogen 5min, after pipe being proceeded to 37 DEG C (5min) thawing, add 800 μ lYEP (non-resistant) liquid nutrient mediums, 28 DEG C of low-speed oscillation (150rpm) 4-5h;
D.10000rpm, 30sec, removes supernatant, adds 100 μ lYEP liquid nutrient mediums, coated plate (containing 50mg/ml kantlex) after suspension thalline;
E. put 28 DEG C to be cultured to white transformant and to grow, picking positive monoclonal shakes bacterium, transforms for soybean cotyledon node;
4. the soybean cotyledon node genetic transformation of Agrobacterium EHA105 mediation
1. with soybean varieties W82 for material, get seed material disinfection by chlorine 10 hours;
2. at B
5substratum (culture medium prescription: 2% sucrose, 0.8% agar powder (sigma), 1 × GAMBORG B-5BASAL (Phyto Technology Laboratories, article No.: G398), pH is adjusted to about 5.7; ) go up sprouting 5 days, be first with by soybean 2cm plumular axis to cut with scalpel, put into culture dish, then vertically cut along hypocotyl, leave and take hypocotyl about 2mm, removing is still connected to epicotyledonary hypocotyl tissue; Axially make 5-7 otch in cotyledon and the hypocotylar junction of cotyledon, in the Agrobacterium EHA105 of activation, infect 30min (OD
600: about 0.8);
3. explant is gone to Dual culture substratum (culture medium prescription: 2% sucrose, 0.8% agar powder (sigma), 1.67mg/L 6-BA, 0.25mg/L GA3,0.1 × GAMBORG B-5 BASAL (Phyto Technology Laboratories, article No.: G398, pH are adjusted to about 5.4; ) on train growth altogether after 3 days, go to induced bundle on inducing culture again to sprout (culture medium prescription: 2% sucrose, 0.8% agar powder (sigma), 1.67mg/L 6-BA, 10mg/L glufosinate, 1 × GAMBORG B-5BASAL (Phyto Technology Laboratories, article No.: G398), pH is adjusted to about 5.7);
4. after induced bundle is sprouted 2 weeks, get the meristematic tissue generated, new otch (horizontal direction) is made at the base portion of vegetative point, and cultured tissue is moved into elongation medium (culture medium prescription: 2% sucrose, 0.8% agar powder (sigma), 0.1mg/L IAA, 1mg/L Zeatin, 0.5mg/L GA3,10mg/L glufosinate, 1 × MURA SHIGE & SKOOG BASAL MEDIOM w/VITAMINS (Phyto Technology Laboratories, article No.: M404), pH is adjusted to about 5.7);
5. culture was shifted once on new substratum in every two weeks; A new horizontal cut is made at the base portion of explant during each transfer;
6. after 6-8 week cultivates, (culture medium prescription: 2% sucrose of taking root is moved on root media after the bud (the long > 4cm of general clip bud) extended is dipped in root in 1mg/ml IBA, 0.8% agar powder (sigma), 0.5 × MURA SHIGE & SKOOG BASAL MEDIOM w/VITAMINS (Phyto Technology Laboratories, article No.: M404), pH is adjusted to about 5.7)); Cultivate about 2-4 week, when growing enough root systems, transplant;
7. the seedling of taking root carefully is moved in small flower, in flowerpot, put into (import soil: Nutrition Soil=1:1) compost; Need cover freshness protection package one week after transplanting, make seedling get used to the new environment of soil and keep humidity, the temperature between cultivation, in 26 DEG C, takes off freshness protection package after one week;
8. after transgenic seedling restoration ecosystem, Bar gene test, careless fourth phosphine glufosinate (SIGMA is used, 45520) blade and Bar test strip (ENVIROLOGIX is smeared, 042043) three kinds of methods carry out conversion qualification, results Bar gene masculine transgenic line, carries out the expression analysis of goal gene and the qualification of phenotype at the positive plant in T1, T2 generation and the Transgenic wheat line in T3 generation.
5. the Molecular Identification of transfer-gen plant
The progeny of plants positive to T1 and T2 generation has carried out comparatively the selection Bar genetic expression of system and the qualification of gene product function.Comprising the analysis that homozygous lines PCR identifies Bar gene, blade smears careless fourth phosphine and Bar test strip.
1) PCR detection reaction method: extract Soybean genomic DNA and be used for PCR detection.Detect Bar gene whether to proceed in soybean gene group.Bar gene primer: F:CTACATCGAGACAAGCACGGTCAA (SEQ ID NO:8), R:AGAAACCCACGTCATGCCAGTTC (SEQ ID NO:9).Methods of Extracting DNA from Soybean Leaf is as follows:
A. soyabean tissue is by liquid nitrogen grinding in mortar, is moved to by the powder fully ground in 1.5mL centrifuge tube; Add 650mL CTAB extracting solution (100mM, Tris-HCl (pH8.0), 4mol/L NaCl, 20mmol/L EDTA (pH8.0), 2%CTAB, add 2mL/100mL beta-mercaptoethanol before using), mixing;
B.65 DEG C water-bath 30min, middle slight oscillatory is several times;
C. 5min is on ice placed in;
D. isopyknic chloroform is added: primary isoamyl alcohol (24:1), mixes gently;
E. room temperature, leaves standstill 10min, 12000rpm frozen centrifugation 15min, gets supernatant;
F. 2 times of volume ice ethanol are added, mixing ,-20 DEG C of standing 30min;
G. centrifugal, discharge supernatant liquor;
H.70% ethanol 1mL rinsing 2 times, dries;
Sterilized water 100 μ l dissolves, and-20 DEG C of refrigerators are preserved for a long time.
2) weedicide streak method: Basta stoste is diluted for concentration 130mg/L, when soybean first pair of ternately compound leaf launches completely, with main lobe arteries and veins for line of delimitation, with marking pen mark half leaf, then dip with cotton swab the half leaf that the wiping of careless fourth phosphine liquid marked, within 5 days, observe blade afterwards to the reaction of weedicide.As not having too large change for the positive plant blade that then weedicide was smeared compared with the blade do not smeared, the blade as then smeared weedicide for negative plant obviously turns yellow even withered.
3) Bar test strip Rapid identification method: get a little blade and put into 1.5mL centrifuge tube, grind blade with grinding rod, adds 300 μ L extracting solutions, stirs, and inserts in mixed solution, observations after 5min by test strip by the direction of regulation.Test strip occurs that 2 bands just show that this plant is positive plant, occurs that 1 explanation is negative plant.
6. result is observed
1) Bar gene test result: the progeny of plants positive to T1 and T2 generation has carried out comparatively the selection Bar genetic expression of system and the qualification of gene product function.Wherein PCR is identified that the strain (Fig. 2 A) of isozygotying has carried out the analysis that careless fourth phosphine smears (Fig. 2 B) and Bar test strip (Fig. 2 C).As seen from the figure, the transfer-gen plant of the PCR positive also present the resistance to careless fourth phosphine, and Bar gene normal expression is described, its albumen has the activity of phosphine Wheat flavone Transacetylase.
2) Molecular Identification of gma-miR156b in the middle of transfer-gen plant and Analysis of agronomic characters: due to gma-miR156b and Bar gene cotransformation, therefore, the expression analysis of gma-miR156b has been carried out subsequently to above-mentioned Bar gene pure strain.As shown in Figure 3, in Transgenic wheat line, the expression level of goal gene gma-miR156b is compared be significantly improved (Fig. 3 A) with the expression in wild-type.And tracing observation has been carried out to the economical character such as habit, Plant Growth Characters of these transfer-gen plants.Find that the transfer-gen plant of process LAN gma-miR156b is compared with contrast wild-type W82, plant height does not have noticeable change (Fig. 3 C) but plant type generation noticeable change (Fig. 3 B).Process LAN gma-miR156b significantly can increase the branch amount of soybean, is increased to 8 branches (Fig. 3 D) by average 2 branches; In addition, the single-strain legumen number of process LAN gma-miR156b transfer-gen plant too increases 59% (Fig. 3 E); The more important thing is, individual plant pod grain number too increases 2-3 doubly (Fig. 3 F), thus significantly improves the output of soybean.Therefore, gma-miR156b is the important gene determining soybean ideotype and high yield.
The cultivation of embodiment 3, desirable high yield plant type wheat
1, the extraction of soy bean DNA
A. soyabean tissue is by liquid nitrogen grinding in mortar, is moved to by the powder fully ground in 1.5mL centrifuge tube; Add 500 μ L CTAB extracting solutions (100mM, Tris-HCl (pH8.0), 4mol/L NaCl, 20mmol/L EDTA (pH8.0), 3%CTAB, add 2mL/100mL beta-mercaptoethanol before using), mixing;
B.65 DEG C water-bath 30min, middle slight oscillatory is several times;
C. 5min is on ice placed in;
D. isopyknic chloroform is added: primary isoamyl alcohol (24:1), mixes gently;
E. room temperature, leaves standstill 10min, 12000rpm frozen centrifugation 15min, gets supernatant;
F. 2 times of volume ice ethanol are added, mixing ,-20 DEG C of standing 30min;
G. centrifugal, discharge supernatant liquor;
H.70% ethanol 1mL rinsing 2 times, dries;
I. sterilized water 100 μ l dissolves, and-20 DEG C of refrigerators are preserved for a long time.
2, recombinant expression vector is built
(1) clone of gma-miR156b gene
The precursor sequence 181bp (SEQ ID NO:2) altogether of gma-miR156b, according to this primers pair, according to carrier pEGAD multiple clone site, prime end introduces Age I respectively and BamH I enzyme cuts recognition site, with the DNA of soybean varieties W82 for template carries out PCR, the encoding gene of amplification gma-miR156b precursor; Primer sequence is:
gma-miR156b-F：5'-TGCACCGGTGGGTTCTATTGGTGGTTG-3'(SEQ?ID?NO：3)
gma-miR156b-R：5'-CGGGATCCCGTCTACTTTGGCTAGAAAG-3'(SEQ?ID?NO：4)
Amplification program is: 95 DEG C 5 minutes; 95 DEG C 30 seconds, 57 DEG C 30 seconds, 72 DEG C 40 seconds, 26 circulations; 72 DEG C 30 seconds;
Pcr amplification product carries out 1% agarose gel electrophoresis, adopts the raw work glue in Shanghai to reclaim the band that test kit reclaims purifying 181bp size;
The DNA fragmentation reclaimed is connected with pMD19-T carrier (Takara company), T vector 1 μ l is added in 10 μ l systems, solution I 5 μ l, reclaim fragment 4 μ l, mixing mixed solution, 16 DEG C of connections are spent the night, thermal shock method proceeds to E.coli competent escherichia coli cell, incubated overnight, chooses positive colony, delivers the order-checking of invitrogen company.
(2) structure of recombinant expression vector
1), extract the carrier T plasmid containing the correct gma-miR156b precursor-gene sequence checked order, cut with restriction enzyme A ge I and BamH I enzyme, reclaim digestion products;
2), with restriction enzyme A ge I and BamH I enzyme cut empty carrier pEGAD, reclaim carrier framework;
3), with T4 ligase enzyme, the digestion products of step 1 is connected with the carrier framework of step 2;
4), by the connection product heat-shock transformed E. coli competent DH5 α bacterial strain of step 3,37 DEG C of incubated overnight, picking positive colony checks order; Sequencing result shows, obtains recombinant plasmid pEGAD-35S::gma-miR156b.
3. wheat mature embryo particle gun genetic transformation
1) induction of mature embryo callus:
The wheat breed section agriculture 199 seed alcohol disinfecting 5min of 70%, then soaks seed 13min, aseptic water washing 5 times with the mercuric chloride of 0.1%; Then thidiazuron (TDZ) solution wheat seed being placed in 10mg/L processes 15h under 25 DEG C of room temperature conditions; Strip mature embryo, be inoculated in evoked callus on mature embryo callus inducing culture; Wheat mature embryo callus inducing medium is with general MS substratum (Phyto Technology Laboratories, article No.: G398) be benchmark, add following material: 2,4-dichlorphenoxyacetic acid (2,4-D): 2.0mg/L, vitamin (VB1): 8.0mg/L, caseinhydrolysate: 500mg/L, L-asparagine: 250mg/L, L-glutaminate: 200mg/L; Sucrose: 15g/L, maltose: 15g/L, agar: 5g/L; PH=5.7; Wheat mature embryo organizes inducing culture to produce mature embryo callus successively after 6 days, and the mature embryo callus selecting induction quality densification in two weeks is transferred to height and oozed in substratum, cultivates 6h in 20 DEG C of dark conditions; It is add the N.F,USP MANNITOL of 0.2mol/L and the sorbyl alcohol of 0.2mol/L again in above-mentioned wheat mature embryo callus inducing medium that height oozes culture medium prescription;
2) biolistic bombardment transforms:
The gene gun conversion method of the mature embryo callus routine after high osmotic treatment carries out bombardment and transforms, biolistic bombardment parameter is: bronze diameter 1.0 μm, stop that the distance between net and bombardment material is 9.0cm, can split film pressure is 1100Pa, every rifle bronze/pEGAD-35S::gma-miR156b consumption is 0.5 μ g/30 μ g, and every ware material bombards 1 time;
3) renewal cultivation:
Callus, after height oozes substratum continues light culture 18h, was oozed media transfer to recovery media from height by the mature embryo callus after biolistic bombardment, in 26 DEG C of light culture two weeks; Wheat mature embryo callus recovery media with general MS substratum for benchmark, add following material: 2,4 dichlorophenoxyacetic acid (2,4-D): 1.5mg/L, 6-furyl aminopurine (KT): 0.5mg/L, caseinhydrolysate: 500mg/L, L-asparagine: 250mg/L, L-glutaminate: 200mg/L, vitamin (VB1): 8.0mg/L, sucrose: 15g/L, maltose: 15g/L, agar: 5g/L; PH=5.7;
4) differentiation culture:
To recover and mature embryo callus after screening and culturing goes on division culture medium and carries out differentiation culture; Culture temperature is 25 ~ 28 DEG C, division culture medium with collective media MS for benchmark, add following material: 6-furyl aminopurine (KT): 2.0mg/L, α-naphthaleneacetic acid (NAA): 0.01mg/L, casein: 500mg/L, vitamin H: 0.5mg/L, vitamin (VB1): 8.0mg/L, sucrose: 15g/L, maltose: 15g/L, agar: 5g/L; PH=5.7;
5) root culture:
Transfer on root media when the bud seedling of mature embryo callus differentiation grows to 2 ~ 3 leaves, in 25 DEG C, carry out root culture under 3000Lux illumination condition; Root media with collective media MS for benchmark, and by the inorganic salt concentration of general for MS cultivation reduce half, wherein add α-naa (NAA) 0.5mg/L, sucrose: 30g/L, agar: 5g/L; PH=5.7; After transgenic seedling restoration ecosystem, use Bar gene test, results Bar gene masculine transgenic line, carry out the expression analysis of goal gene and the qualification of phenotype at the positive plant in T1, T2 generation and the Transgenic wheat line in T3 generation.
4. the Molecular Identification of transfer-gen plant
PCR method is adopted to carry out the qualification of Bar gene to the progeny of plants that T1 and T2 generation is positive.
PCR detection reaction method: extract Wheat volatiles DNA and be used for PCR detection.Detect Bar gene whether to proceed in Wheat volatiles.Bar gene primer: F:CTACATCGAGACAAGCACGGTCAA (SEQ ID NO:8), R:AGAAACCCACGTCATGCCAGTTC (SEQ ID NO:9).
5. result is observed
1) Bar gene test result: the plant positive to T2 generation has carried out Bar gene identification.As (Fig. 4) display, identified the positive transgenic lines of 156b-2-3 and 156b-5-8 two separate source by PCR method.
2) Analysis of agronomic characters of gma-miR156b in transgenic wheat: tracing observation has been carried out to the economical character such as habit, fringe type feature of these transfer-gen plants.Find that the transfer-gen plant of process LAN gma-miR156b is compared with check variety section agriculture 199, spike length significantly increases (Fig. 5 A, 5B).Process LAN gma-miR156b significantly can increase the tiller number of transgenic wheat, and tillering by average 3.3 is increased to 4.4 tiller (Fig. 5 C); In addition, the grain number per spike of process LAN gma-miR156b transfer-gen plant also significantly increases (Fig. 5 D); The more important thing is, single fringe averageparticle is heavy also significantly increases (Fig. 5 E), thus significantly improves the output of wheat.Therefore, gma-miR156b is the important gene determining wheat tillering and high yield.
Foregoing description only proposes as the enforceable technical scheme of the present invention; not as the single restricted condition to its technical scheme itself; such as: the precursor sequence containing miRNA of the present invention; the expression vector of ripe miRNA sequence and sequence itself; the required primer of amplification, transgenic cell line and Host Strains etc. all belong to protection scope of the present invention.
Claims (10)
1. in sequence table microRNA shown in SEQ ID NO:1 cultivating the application in multi-branched and/or many pods and/or seediness grain plant type plant.
2. application according to claim 1, is characterized in that: the microRNA shown in process LAN SEQ ID NO:1 in plant, cultivates the transgenic plant with multi-branched and/or many pods and/or seediness grain plant type.
3. application according to claim 2, it is characterized in that: first build the recombinant expression vector containing described microRNA precursor sequence, then this recombinant expression vector is utilized to build transformant, recycle this transformant and infect object plant, screening obtains the high-yield transgenic plants compared with normal plants with multi-branched, many pods, seediness grain; The precursor sequence of described microRNA is as shown in SEQ ID NO:2.
4. application according to claim 3, is characterized in that: the step building the recombinant expression vector containing polynucleotide sequence shown in SEQ ID NO:2 is:
1), first with plant leaf DNA for template, amplification obtains polynucleotide sequence shown in SEQ ID NO:2 and is also connected in carrier T, then cuts gained carrier T plasmid with restriction enzyme A ge I and BamH I enzyme, recovery digestion products;
2), then cut empty carrier pEGAD with restriction enzyme A ge I and BamH I enzyme, reclaim carrier framework;
3), finally with T4 ligase enzyme by step 1) digestion products and step 2) carrier framework be connected;
4), by step 3) connection product heat-shock transformed E. coli competent DH5 α bacterial strain, 37 DEG C of incubated overnight, picking positive colony carries out sequence verification, obtains recombinant expression vector pEGAD-35S::gma-miR156b.
5. application according to claim 3, is characterized in that: adopt liquid nitrogen freeze-thaw method transformation Agrobacterium EHA105 to obtain transformant, concrete operation step comprises:
A. take out 200 frozen μ l competence agrobatcerium cells, after thawing, add the plasmid DNA of 5-10 μ l recombinant expression vector, flick tube wall mixing, put 20-30min on ice;
B. take out after putting into liquid nitrogen 5min, pipe is proceeded to 37 DEG C, after 5min melts, add 800 μ lYEP liquid nutrient mediums, 28 DEG C of low-speed oscillations, 150rpm, 4-5h;
D.10000rpm, 30sec, removes supernatant, adds 100 μ lYEP liquid nutrient mediums, coated plate after suspension thalline;
E. be placed in 28 DEG C to be cultured to white transformant and to grow, picking positive monoclonal shakes bacterium, transforms for plant cotyledonary node.
6. the application according to any one of claim 1-5, is characterized in that: described object plant is soybean or wheat.
7. the precursor sequence of microRNA described in claim 1, it has the nucleotide sequence shown in SEQ ID NO:2, is sheared and expresses to obtain corresponding microRNA in vegetable cell.
8. the recombinant expression vector containing microRNA precursor sequence described in claim 7.
9. the transformant containing microRNA precursor sequence described in claim 7
10. the primer pair of the microRNA precursor sequence described in claim 7 that increases, its nucleotide sequence is as shown in SEQ ID NO:3 and SEQ ID NO:4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410478207.XA CN104232682B (en) | 2014-09-18 | 2014-09-18 | Method for cultivating high-yield plant by overexpression of gma-miR156b |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410478207.XA CN104232682B (en) | 2014-09-18 | 2014-09-18 | Method for cultivating high-yield plant by overexpression of gma-miR156b |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104232682A true CN104232682A (en) | 2014-12-24 |
| CN104232682B CN104232682B (en) | 2017-01-11 |
Family
ID=52221576
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410478207.XA Active CN104232682B (en) | 2014-09-18 | 2014-09-18 | Method for cultivating high-yield plant by overexpression of gma-miR156b |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104232682B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106615619A (en) * | 2016-12-19 | 2017-05-10 | 浙江大学 | Feed containing miRNA-34 (micro Ribonucleic Acid-34) as well as production method and anti-virus and anti-cancer effects thereof |
| CN108841863A (en) * | 2018-07-24 | 2018-11-20 | 华中农业大学 | A method of cultivating high nodulation and nitrogen fixation plant |
| CN109055422A (en) * | 2018-08-21 | 2018-12-21 | 西南大学 | Application of the miRNA PtomiR6443 in regulation lignin S/G value |
| CN109929873A (en) * | 2019-03-20 | 2019-06-25 | 华中农业大学 | A method of cultivating drought resisting genetically modified plants |
| CN115851754A (en) * | 2022-07-11 | 2023-03-28 | 华中农业大学 | Soybean gene GmYSL7 and application thereof, primer pair, expression vector and application thereof |
| CN116042696A (en) * | 2022-12-28 | 2023-05-02 | 南京林业大学 | Application of cymbidium MIR156a gene in regulating and controlling plant fruit development |
| CN116254288A (en) * | 2022-12-28 | 2023-06-13 | 南京林业大学 | Application of cymbidium MIR156b gene in regulating and controlling flowering time of plants |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220330A (en) * | 2011-06-10 | 2011-10-19 | 中国科学院遗传与发育生物学研究所 | MiRNA-gma-miR56b related to drought resistance of plants and application thereof |
| CN103589721A (en) * | 2012-08-15 | 2014-02-19 | 北京命码生科科技有限公司 | Extraction, preparation and application of plant micro ribonucleic acid |
-
2014
- 2014-09-18 CN CN201410478207.XA patent/CN104232682B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220330A (en) * | 2011-06-10 | 2011-10-19 | 中国科学院遗传与发育生物学研究所 | MiRNA-gma-miR56b related to drought resistance of plants and application thereof |
| CN103589721A (en) * | 2012-08-15 | 2014-02-19 | 北京命码生科科技有限公司 | Extraction, preparation and application of plant micro ribonucleic acid |
Non-Patent Citations (2)
| Title |
|---|
| KABIN XIE 等: ""Genomic Organization，Differential Expression，and Interaction of SQUAMOSA Promoter-Binding-Like Transcription Factors and microRNA156 in Rice"", 《PLANT PHYSIOLOGY》, vol. 42, no. 1, 21 July 2006 (2006-07-21) * |
| 登陆号: ""GenBank Accession No：NR_048600.1"", 《GENBANK》, 16 May 2012 (2012-05-16) * |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106615619A (en) * | 2016-12-19 | 2017-05-10 | 浙江大学 | Feed containing miRNA-34 (micro Ribonucleic Acid-34) as well as production method and anti-virus and anti-cancer effects thereof |
| CN108841863A (en) * | 2018-07-24 | 2018-11-20 | 华中农业大学 | A method of cultivating high nodulation and nitrogen fixation plant |
| CN108841863B (en) * | 2018-07-24 | 2020-08-18 | 华中农业大学 | Method for cultivating high-nodulation nitrogen-fixing plant |
| CN109055422A (en) * | 2018-08-21 | 2018-12-21 | 西南大学 | Application of the miRNA PtomiR6443 in regulation lignin S/G value |
| CN109055422B (en) * | 2018-08-21 | 2022-04-19 | 西南大学 | Application of miRNA PtomiR6443 in regulation and control of lignin S/G value |
| CN109929873A (en) * | 2019-03-20 | 2019-06-25 | 华中农业大学 | A method of cultivating drought resisting genetically modified plants |
| CN115851754A (en) * | 2022-07-11 | 2023-03-28 | 华中农业大学 | Soybean gene GmYSL7 and application thereof, primer pair, expression vector and application thereof |
| CN116042696A (en) * | 2022-12-28 | 2023-05-02 | 南京林业大学 | Application of cymbidium MIR156a gene in regulating and controlling plant fruit development |
| CN116254288A (en) * | 2022-12-28 | 2023-06-13 | 南京林业大学 | Application of cymbidium MIR156b gene in regulating and controlling flowering time of plants |
| CN116042696B (en) * | 2022-12-28 | 2023-09-22 | 南京林业大学 | Application of cymbidium MIR156a gene in regulating and controlling plant fruit development |
| CN116254288B (en) * | 2022-12-28 | 2023-09-22 | 南京林业大学 | Application of cymbidium MIR156b gene in regulating and controlling flowering time of plants |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104232682B (en) | 2017-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104232682B (en) | Method for cultivating high-yield plant by overexpression of gma-miR156b | |
| CN107312793A (en) | The tomato dna editor carrier of Cas9 mediations and its application | |
| CN110305201B (en) | Plant stress resistance related gene and its coded protein and application | |
| Raji et al. | Agrobacterium-and biolistic-mediated transformation of maize B104 inbred | |
| CN104004781A (en) | Preparation method of glyphosate resistant transgenic rice | |
| CN106636182A (en) | Construction of CRISPR-Cas9 system of tomato PSY 1 gene and application thereof | |
| CN104327173B (en) | A kind of cotton WRKY transcription factors GarWRKY22 of regulation and control plant salt endurance and application | |
| CN109234310A (en) | It is quickly obtained the recombinant vector and application method of no transgene gene editor plant | |
| CN102433356A (en) | Agrobacterium-mediated transgenic method for mature seed embryos of corn | |
| CN112342222A (en) | Wheat salt-tolerant gene TaAAP3 and application thereof | |
| CN104328127B (en) | Tumorous stem mustard stress resistance gene BjEFh1 as well as plant expression vector and application thereof | |
| CN102994544A (en) | Method for cultivating transgenetic gloxinia plant through agrobacterium-mediated transformation | |
| CN102337295A (en) | Agrobacterium-mediated melon seedling apex transformation method | |
| CN109852634A (en) | A method of cultivating high nodulation and nitrogen fixation genetically modified plants | |
| CN102154337A (en) | Gossypium hirsutum mitogen-activated protein kinas 6 (GhMAPK6) gene and application thereof | |
| CN108795927A (en) | The clone of common wheat gene TaSPX3 coded sequences and its application | |
| Okeyo-Ikawa et al. | In planta seed transformation of Kenyan cowpeas (Vigna unguiculata) with P5CS gene via Agrobacterium tumefaciens. | |
| CN106047922A (en) | Method for improving drought resistance of corn through transgenosis | |
| CN103243108A (en) | Calcium ion binding protein derived from stem nodule as well as encoding gene and application thereof | |
| CN101906426B (en) | Method for regulating plant photoperiod by combining soybean gibberellin with protein gene | |
| CN105316359A (en) | Plasma treatment and transgenosis combined corn breeding method | |
| CN102154363A (en) | Recombinant vectors containing specific promoters of rice endosperm and use and plant thereof | |
| CN104877987A (en) | Soybean regeneration-associated gene (GmESR1) and expression analysis thereof | |
| CN116240219B (en) | Wheat RTH-1 gene and application thereof | |
| CN116555301B (en) | SlMETS1 gene and application thereof in regulation and control of tomato growth and development |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |