CN106047922A

CN106047922A - Method for improving drought resistance of corn through transgenosis

Info

Publication number: CN106047922A
Application number: CN201610398994.6A
Authority: CN
Inventors: 张春; 李向龙; 张中保; 吴忠义
Original assignee: BEIJING AGRICULTURAL BIOLOGICAL TECHNOLOGY Research CENTRE
Current assignee: BEIJING AGRICULTURAL BIOLOGICAL TECHNOLOGY Research CENTRE
Priority date: 2016-06-07
Filing date: 2016-06-07
Publication date: 2016-10-26

Abstract

The invention belongs to the field of plant genetic engineering and provides a method for improving the drought resistance of corn through transgenosis. The method comprises the step as follows: a CKX1 gene is transferred to a corn genome, wherein the CKX1 gene has a nucleotide sequence shown in SEQ ID NO:1 in a sequence table. A specifically expressed CKX1 gene in roots of a corn plant can be induced by transferring the CKX1 gene into the corn genome, accordingly, growth and development of the root system of corn are promoted, the corn plant can absorb moisture deep in the soil, the drought resistance of the corn is improved, and growth and development of the corn cannot be influenced under a normal moisture condition.

Description

A kind of method improving drought resistance of maize by transgenic

Technical field

The invention belongs to plant genetic engineering field, particularly to a kind of side being improved drought resistance of maize by transgenic Method.

Background technology

Semen Maydis is the cereal crops that grown worldwide is widest in area, yield is maximum, occupies first of Three major grain crops.China is beautiful Rice production and consumption big country, sown area, total output, consumption figure are only second to the U.S., Jun Ju second place of the world.But the Semen Maydis of China Producing and face the severeest Arid Problem, the drought frequently occurred makes corn yield suffer massive losses, according to the Ministry of Agriculture Statistics, China corn yield occurs the main reason of fluctuation to be arid, within such as 2000, causes whole nation grain because of severe drought Decreased food intake produces 46,200,000,000 kilograms, wherein the Semen Maydis underproduction 22,100,000,000 kilograms, accounts for the 48% of output reduction.Therefore drought-resistant corn new varieties pair are cultivated China's grain-production is significant.

Summary of the invention

It is an object of the invention to provide a kind of method improving drought resistance of maize by transgenic, the method is by by CKX1 Gene proceeds in Maize genome, thus substantially increases the drought resistance of Semen Maydis.

The present inventor finds through research, by proceeding in Maize genome by CKX1 gene, can induce jade Specifically expressing CKX1 gene in rice plant root, thus promote the growth promoter of maize root system, beneficially milpa obtains soil The moisture of deep layer, thus improve the drought resistance of Semen Maydis, the most also do not interfere with Semen Maydis growth promoter under the conditions of normal moisture.

The invention provides a kind of method improving drought resistance of maize by transgenic, described method includes CKX1 gene Proceed to the step in Maize genome；Described CKX1 gene has the nucleotide sequence shown in SEQ ID NO:1 in sequence table.

Preferably, the method includes the plant expression vector building CKX1 gene, and with the plant table of described CKX1 gene Reach the step of vector Semen Maydis.

Preferably, the carrier that sets out of the plant expression vector of described CKX1 gene is PGreen0229 plasmid vector, described The plant expression vector of CKX1 gene is with promoter EXP18-D gene, terminator Nos gene and CKX1 gene.

Preferably, the 35S Bar gene that marker gene is antiweed of the plant expression vector of described CKX1 gene.

Preferably, described 35S Bar gene has the nucleotide sequence shown in SEQ ID NO:2 in sequence table；

Described Nos gene has the nucleotide sequence shown in SEQ ID NO:3 in sequence table；

Described EXP18-D gene has the nucleotide sequence shown in SEQ ID NO:4 in sequence table.

Preferably, the plant expression vector of described structure CKX1 gene comprises the following steps:

First described 35S Bar gene is connected to PGreen0229 plasmid vector, obtains 35S Bar-PGreen0229 matter Grain carrier；

Described Nos gene is connected to described 35S Bar-PGreen0229 plasmid vector again, obtains Nos-35S Bar- PGreen0229 plasmid vector；

Described EXP18-D gene is connected to described Nos-35S Bar-PGreen0229 plasmid vector again, obtains EXP18-D-Nos-35S Bar-PGreen0229 plasmid vector；

Finally described CKX1 gene is connected to described EXP18-D-Nos-35S Bar-PGreen0229 plasmid vector, Plant expression vector to described CKX1 gene.

Preferably, by the pollen tube passage method plant expression vector maize transformation of described CKX1 gene.

Preferably, described by pollen tube passage method with the plant expression vector maize transformation of described CKX1 gene include with Lower step:

First milpa is carried out bagging pollination process；

Again the spica of described milpa is carried out pruning modes；

Plant expression vector maize transformation at the described CKX1 gene of incision that described pruning modes is formed.

Preferably, the plant expression of the described CKX1 gene of incision that use linear DNA is formed at described pruning modes Vector Semen Maydis；Wherein,

Described linear DNA by carrying out pcr amplification reaction acquisition with the plant expression vector of described CKX1 gene for template, The primer that described pcr amplification reaction uses is to having the nucleotides sequence shown in SEQ ID NO:6 and SEQ ID NO:7 in sequence table Row.

Preferably, the program of described pcr amplification reaction is:

96 DEG C of denaturations 4min；98 DEG C of degeneration 10s, 56 DEG C of annealing 15s, 72 DEG C extend 7min, totally 30 circulations；72 DEG C are prolonged Stretch 10min.

The method of the raising drought resistance of maize that the present invention provides has the advantages that

1, the present invention uses the root-specific promoter EXP18-D from monocotyledon rice to drive arabidopsis CKX1 base Because expressing in corn inbred line, promote the growth promoter of maize root system, beneficially milpa and obtain the water of deep subsoil Point, thus improve the drought resistance of transgenic corns.

2, the method for the present invention can promote the growth absorption with the various nutrient ions of increase of maize root system, to transgenic Semen Maydis growth promoter under normally having moisture condition has no adverse effect, that is can improve transgenic under drought condition Corn yield, and the transgenic corns yield not underproduction under moisture sufficiency, even can also increase production.

Other features and advantages of the present invention will describe in detail in following detailed description of the invention part.

Accompanying drawing explanation

Fig. 1 is to build the plant expression vector collection of illustrative plates obtained in embodiment 1.

Fig. 2 is the digestion products electrophoresis pattern of plant expression vector in embodiment 1.

Fig. 3 is Maize genome pcr amplification reaction product electrophoresis pattern in embodiment 3.

Fig. 4 is the Southern results of hybridization figure of transfer-gen plant in embodiment 3.

Fig. 5 is the photo of growing state during comparative control plant and transgenic line tie up to drought canopy in embodiment 3.

Fig. 6 is the photo of the root length degree of comparative control plant and transgenic line in embodiment 3.

Fig. 7 is the block diagram of the root length degree of comparative control plant and transgenic line in embodiment 3.

Fig. 8 is comparative control plant and the grain weight per panicle of transgenic line and the block diagram of mass of 1000 kernel in embodiment 3.

Detailed description of the invention

For making the object, technical solutions and advantages of the present invention clearer, embodiments of the present invention will be made below into One step ground describes in detail.It should be appreciated that detailed description of the invention described herein is merely to illustrate and explains the present invention, and It is not used in the restriction present invention.

Embodiment 1:

The present embodiment is used for illustrating the acquisition of CKX1 gene, and the structure of the plant expression vector of CKX1 gene；Should The nucleotide sequence of CKX1 gene is as shown in SEQ ID No:1 in sequence table.

The construction method of the plant expression vector of CKX1 gene comprises the following steps:

(1) acquisition of CKX1 gene:

CKX1 gene is synthesized by Shanghai raw work biology company limited according to arabidopsis gene At5g56970cDNA sequence, its Nucleotides sequence is listed in shown in sequence table SEQ ID No:1；The aminoacid sequence of the polypeptide chain of this CKX1 gene code such as sequence In table shown in SEQ ID No:5；The two ends of the sequence of SEQ ID No:1, with spe I and Not I restriction enzyme site, are connected to On puc57 plasmid, it is commercially available with the form of puc57-CKX1 plasmid；

This CKX1 gene can also be obtained by RT-PCR method clone in the genome of arabidopsis thaliana.

(2) structure of plant expression vector (CKX1-EXP18-D-Nos-35S Bar-PGreen0229 plasmid vector):

Method one:

1. 35S Bar gene is connected to PGreen0229 plasmid vector, obtains 35S Bar-PGreen0229 plasmid and carry Body:

First puc57-35S Bar plasmid Sac I restriction endonuclease is carried out endonuclease reaction, reclaims and obtain with restriction enzyme site 35S Bar gene；PGreen0229 plasmid vector Sac I restriction endonuclease is carried out endonuclease reaction again, reclaims and obtain size about The fragment of 4451bp；Afterwards this is attached with the 35S Bar gene of restriction enzyme site and the fragment of size about 4451bp Reaction, obtains 35S Bar-PGreen0229 plasmid vector；

The nucleotide sequence of above-mentioned 35S Bar gene is as shown in SEQ ID No:2 in sequence table；This 35S Bar gene by Raw work biology company limited synthesizes and is connected on puc57 plasmid, is commercially available with the form of puc57-35S Bar plasmid.

2. Nos gene is connected to above-mentioned 35S Bar-PGreen0229 plasmid vector, obtain Nos-35S Bar- PGreen0229 plasmid vector:

First puc57-Nos plasmid Hind III and csp I restriction endonuclease is carried out endonuclease reaction, reclaims and obtain with enzyme action position The Nos gene of point；Again described 35S Bar-PGreen0229 plasmid vector Hind III and csp I restriction endonuclease is carried out enzyme action Reaction, reclaims and obtains the fragment that size is about 5804bp；Afterwards this is about with Nos gene and the size of restriction enzyme site The fragment of 5804bp is attached reaction, obtains Nos-35S Bar-PGreen0229 plasmid vector；

The nucleotide sequence of above-mentioned Nos gene is as shown in SEQ ID No:3 in sequence table；This Nos gene is biological by giving birth to work Company limited synthesizes and is connected on puc57 plasmid, is commercially available with the form of puc57-Nos plasmid.

3. EXP18-D gene is connected to above-mentioned Nos-35S Bar-PGreen0229 plasmid vector, obtains EXP18-D- Nos-35S Bar-PGreen0229 plasmid vector:

First puc57-EXP18-D plasmid Hind III restriction endonuclease is carried out endonuclease reaction, reclaims and obtain with restriction enzyme site EXP18-D gene；Again this Nos-35S Bar-PGreen0229 plasmid vector Hind III restriction endonuclease is carried out endonuclease reaction, Reclaim and obtain the fragment that size is about 6026bp；Afterwards this is about with EXP18-D gene and the size of restriction enzyme site The fragment of 6026bp is attached reaction, obtains EXP18-D-Nos-35S Bar-PGreen0229 plasmid vector；

The nucleotide sequence of above-mentioned EXP18-D gene is as shown in SEQ ID No:4 in sequence table；This EXP18-D gene by Raw work biology company limited synthesizes and is connected on puc57 plasmid, is commercially available with the form of EXP18-D-puc57 plasmid.

4. CKX1 gene is connected to above-mentioned EXP18-D-Nos-35S Bar-PGreen0229 plasmid vector, obtains CKX1-EXP18-D-Nos-35S Bar-PGreen0229 plasmid vector:

First puc57-CKX1 plasmid spe I and Not I restriction endonuclease are carried out endonuclease reaction, reclaims and obtain with enzyme action position The CKX1 gene of point；Again EXP18-D-Nos-35S Bar-PGreen0229 plasmid vector spe I and Not I restriction endonuclease are entered Row endonuclease reaction, reclaims and obtains the fragment that size is about 88028bp；Afterwards by with the CKX1 gene of restriction enzyme site and size about Fragment for 8028bp is attached reaction, obtains CKX1-EXP18-D-Nos-35S Bar-PGreen0229 plasmid vector, i.e. The plant expression vector of CKX1 gene.In the endonuclease reaction of the plant expression vector of above-mentioned structure CKX1 gene, enzyme action system is equal For: 10 × buffer:2 μ l；Restriction endonuclease: 2 μ l (during double digestion, two kinds of each 1 μ l of restriction endonuclease), plasmid: 10 μ l, ddH₂O；6μl；In 37 DEG C are reacted 3 hours；

In the coupled reaction of the plant expression vector of above-mentioned structure CKX1 gene, linked system is: 10 × buffer:1 μ l, The fragment that molecular weight is big: 1 μ l, the fragment that molecular weight is little: 7 μ l, T4DNA ligase: 1 μ l；16 DEG C connect overnight；

Various restricted enzyme, T4DNA ligase used above are purchased from Takara company.

The initial carrier of above-mentioned plant expression vector is pGreen0229, is the general load of arabidopsis thaliana transformation and other plant Body, is inserted in Spe I/Not I from arabidopsis thaliana genes of interest CKX1；This plant expression vector high safety；Above-mentioned open Mover is EXP18-D, is from rice root specific promoter；Terminator is Nos, for Agrobacterium tumefaciems Ti-plasmids T-DNA district rouge Fat alkali synthase gene terminator, is used for terminating CKX1 genetic transcription.

Method two:

Above-mentioned plant expression vector can also build by the following method: utilizes PGM-35S Bar universal support (structure side The Agriculture of Anhui science such as method is recorded in " structure of PGM-35Sbar Semen Maydis universal expression vector and corn transformation research ", Wang Xiaohan 2012,40:12367-12370), UBQ I promoter is substituted with root-specific promoter EXP18-D in Hind III site, by mesh Gene C KX1 insert between Spe I/Not I restriction enzyme site, correct through sequence verification.

The plant expression vector collection of illustrative plates that said method one and method two build is as shown in Figure 1.

5. the plant expression vector of CKX1 gene that any one in above two method builds is carried out conversion processing, Shaken cultivation processes, plasmid extraction processes, endonuclease reaction, correct to verify this plant expression vector construction:

This conversion processing is: the plant expression vector 5 μ l taking this CKX1 gene adds 100 μ l competent escherichia coli cells In DH5 α competent cell, mix gently, place 30 minutes on ice；42 DEG C of heat shocks 45 seconds again, place 2 minutes on ice；Add 500 μ l LB nonreactive culture medium, in 37 DEG C of rotating speed 150rpm shaken cultivation 1 hour；It is centrifuged 5 minutes with rotating speed 4000rpm again, uses Rifle sops up 400 μ about l supernatant, and remaining spreading rod is coated in the culture medium of the kanamycin (Kan) containing 50mg/L； Then at 37 DEG C of incubated overnight, obtain single bacterium colony.

This shaken cultivation is processed as: the above-mentioned single bacterium colony grown of picking respectively, adds LB fluid medium, and 37 DEG C overnight Shaken cultivation.

This plasmid extraction is processed as: precious biological engineering (Dalian) company limited of the bacterium solution cultivated by above-mentioned overnight shaking DV801A type plasmid DNA small scale purification test kit carries out plasmid extraction process, obtains plant expression vector.

This endonuclease reaction is: the plant expression vector restriction endonuclease Spe I and Not I extracted is carried out endonuclease reaction, Obtain digestion products, enzyme action system and step 4. in identical；Again digestion products is carried out 1.5% agarose gel electrophoresis.Electrophoresis Result is as in figure 2 it is shown, be digestion products in swimming lane 1-4, and band is from top to bottom respectively large fragment and the 1.6kb of about 8.4kb The small fragment of left and right, may certify that this plant expression vector construction is correct.

Embodiment 2:

The present embodiment be plant expression vector prepared by embodiment 1 as template, carry out pcr amplification reaction, sieved Select the linear DNA of expression cassette, then by this linear DNA in pollen tube passage method proceeds to Semen Maydis 178, comprise the steps:

(1) preparation of linear DNA:

(this linear DNA includes genes of interest and the expressed intact of herbicide screening gene to the linear DNA of screening expression cassette Box), by the plant expression vector prepared with embodiment 1 as template, use the method for PCR amplification to obtain.

Wherein, the primer of PCR amplification is:

Forward primer (LacZ-F1) (in sequence table shown in SEQ ID NO:6):

GTAATACGACTCACTATAGGGCGAATTGGGT；

Downstream primer (RB-R) (in sequence table shown in SEQ ID NO:7):

GTTTACCCGCCAATATATCCTGTCA。

The program of pcr amplification reaction is as follows:

96 DEG C of denaturations 4min；98 DEG C of degeneration 10s, 56 DEG C of annealing 15s, 72 DEG C extend 7min, totally 30 circulations；72 DEG C are prolonged Stretch 10min, 4 DEG C of preservations；

The reaction system of pcr amplification reaction is following (as a example by 50 μ l systems):

Template (0.2ng/ μ l) 1 μ l, 5 × Prime STAR Buffer 10 μ l, dNTP (each 2.5mM) 5 μ l, forward primer (10 μMs) 1 μ l, downstream primer (10 μMs) 1 μ l, Prime STAR HS DNA Polymerase (2.5U/ μ l) 1 μ l, dd H₂O adds To 50 μ l.

The aseptic ddH of linear DNA that will obtain₂O adjusts concentration, obtains the linear DNA solution that concentration is 30ng/ μ l.

(2) pollen tube passage method maize transformation:

1., when Semen Maydis florescence, normotrophic plant is selected to carry out bagging pollination process；

2. 20h after above-mentioned pollination processes, carries out pruning modes as follows to the spica of milpa: first will Paper bag on the female fringe of milpa is taken, and cuts off filigree and the bract on about distance cob top 1～2cm with shears, keeps Filigree tangent plane is concordant, and makes the filigree in bract be slightly above bract；

The most then it is 30ng/ μ l with disposable needle tubing in the incision that above-mentioned pruning modes the is formed 200 μ l concentration that instil Linear DNA solution, puts paper bag, the time of record conversion and linear DNA title the most again.

Embodiment 3:

During corn ear maturation after the conversion of example 2 to be performed, gathered in the crops and dried threshing, obtained transformed the seed；This turn After changing planting seed, spray 200mg/L hundred speed glufosinate-ammonium herbicide in the 3-5 leaf phase in seedling stage, it is thus achieved that resistant plant (part strain Named L77-4, L85-8, L122-1, L188-5, L242-2, L255-1, L264-8, L407-11) for Molecular Detection.Turn Gene strain selfing expanding propagation obtains homozygous lines to T3 generation.

In order to determine that above-mentioned CKX1 gene has been integrated in Maize genome, above-mentioned resistant plant is carried out PCR detection, Southern hybridization check.

(1) pcr amplification reaction detection:

DNA sequence composition design primer according to CKX1 gene, primer sequence is as follows:

Primer 1 (forward primer) (in sequence table shown in SEQ ID NO:8):

5 ' TCAAGCATTCAAGCATGGAC 3 ',

Primer 2 (downstream primer) (in sequence table shown in SEQ ID NO:9):

5’GGTCCCTTGAAAATGCAGAAT 3’

Use SDS micromethod to extract the DNA of maize leaf, then with this DNA as template, with above-mentioned primer 1 and primer 2 be Primer, expands CKX1 genetic fragment with PTC-100PCR amplification instrument (M.J.Research company)；

The pcr amplification reaction system of 50 μ l is: 10 × PCR buffer 5 μ l, 2mM dNTP 5 μ l, primer 1 He of 50 μMs The each 1 μ l of primer 2, template DNA (1 μ g/ μ l) 1 μ l；Taq archaeal dna polymerase 2.5 μ l；Add water to 50 μ l；

Pcr amplification reaction condition is: first 94 DEG C of 5min；Then 94 DEG C of 1min, 57 DEG C of 1min, 72 DEG C of 2min, totally 30 are followed Ring；Last 72 DEG C of 7min.

After PCR reaction terminates, PCR primer carrying out 1% agarose gel electrophoresis detection, testing result is as it is shown on figure 3, can See in swimming lane 1-4, positive transgenic plant amplifiable go out 240bp fragment (swimming lane M:DNA standard molecular weight；Swimming lane 1: plasmid, Swimming lane 2: water, swimming lane 3: nontransgenic plants, swimming lane 4-7 is transfer-gen plant；Swimming lane 4: strain L77-4, swimming lane 5: strain L85-8, swimming lane 6: strain L122-1, swimming lane 7: strain L188-5).

(2) Southern blot hybridization check:

Use DIG High Prime DNA Labeling and Detection Starter Kit II test kit (Roche company), carries out Southern blot analysis, concrete grammar to the some positive transgenic line obtained through PCR detection For:

Use a large amount of extraction method of CTAB to extract the genomic DNA of blade, take 60 μ g Maize genome STb gene in restricted After cutting enzyme BamHI (TaKaRa company) catapepsis, separate with 0.8% agarose gel electrophoresis, after electrophoresis terminates, utilize DNA is transferred to positively charged Hybond-N by capillary transfer⁺On nylon membrane, probe used is CKX1 nucleotide sequence, It is marked after reclaiming this DNA fragmentation with agarose gel electrophoresis, probe marking operation flow process making by mentioned reagent box Carry out by description.Testing result (swimming lane M:DNA standard molecular weight as shown in Figure 4；Swimming lane 1: plasmid, swimming lane 2: water, swimming lane 3: Nontransgenic plants, swimming lane 4-7 is transfer-gen plant: swimming lane 4: strain L77-4, swimming lane 5: strain L85-8, swimming lane 6: strain L122-1, swimming lane 7: strain L188-5), there is the hybridization signal of CKX1 in result transgenic corns, and compares nontransgenic plants Then without this hybridization signal, show that foreign DNA has been incorporated in the genome of Semen Maydis.

(3) transgenic corn plant character detection:

1. the growing state during comparison and transgenic line tie up to drought canopy:

Comparison and transgenic line based material are sowed by spacing in the rows 40 centimetres, line-spacing 60 centimetres in the plastics drought canopy of Beijing, and 3 Seedling during leaf, does not waters in after planting 30 days, does not rewaters to results after fully watering once by the 30th day；As it is shown in figure 5, Grow the plant (left side is adjoining tree, and right side is transfer-gen plant: strain L122-1) of 60 days, the plant height of transfer-gen plant and Growing way is significantly higher than matched group plant far better than matched group plant, the drought resistance of this explanation transfer-gen plant.

2. the comparison of the root length of comparison and transgenic line:

In common heliogreenhouse, use pot experiment, fill Nutrition Soil at the high flowerpot of 40 centimetres of each diameter 20 centimetres Middle sowing 10 comparison or the full seed of transgenic corns, each transgenic line or 5 repetition of comparison, the kind such as fully water Son grew to for 3 leaf phases and carries out thinning after emerging, leave the seedling that 3 strain growing ways are consistent, within every 3 days, water 1 time in each flowerpot, it is ensured that flower Basin has adequate water supply.

When growing to for 5 leaf phase Deng seedling, carefully wash away Nutrition Soil with water, stay the complete root system of milpa to take pictures, and Each side root of root system whole to each plant carries out linear measure longimetry, and the length sum of all sides root is as total root of com per plant Long, it is repeated 3 times above test, carries out statistical analysis to obtaining data.

As shown in Figure 6, during the potted plant 5 leaf phase, the root length of transgenic line 122-1 can reach 57cm, and the root length of adjoining tree It is only capable of reaching 30cm, increases by 90% (in Fig. 6, CK represents matched group, and remaining is transfer-gen plant) than matched group plant.

As it is shown in fig. 7, * represents transfer-gen plant, there were significant differences compared with matched group plant, and * * represents transgenic line There is pole significant difference (in Fig. 7, CK represents matched group, and remaining is transfer-gen plant) compared with the control.

3. the solid situation of transgenic line compares:

Transgenic line selfing expanding propagation obtains homozygous lines to T4 generation, and in Hainan in Winter sowing on November 5, before planting, soil fills Dividing and water, the most whole corn growth season does not rewaters, and by the strain of each material 15,30 centimetres of line-spacings of spacing in the rows 60 centimetres, and carries out Spontaneous pollination, adds up setting percentage and the mass of 1000 kernel of the averagely single fringe of each material after 130 days, transgenic line comparison impinges upon grain number per spike Significance is had to increase with mass of 1000 kernel.Result is as shown in Figure 8.In Fig. 8, it is seen that the simple grain spike number of transgenic line and mass of 1000 kernel are equal Apparently higher than matched group.

By embodiment 1-3 it can be seen that inventor is by using the root-specific promoter from monocotyledon rice EXP18-D drives CKX1 to express in corn inbred line, it is thus achieved that (T2 no longer divides 78 homozygous lines for herbicide screening From), filter out the transgenic line that drought resistance dramatically increases.The root growth amount of observation transgenic line in seedling stage is more than comparison open country Raw type, in drought canopy control water test, transgenic line drought resistance dramatically increases, and setting percentage is also obviously improved.Plant arid response Gene more than more than 1000, of scientific circles is always perplexed in the drought resisting improvement selecting which class or which gene to carry out crop A difficult problem, by specifically expressing CKX1 gene in root, the present inventor confirms can promote that Maize Roots is grown, Thus improve the drought resistance of Semen Maydis, and do not affect Semen Maydis growth promoter under normally having moisture condition.Turn CKX1 gene to promote Maize Roots growth, adds root length and side radical, and healthy and strong root system improves the drought resistance of Semen Maydis, adds in arid Under the conditions of the yield of Semen Maydis, under moisture sufficiency, transgenic corns yield is the most also volume increase.

Obviously, the above-mentioned embodiment of the present invention is only by clearly demonstrating the citing that the present invention is done, and is not Restriction to embodiments of the present invention.For those of ordinary skill in the field, on the basis of the above description also Change or the variation of other multi-forms can be made.Here cannot all of embodiment be given exhaustive.Every belong to this What the technical scheme of invention was extended out obviously changes or changes the row still in protection scope of the present invention.

Claims

1. the method improving drought resistance of maize by transgenic, it is characterised in that: described method includes turning CKX1 gene Enter the step in Maize genome；Described CKX1 gene has the nucleotide sequence shown in SEQ ID NO:1 in sequence table.

The method improving drought resistance of maize by transgenic the most according to claim 1, it is characterised in that: the method includes Build the plant expression vector of CKX1 gene, and the step of the plant expression vector maize transformation with described CKX1 gene.

The method improving drought resistance of maize by transgenic the most according to claim 2, it is characterised in that: described CKX1 base The carrier that sets out of the plant expression vector of cause is PGreen0229 plasmid vector, the plant expression vector of described CKX1 gene with Promoter EXP18-D gene, terminator Nos gene and CKX1 gene.

The method improving drought resistance of maize by transgenic the most according to claim 3, it is characterised in that: described CKX1 base The marker gene of the plant expression vector of cause is the 35S Bar gene of antiweed.

The method of raising drought resistance of maize the most according to claim 4, it is characterised in that:

Described 35S Bar gene has the nucleotide sequence shown in SEQ ID NO:2 in sequence table；

6. according to the method improving drought resistance of maize by transgenic described in claim 3 or 4, it is characterised in that: described structure The plant expression vector building CKX1 gene comprises the following steps:

First described 35S Bar gene is connected to PGreen0229 plasmid vector, obtains 35S Bar-PGreen0229 plasmid and carry Body；

Described EXP18-D gene is connected to described Nos-35S Bar-PGreen0229 plasmid vector again, obtains EXP18-D- Nos-35S Bar-PGreen0229 plasmid vector；

Finally described CKX1 gene is connected to described EXP18-D-Nos-35S Bar-PGreen0229 plasmid vector, obtains institute State the plant expression vector of CKX1 gene.

The method improving drought resistance of maize by transgenic the most according to claim 2, it is characterised in that: pass through pollen tube The passage method plant expression vector maize transformation of described CKX1 gene.

The method improving drought resistance of maize by transgenic the most according to claim 7, it is characterised in that: described by flower The tube cell passage method plant expression vector maize transformation of described CKX1 gene comprises the following steps:

First milpa is carried out bagging pollination process；

Again the spica of described milpa is carried out pruning modes；

The method improving drought resistance of maize by transgenic the most according to claim 8, it is characterised in that: use linear The plant expression vector maize transformation of the described CKX1 gene of incision that DNA is formed at described pruning modes；Wherein,

Described linear DNA is by carrying out pcr amplification reaction acquisition with the plant expression vector of described CKX1 gene for template, described The primer that pcr amplification reaction uses is to having the nucleotide sequence shown in SEQ ID NO:6 and SEQ ID NO:7 in sequence table.

The method improving drought resistance of maize by transgenic the most according to claim 9, it is characterised in that: described PCR expands The program increasing reaction is:

96 DEG C of denaturations 4min；98 DEG C of degeneration 10s, 56 DEG C of annealing 15s, 72 DEG C extend 7min, totally 30 circulations；72 DEG C of extensions 10min。