CN105294847A - Stress tolerance-related protein of plants and encoding gene and application of stress tolerance-related protein - Google Patents

Abstract

The invention discloses a stress tolerance-related protein of plants and an encoding gene and application of the stress tolerance-related protein. The invention provides a protein which is (1) or (2) as follows: (1) a protein as shown in a sequence 2 in a sequence table; (2) a protein which is obtained by displacement and/or deletion and/or addition of one or several amino acid residues of the amino acid sequence as shown in the sequence 2 in the sequence table, has the same function and is derived from the sequence 2. Proved by experiments, a new protein GhPYL9 is found in cotton, and is introduced to Arabidopsis, the drought resistance of transgenic plants is higher than that of a target plant and has improved sensitivity to ABA (hormone abscisic acid), and the protein disclosed by the invention is proved to be a drought resistant protein, is sensitive to the ABA and provides a basis for cultivating drought resistant plants; in addition, the protein provided by the invention is capable of interacting with a PP2C family protein by reacting with the PP2C family protein.

Description

Plant stress tolerance correlative protein and encoding gene thereof and application

Technical field

The present invention relates to biological technical field, particularly relate to a kind of plant stress tolerance correlative protein and encoding gene thereof and application.

Background technology

Arid is on one of the impact of agricultural abiotic stress the most serious, can have a strong impact on growing of crop, reduces the output of crop.It is wide that arid has range of influence, the feature that the time length is long, and along with Global climate change, the frequency that arid occurs, lasting time and hazard rating are also in rising.China is large agricultural country, is again one of main in the world arid country.Therefore, research arid waits the mechanism of action of abiotic stress and plant to the molecular mechanism of adverse circumstance signal reaction and tackles the relevant gene of abiotic stress in conjunction with genetically engineered clone with process LAN plant, the tolerance of transgenic plant to environment stresses such as arids may be improved, for the resistance and crop yield improving plant provides foundation.

Abscisic Acid ABA is the hormone relevant to water stress, plays a significant role in the plant reply abiotic stress such as arid, saline and alkaline and the growth course such as seed maturity, dormancy.ABA signal transduction pathway comprises three core components, and they are PYR/PYL/RCAR (ABA acceptor), 2C proteinoid Phosphoric acid esterase (PP2C respectively; Negative regulatory factor), SNF1 related protein kinase 2 (SnRK2; Positive regulatory factor).They constitute a dual Negative regulation system: [PYR/PYL/RCAR-| PP2C-| SnRK2].When not having ABA, PP2C suppresses the activity of SnRK2 by separating phosphorylation.When replying from environment or growing signal, ABA promotes the interaction between PYR/PYL/RCAR and PP2C, and result PP2C is suppressed, SnRK2 is activated, the SnRK2 that is activated obtains kinase activity, can the transcription factor of phosphorylate downstream, thus the expression of induction ABA response gene.

Summary of the invention

An object of the present invention is to provide a kind of albumen.

Albumen provided by the invention, called after GhPYL9 is following 1) or 2):

1) protein shown in sequence 2 in sequence table;

2) aminoacid sequence shown in sequence in sequence table 2 is had through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation the protein that identical function derives by sequence 2.

The replacement of one or several amino-acid residue above-mentioned and/or disappearance and/or be added to the replacement and/or disappearance and/or interpolation that are no more than 10 amino-acid residues.

Above-mentioned protein DNA molecule of encoding also is the scope of protection of the invention.

Above-mentioned DNA molecular is following 1)-4) in any one DNA molecular:

1) coding region is the DNA molecular shown in sequence in sequence table 1;

2) coding region is the DNA molecular shown in sequence in sequence table 3;

3) under strict conditions with 1) or 2) DNA sequence dna that limits hybridizes and encode and have identical function protein DNA molecule;

4) with 1) or 2) DNA sequence dna that limits at least has 70%, at least have 75%, at least have 80%, at least have 85%, at least have 90%, at least have 95%, at least have 96%, at least have 97%, at least have 98% or at least have 99% homology and encode and have identical function protein DNA molecule.

Above-mentioned stringent condition can be in the solution of 6 × SSC, 0.5%SDS, and hybridize at 65 DEG C, then use 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film once.

Recombinant vectors containing above-mentioned DNA molecular, expression cassette, transgenic cell line or recombinant bacterium are also the scope of protection of the invention.

Transgenic cell does not comprise plant propagation material.

The primer pair of above-mentioned DNA molecular total length or its any fragment of increasing also is the scope of protection of the invention.

Above-mentioned albumen, above-mentioned DNA molecular or above-mentioned recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium are following 1)-5) middle at least one application:

1) under environment stress, regulating plant seed germination;

2) regulating plant is to ABA susceptibility (Their Seed Germinating Period and root growth initial stage);

3) in regulating plant, ABA response protein is expressed;

4) regulating plant resistance;

5) interact with PP2C family protein.

Described PP2C family protein is ABI1, ABI2, GhPP2C1 or GhPP2C2.

In above-mentioned application, described resistance is plant seedling stage stress resistance, is specially plant drought resistance of seedling;

Described plant is monocotyledons or dicotyledons.

Above-mentioned albumen, above-mentioned DNA molecular or above-mentioned recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium have following 1 in cultivation)-4) application in the plant of at least one feature is also the scope of protection of the invention:

1) under environment stress, plant seed germination is delayed;

2) plant is improved ABA susceptibility;

3) in plant, ABA response protein expression amount improves;

4) stress resistance of plant improves.

Described resistance is plant seedling stage stress resistance, is specially plant drought resistance of seedling;

Described plant is monocotyledons or dicotyledons; Described dicotyledons is specially cress; Described cress is specially Arabidopis thaliana.

Described plant is embodied in plant to the raising of ABA susceptibility and coerces lower long reduction at ABA;

Described ABA response protein is specially RD29A and RD29B;

Another object of the present invention is to provide a kind of cultivation and has following 1)-4) method of the transgenic plant of at least one feature.

Method provided by the invention, comprises the steps:, into the DNA molecular of the above-mentioned albumen of coding is imported object plant, to obtain transgenic plant,

Described transgenic plant have following 1-4) middle at least one feature:

1) under environment stress, described transgenic plant seed is sprouted and is lagged behind described object plant;

2) described transgenic plant to ABA susceptibility higher than described object plant;

3) in described transgenic plant, ABA response protein expression amount is greater than described object plant;

4) described transgenic plant resistance is higher than described object plant.

In above-mentioned application or above-mentioned method,

Described resistance is plant seedling stage stress resistance, is specially plant drought resistance of seedling;

Described plant is monocotyledons or dicotyledons.

Above-mentioned albumen, above-mentioned DNA molecular or above-mentioned recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium have following 1 in cultivation)-4) transgenic plant of at least one feature:

1) under environment stress, described transgenic plant seed is sprouted and is lagged behind described object plant;

2) described transgenic plant to ABA susceptibility higher than described object plant;

3) in described transgenic plant, ABA response protein expression amount is greater than described object plant;

4) described transgenic plant resistance is higher than described object plant;

Described transgenic plant are that the DNA molecular of the above-mentioned albumen of coding is imported object plant, obtain transgenic plant.

Above-mentioned transgenic plant are coerced lower piece described transgenic plant at ABA higher than described object families of plant to ABA susceptibility and are longly less than described object plant;

Described resistance is plant seedling stage stress resistance, is specially plant drought resistance of seedling;

Described ABA response protein is RD29A and RD29B;

Described plant is monocotyledons or dicotyledons; Described dicotyledons is specially cress; Described cress is specially Arabidopis thaliana.

Experiment of the present invention proves, the present invention finds a new Protein G hPYL9 in cotton, is imported in Arabidopis thaliana, the drought resistance of transgenic plant higher than object plant, and improves the susceptibility of ABA, proves that this albumen is drought resisting protein, and responsive to ABA, improve basis for cultivating drought-resistant plant; In addition itself and PP2C family protein are reacted, find that it can interact with this family protein.

Accompanying drawing explanation

Fig. 1 is the clone of upland cotton GhPYL9 gene.

Fig. 2 is GhPYL9 genetic transcription district schematic diagram.

Fig. 3 is that GhPYL9 gene is in each tissue expression situation of cotton.

Fig. 4 is the expression of GhPYL9 gene under ABA inductive condition.

Fig. 5 is that over-express vector pGhPYL9 enzyme cuts qualification and plasmid electrophoresis.

Fig. 6 is the Agrobacterium qualification that over-express vector pGhPYL9 transforms.

Fig. 7 is GhPYL9T ₁pCR for transgenic Arabidopsis plants identifies.

Fig. 8 is T ₃experimental analysis is sprouted for GhPYL9 transgenic arabidopsis.

Fig. 9 is that under different treatment condition, wild-type compares with transgenic line seed germination rate.

Figure 10 is that under ABA treatment condition, transgenic line and wild type growth situation compare.

Figure 11 is that the root under ABA process is long.

Figure 12 is the expression analysis of ABA response gene in wild-type and transgenic Arabidopis thaliana.

Figure 13 is drought stress experiment.

Figure 14 is the transactional analysis of GhPYL9 and PP2C family member

Embodiment

The experimental technique used in following embodiment if no special instructions, is ordinary method.

Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.

Substratum:

DDO:SD/-Leu/-Trp solid medium

QDO:SD/-Trp-Leu-His-Ade solid medium

QDO/X/A fills a prescription: after 1LQDO substratum autoclaving, add 250 μ L0.5mg/mLAbA to final concentration 125ng/mL.

QDO/X/A/ABA fills a prescription: after 1LQDO substratum autoclaving, add 250 μ L0.5mg/mLAbA to final concentration 125ng/mL, add 2mL20mg/mLX-α-GAL to final concentration 40 μ g/mL).

After above substratum prepares, 121 DEG C, high pressure steam sterilization 15min, is cooled to 50 DEG C can add 0.5mg/mLAbA (to final concentration 125ng/mL) and 20mg/mLX-α-GAL (to final concentration 40 μ g/mL) once.

The clone of embodiment 1, GhPYL9 gene

One, the clone of GhPYL9 gene

1, the clone of GhPYL9 gene cDNA

Extract upland cotton Y18 (GossypiumhirsutumL.Y18 (Liu Dongjun, Zhang Rui, Guo three heap, Deng. epsps gene expression analysis research [J] of cotton strain Y18 under glyphosate is coerced. Chinese biological engineering magazine, 2008, (10): 55-59.) RNA of blade, reverse transcription obtains cDNA as template, be that primer carries out RT-PCR amplification with primer GhPYL9F/GhPYL9R, obtain the pcr amplification product (Figure 1A) of 558bp.

Table 1 is primer sequence

Primer	Primer sequence (5'-3')
		GhPYL9F	ATGCTTACGGTATGGTCATTGGT
GhPYL9R	GTACCCGTTGATAGGTTGTGTTTGG
		GhPYL9qF	CAATCATAACGGTCCATCCA
GhPYL9qR	AGAGCCTCCACAAAGTAACAAG
		His3F	TCAAGACTGATTTGCGTTTCCA
His3R	GCGCAAAGGTTGGTGTCTTC

Through order-checking, this pcr amplification product has the Nucleotide shown in sequence 1 in sequence table, and the unnamed gene shown in it is GhPYL9, the long 561bp of open reading frame of GhPYL9 gene, encode 186 amino-acid residues, the protein designations of coding is GhPYL9, and its aminoacid sequence is sequence 2 in sequence table.

2, the clone of GhPYL9 gene group DNA

The genomic dna extracting upland cotton Y18 blade is template, carries out pcr amplification, obtain the pcr amplification product (Figure 1B) of 949bp with primer GhPYL9F/R (table 1) for primer.

Through order-checking, this pcr amplification product has the Nucleotide shown in sequence 3 in sequence table, the GhPYL9 gene group DNA shown in it.Sequential analysis shows, GhPYL9 gene contains 3 exons, and its transcriptional domain structure as shown in Figure 2.Include subarea all to start with bases G U, terminate with base AG, meet the general editing principle of mRNA primary transcribe, this result is also on all four with the result originally predicted.

Two, the expression analysis of GhPYL9

1, the expression characterization respectively organized in cotton of GhPYL9 gene

Upland cotton (GossypiumhirsutumL.) Y18 different tissues sample collecting: gather the root of ripening stage cotton, stem, three leaves, and the cotton seeds collected, liquid nitrogen flash freezer after sampling, extract total serum IgE.

RNA reverse transcription is obtained cDNA as template, and with primer GhPYL9qF/R (table 1) for primer carries out RT-PCR amplification, internal reference primer is His3F/R.

Result as shown in figure 3 and table 2, can be found out, GhPYL9 gene all has expression in the leaf of cotton, root, stem and seed, and the expression amount wherein in seed is the highest, is 2.8 times of blade.Next is in root, is 1.67 in blade times, and the expression amount in stem is then 1.24 times in blade.All in all, the expression amount in each tissue is comparatively balanced.GhPYL9 gene is different at the expression amount of different tissues, may be closely related with the response difference of Different Organs to ABA.

The relative expression quantity that table 2GhPYL9 gene is respectively organized in cotton

2, the expression characterization of GhPYL9 under ABA induction

The induction of ABA whether is subject in order to analyze GhPYL9 gene, ABA process is carried out to the cotton Y18 seedling growing true leaf of growth 20d and (sprays the upper and lower surface of 20d cotton leaf with the ABA aqueous solution of 100uM, all squirt, before getting process, process 1h, 3h, 6h blade liquid nitrogen flash freezer).

Extract the seedling leaves RNA of ABA process different time, it is template that reverse transcription obtains cDNA, is that primer carries out RT-PCR amplification with primer GhPYL9qF/R.Internal reference primer is His3F/R.

Result is as shown in Fig. 4 and table 3, ABA process 1.0h, the expression amount of GhPYL9 gene rises to 2.8 times before treatment, during process 3h, expression amount rises to 8 times before treatment, and along with the further prolongation in treatment time, the expression amount of GhPYL9 gene starts to decline, when processing 6.0h, the expression amount of GhPYL9 gene drops to 2.2 times before treatment.The result shows that the expression of GhPYL9 gene in blade is subject to the induction of ABA.

Table 3 is the expression of GhPYL9 gene under ABA inductive condition

The study on drought resistance of embodiment 2, GhPYL9

1, the structure of GhPYL9 over-express vector

This part whole primer used is in table 4 and table 5.

Table 4 primer table

Note: in table, single underscore is depicted as restriction enzyme site, double underline is depicted as the base of sudden change

Table 5 primer sequence

Note: in table, single underscore is depicted as restriction enzyme site, double underline is depicted as the base of sudden change

Extract the RNA of upland cotton Y18 blade, it is template that reverse transcription obtains cDNA, is that primer carries out pcr amplification with GhPYL9F1 and GhPYL9R1, obtains the pcr amplification product (GhPYL9 of band restriction enzyme site) of 574bp.

By with the GhPYL9 gene of Not I and Xma I restriction enzyme site and TEASY ^tMafter-BluntZero carrier connects, after carrying out Not I and Xma I double digestion with entry vector p8GWN (Ren, etal., 2011) simultaneously, reclaim object fragment and connect structure entry vector p8GWN-GhPYL9.By pEarleygate3033 (EarleyKW, HaagJR, PontesO, etal.Gateway-compatiblevectorsforplantfunctionalgenomics andproteomics [J] .ThePlantJournal, 2006,45 (4): 616-629.) Bar selection markers replaces with Kan selection markers and is configured to object carrier pEarleyGate330.Entry vector p8GWN-GhPYL9 and object carrier pEarleyGate330 is carried out LR reaction by GatewayLRClonase II EnzymeMix, finally successfully builds over-express vector pGhPYL9.LR reaction system is as follows:

1) LR reaction system is prepared:

2) after preparing, mix gently, hatch 6h for 25 DEG C;

(3) add 1.0 μ LProteinaseK and terminate reaction, mix gently, hatch 10min for 37 DEG C;

(4) transformation of E. coli, is coated with the LB solid medium containing spectinomycin;

(5) provoke single bacterium colony and carry out bacterium colony PCR qualification (primer is GhPYL9F1/R1, and obtaining 574bp is positive bacterium colony).

Positive bacterium colony is extracted plasmid, through Not I and the qualification of Xma I double digestion, result as Fig. 5,1, pGhPYL9 is through Not I and the qualification of Xma I double digestion; 2:pGhPYL9 plasmid; Obtain the positive plasmid of 12.5Kb.

Positive plasmid is sent to order-checking, for there is LR recombining reaction by the GhPYL9 gene shown in sequence in sequence table 1 and pEarleyGate330 in this plasmid of result, obtain recombinant vectors, called after pGhPYL9, namely replaces the carrier that the DNA molecular in pEarleygate303 and between Pst I and Cla I site obtains by the Kan selection markers shown in sequence 8.

Two, the structure of recombinant bacterium

Above-mentioned recombinant vectors pGhPYL9 is proceeded to Agrobacterium GV3101 (ZhangX, HenriquesR, LinS, etal.Agrobacterium-mediatedtransformationofArabidopsisth alianausingthefloraldipmethod [J] .NatureProtocols, 2006,1 (2): 641-646.), in, recombinant bacterium is obtained.

Recombinant bacterium is carried out colony PCR amplification (primer is GhPYL9F1/R1), as shown in Figure 6,1-2: two single bacterium colonies of Agrobacterium carry out PCR qualification through two pairs of primers to result respectively; N: negative control; What obtain 500bp is positive recombinant bacterium, called after GV3101/pGhPYL9.

Three, the acquisition of GhPYL9 Arabidopis thaliana is turned

1, the acquisition of GhPYL9 Arabidopis thaliana is turned

1) the single bacterium colony GV3101/pGhPYL9 of picking Agrobacterium, is inoculated in 5mLYEB resistance culture base, and 28 DEG C of 250rpm cultivate 24h;

2) 1:100 is forwarded in 500mLYEB resistance culture base, and 28 DEG C of 250rpm overnight incubation are to OD=0.6-0.8;

3) 4,000rpm10min centrifugal Agrobacterium bacterium liquid, the suspension prepared with 250mL is resuspended;

4) 250mL agrobacterium suspension is added in the beaker of a 500mL, add 250mL suspension (containing Selwet-L77100 μ L) mixing again, petal phase, eugonic Arabidopis thaliana will be in (hereinafter also referred to wildtype Arabidopsis thaliana, col-0, derive from ABRC, seed catalog number (Cat.No.) is CS28166) (transforming to water the day before yesterday is permeablely inverted in beaker, and 30s is infected in timing, and the petal rifle head do not infected is drawn suspension and infected;

5) cultivate under the Arabidopis thaliana shading treatment 12h after infecting being placed on regular culture conditions, obtain T ₀in generation, turns GhPYL9 Arabidopis thaliana.

2, the PCR qualification of GhPYL9 Arabidopis thaliana is turned

Collect T ₀it is T that generation turns GhPYL9 Arabidopis thaliana seed ₁in generation, by T ₁for seed at resistance MS flat board (Kan:50mg/L) enterprising row filter, sow and cultivate the Arabidopis thaliana of a week, the Arabidopis thaliana of resistance grows green true leaf, root growth is normal, and namely the Arabidopis thaliana of feminine gender to turn to be yellow not regrowth at cotyledon period.Resistance Arabidopsis thaliana Seedlings is transplanted to continued growth in Nutrition Soil, obtains T ₁in generation, turns GhPYL9 Arabidopis thaliana.

Treat T ₁in generation, turns after GhPYL9 Arabidopis thaliana grows up, get blade and extract minim DNA as pcr template, when carrying out PCR qualification, for ensureing the exactness of qualification, each individual plant uses two pairs of primers to identify, pair of primers is the special upstream and downstream primer GhPYL9F1/R1 of GhPYL9 gene, and second pair of primer is that 35S promoter the preceding paragraph sequence 35SF is as upstream primer, gene specific primer GhPYL9R1 as downstream primer, i.e. 35SF/GhPYL9R1 (table 5).With wildtype Arabidopsis thaliana (WT) for contrast.

Result as shown in Figure 7, every deck label is 1-28, be respectively T1 for turning GhPYL9 Arabidopis thaliana individual plant, often in group, left lane is first pair of primer amplification, and the right swimming lane is second pair of primer amplification, in 28 individual plants detected, except No. 13 do not obtain amplified band, be detected as outside feminine gender, all the other 27 strains turn the equal test positive of GhPYL9 Arabidopis thaliana, amplify two DNA band 574bp and 776bp conformed to expection size, shown to obtain the positive T of 27 strains ₁for the Arabidopsis plant turning GhPYL9 gene.

Be accredited as positive T ₁in generation, turns the seed of GhPYL9 Arabidopsis plant to ripe rear each individual plant of results, is T ₂in generation, turns GhPYL9 Arabidopis thaliana seed.T ₂in generation, turns GhPYL9 Arabidopis thaliana and can carry out preliminary physiological function analysis, selects representative T ₂for strain succeeding transfer culture, each strain sowing at least 20 strain T ₂for individual plant, treat T ₂continue for plant maturation the seed gathering in the crops individual plant afterwards, the seed now gathered in the crops is T ₃generation.By T ₃for the planting seed of each individual plant on resistance screening MS solid medium (Kan:50mg/L), sow about 10d, what resistance culture base grew is the T isozygotied ₃in generation, turns GhPYL9 Arabidopsis plant.

Four, the functional study of GhPYL9 Arabidopis thaliana is turned

1, GhPYL9 makes seed germination delayed under environment stress

T ₃in generation, suspends with 0.1% agarose solution after turning GhPYL9 Arabidopis thaliana 3 different strain OEGhPYL9-16, OEGhPYL9-21, OEGhPYL9-22, wildtype Arabidopsis thaliana (WT) and pyl9 mutant (SALK_032948) seed disinfection, drawing seed with rifle head evenly beats on the substratum of different treatment group, in a kind of process, each classification spreads 50 seeds, 4 groups of parallel laboratory tests are carried out in each process, namely in each process (as ABA process), the seed co-processing of each classification about 200.After seed is completed, seal with plastics film, in the dark vernalization 3d of 4 DEG C of refrigerators, be then transferred to weather incubator, 23 DEG C/20 DEG C, cultivate under 16h illumination/8h dark condition.

The substratum of different treatment group is as follows: MS solid medium, (in MS solid medium, add ABA containing the MS solid medium of 0.5 μM of ABA, make its concentration be 0.5 μM), (in MS solid medium, add NaCl containing the MS substratum of 100mMNaCl, make its concentration be 100mM), containing the MS solid medium (add sweet dew in MS solid medium, make its concentration be 200mM) of 200mM N.F,USP MANNITOL.

Cultivate and to take pictures after 4d and under adding up each treatment condition, the germination rate of WT, pyl9, OEGhPYL9-16, OEGhPYL9-21, OEGhPYL9-22, as shown in Figure 8 and Figure 9, in Fig. 8, A:WT, pyl9, OEGhPYL9-16/21/22 sprout result on MS solid medium; B:WT, pyl9, OEGhPYL9-16/21/22 are sprouting containing on the MS solid medium of 0.5 μM of ABA; C:WT, pyl9, OEGhPYL9-16/21/22 are sprouting containing on the MS solid medium of 100mMNaCl; D:WT, pyl9, OEGhPYL9-16/21/22 are sprouting containing on the MS solid medium of 200mM N.F,USP MANNITOL;

After the MS substratum not adding any material cultivates 4d, all Arabidopis thalianas all can normally be sprouted, and growing green cotyledon (as Fig. 8 A), germination rate is (table 6) between 94%-96%, no significant difference (Fig. 9) between differing materials.And after they being seeded in 0.5 μM of ABAMS substratum cultivating 4d, observe and find to show significant difference between transgenic arabidopsis and wild-type, mutant, wild-type and mutant seeds is most of can normally sprout, and grow green cotyledon, germination rate is more than 90%, the seed of 3 transgenic arabidopsis strains then shows as to be sprouted delayed, and the quantity growing green cotyledon is little, and germination rate only has (Fig. 8 B) between 8%-13%.Significance analysis shows, there is not significant difference between wild-type and mutant, both and 3 T ₃pole significant difference (Fig. 9) is there is for the germination rate turned between GhPYL9 Arabidopis thaliana strain on 0.5 μM of ABAMS substratum.

All types of Arabidopis thaliana is on 100mMNaCl substratum, and germination rate all can decline.The germination rate of WT and mutant is compared with the germination rate on MS substratum, and fall is relatively little, and germination rate still maintains more than 60%, and 3 T ₃the germination rate that generation turns GhPYL9 Arabidopis thaliana strain then declines extremely obvious, only surplus about 6% (Fig. 8 C, table 6).Significance analysis shows, T ₃the germination rate that generation turns GhPYL9 Arabidopis thaliana extremely significantly declines (Fig. 9) with this understanding.

Similarly, on 200mM N.F,USP MANNITOL substratum, the germination rate of wild-type and mutant still possesses about 90%, and 3 T ₃the germination rate that generation turns GhPYL9 Arabidopis thaliana strain then drops to 7%-14% (table 6), shows as and extremely significantly declines (Fig. 9).

Continuous observation, 3 T ₃in generation, turns GhPYL9 Arabidopis thaliana strain and under Different stress, cultivates 10 days seeds all sprout, and reaches wild-type and mutant at the germination rate of 4 days.

The above results shows, GhPYL9, under environment stress, makes plant seed germination delayed.

Wild-type and transgenic Arabidopis thaliana germination rate under table 6 different treatment

Each data are x ± s, n=4; Transfer-gen plant carries out significant difference analysis with the wild-type data under same treatment respectively, and * represents significant difference P<0.05; * represents difference extremely significantly P<0.01

2, GhPYL9 Arabidopis thaliana is turned to ABA sensitivity experiments

By WT, pyl9, T ₃in generation, turns GhPYL9 Arabidopis thaliana strain OEGhPYL9-16, OEGhPYL9-21, OEGhPYL9-22 Arabidopis thaliana seed is seeded in MS substratum respectively, containing 0.3 μM of ABAMS substratum, containing on 0.5 μM of ABAMS substratum, cultivate 10d after vernalization 3d in artificial climate incubator.Each strain 200 seeds, experiment repetition 3 times, results averaged.

Result as shown in Figure 10 and Figure 11,

Figure 10 is that under ABA treatment condition, transgenic line and wild type growth situation compare, A:WT, pyl9, OEGhPYL9-16/21/22 growing state on MS solid medium; B:WT, pyl9, OEGhPYL9-16/21/22 growing state on the MS solid medium containing 0.3 μM of ABA; C:WT, pyl9, OEGhPYL9-16/21/22 growing state on the MS solid medium containing 0.5 μM of ABA;

On MS solid medium, all material is acted normally growth (Figure 10 A), wherein 3 T ₃the growing way that generation turns GhPYL9 Arabidopis thaliana strain is better than wild-type and mutant, shows as root longer, especially OEGhPYL9-22 strain, the extremely significant difference (Figure 11) of its root length existence compared with wild-type.

On the MS solid medium of 0.3 μM of ABA, different from the situation on MS substratum, on the MS substratum of 0.3 μM of ABA, 3 T ₃the growth that generation turns GhPYL9 Arabidopis thaliana strain root receives suppression, and average root length, in wild-type and mutant, utilizes t-to check: paired two sample analyses of mean value show, 3 T ₃the root length that generation turns GhPYL9 Arabidopis thaliana strain has extremely significant difference (Figure 11 and table 7) compared with wild-type.

On the MS substratum of 0.5 μM of ABA, the root of WT, pyl9, OEGhPYL9#16/21/22 is long all to decline further, but the fall of WT and pyl9 is less than 3 T ₃in generation, turns GhPYL9 Arabidopis thaliana strain (Figure 10 C), there is extremely significant difference (Figure 11, table 7) between WT, pyl9 and 3 transgenic lines.

Can find out based on the above results, ABA has the effect suppressing root growth, and under identical treatment condition, 3 T ₃the growth that generation turns the root of GhPYL9 Arabidopis thaliana strain is more thoroughly suppressed, shows 3 T ₃it is more responsive to ABA that in generation, turns GhPYL9 Arabidopis thaliana strain, and namely the process LAN of GhPYL9 gene improves the susceptibility of Arabidopis thaliana to ABA, reduces anti-ABA and coerces.

Table 7 for the root under ABA process long

3, the expression analysis of ABA response gene

Wild-type and the T of 10d will be grown on MS substratum ₃in generation, turns GhPYL9 Arabidopis thaliana OEGhPYL9-16 seedling 10 μMs of ABA process (treatment process wild-type and transgenic Arabidopis thaliana is transferred in the MS liquid nutrient medium containing 10 μMs of ABA to process 3h).

Liquid nitrogen flash freezer after Arabidopis thaliana material before collecting ABA process and after ABA process.Extract Arabidopis thaliana RNA and reverse transcription is that cDNA is as template.The expression analysis of ABA response gene RD29A, RD29B is carried out, internal reference control selection Arabidopis thaliana GAPDH gene (sequence is in table 5) by real-time quantitative PCR.

Reaction system 20 μ L:GoTagqPCRMasterMix (2 ×) 10.0 μ L, cDNA2 μ L, each 0.4 μ L, the ddH of upstream and downstream primer (10 μMs) ₂o7.2 μ L, each experiment setting 3 repetition.Response procedures is: 98 DEG C of 2min; 98 DEG C of 15s, 60 DEG C of 15s, 72 DEG C of 30s, 40 circulations.Cycle number (Ct) corresponding when the fluorescence intensity of adding up each reaction reaches threshold value.Goal gene relative to the relative expression quantity of reference gene with 2 ^{-△ △ Ct}method calculates.

Result as shown in figure 12, the relative expression quantity of A:RD29A gene; The relative expression quantity of B:RD29B gene, can find out, before ABA process, in OEGhPYL9-16, the expression amount of RA29A gene is a little more than wild-type, is 1.53 times of wild-type, the expression amount of RD29B gene a little less than wild-type, no significant difference; After ABA process, in OEGhPYL9-16 and wild-type, the expression amount of RD29B gene both increases, and adds 26.76 times, and add 97.18 times in OEGhPYL9-16 in wild-type, reaches 98.13 times of wild-type before process; Similarly, although the expression amount of RD29A gene wild-type after treatment declines to some extent, add 6.46 times at OEGhPYL9-16, reach 7.99 times of the front wild-type of process.These results show, at T ₃in generation, turns in GhPYL9 Arabidopis thaliana, the activity of ABA path is higher than wild-type, particularly after ABA process, activity significantly promotes, response gene great expression, to make plant tackle the adverse circumstances such as arid, high salt, therefore, GhPYL9 can improve the expression of ABA response gene, and as RD29A and RD29B, (RD29AGeneBank:BAA02376.1 submits day: 1992.8.25 to; RD29BGeneBank:BAA02375.1 submits day: 1992.8.25 to)

4, drought stress experiment

To sprout on MS solid medium and grow WT, pyl9, T of 14d ₃in generation, turns GhPYL9 Arabidopis thaliana OEGhPYL9-16, OEGhPYL9-21 and OEGhPYL9-22 and transplants to (Nutrition Soil: vermiculite=1:1) in compost, and compost is transplanted and watered the day before yesterday permeable, does not water after transplanting, and continue 6 weeks, recovery in the 7th week is watered.Each Arabidopis thaliana transplants 20 strains, and WT, pyl9, OEGhPYL9-16, OEGhPYL9-21 and OEGhPYL9-22 are transplanted in same basin, carry out mark.Covered rearing with plastic film opened film after one day, and in 22 DEG C, 5000-10000lx intensity of illumination, the photoperiod is that 6h illumination/8h is dark, cultivates in the greenhouse of atmospheric moisture more than 80%.

To take pictures observation in different steps, result as shown in figure 13, A:WT, pyl9, OEGhPYL9-16, OEGhPYL9-21, OEGhPYL9-22 plant plantation schematic diagram; B:WT, pyl9, OEGhPYL9-16, OEGhPYL9-21, OEGhPYL9-22 plantlet of transplant 2weeks; C:WT, pyl9, OEGhPYL9-16, OEGhPYL9-21, OEGhPYL9-22 plantlet of transplant 4weeks; D:WT, pyl9, OEGhPYL9-16, OEGhPYL9-21, OEGhPYL9-22 plantlet of transplant 5weeks; E:WT, pyl9, OEGhPYL9-16, OEGhPYL9-21, OEGhPYL9-22 plantlet of transplant 6weeks; F:WT, pyl9, OEGhPYL9-16, OEGhPYL9-21, OEGhPYL9-22 plantlet of transplant 7weeks; Can find out, WT, pyl9 and T of 14d will be grown on MS substratum ₃be transplanted in Nutrition Soil for OEGhPYL9-16, OEGhPYL9-21, OEGhPYL9-22 Arabidopsis plant, transplant relative position as shown in FIG. 13A; To its take pictures (Figure 13 B) after transplanting one week, now, all Arabidopis thalianas are in Seedling Stage, all grow 4-6 sheet true leaf, and growth conditions is good, no significant difference in phenotype between dissimilar Arabidopis thaliana; Carry out observation after transplanting 4 weeks to take pictures, between now dissimilar plant, show difference, 3 T ₃in generation, turns the growing way of GhPYL9 Arabidopis thaliana OEGhPYL9-16/21/22 significantly better than WT and pyl9, and transfer-gen plant growth is vigorous, and blade is large and green, and WT and pyl9 plant is short and small, and some plant leafs occur wilting (Figure 13 C); After transplanting 5 weeks, all there is wilting in various degree in all Arabidopsis plant blades, but the growing state of transgenic line is still better than WT and pyl9 plant, WT and pyl9 plant starts to occur dead (Figure 13 D); After transplanting 6 weeks, there is how dead plant in WT and pyl9 plant, and 3 transgenic line OEGhPYL9-16/21/22 death is less, and now Arabidopsis plant is in peduncle-growing period for rapeseed (Figure 13 E), now carries out rehydration; Rehydration is after one week, and after namely transplanting 7 weeks, Arabidopis thaliana grows fruit branch, 3 T ₃the fruit branch that generation turns GhPYL9 Arabidopis thaliana strain wants unnecessary WT and pyl9 plant (Figure 13 F).

Demonstrate, in Arabidopis thaliana, process LAN GhPYL9 gene can improve the drought resistance of Arabidopis thaliana.

The interaction of embodiment 3, GhPYL9 and PP2C family member

The two assorted Gold system of the yeast of Clotech company is used to carry out the research of interactions between protein in research.This screening system adopts a rigorous approach, transformation efficiency is high, false negative background is low.The interaction of this system verification cotton GhPYL9 gene of this research and utilization and PP2C family member, is further analyzed their function.

1, the structure of recombinant vectors

The method of same employing homologous clone, with the genome sequence of PP2C family member ABI1 in Arabidopis thaliana and ABI2 sequence B last Lei Mengdeshi cotton, analyze the gene order of two PP2C members in Lei Mengdeshi cotton, then primer is designed with the cDNA of cotton for template carries out pcr amplification, check order after the object band of acquisition is connected with carrier T, sequence is carried out Blast analysis in NCBI, determine that the gene of cloning has the conserved domain of PP2C family member, thus clone obtains two PP2C members from upland cotton, called after GhPP2C1 (sequence 4) and GhPP2C2 (sequence 5) respectively.Meanwhile, PP2C family member ABI1 (sequence 6) and the ABI2 (sequence 7) that primer has cloned Arabidopis thaliana is designed.

Build following recombinant vectors:

PGADT7-GhPP2C1 is for inserting the recombinant vectors obtained between the Xma I of pGADT7 carrier (Clotech.Cat630442) and Sac I site by the GhPP2C1 shown in sequence in sequence table 4;

PGADT7-GhPP2C2 is for inserting the recombinant vectors obtained between the Xma I of pGADT7 carrier and Sac I site by the GhPP2C2 shown in sequence in sequence table 5;

PGADT7-AtABI1 is for inserting the recombinant vectors obtained between the Xma I of pGADT7 carrier and BamH I site by the ABI1 shown in sequence in sequence table 6;

PGADT7-AtABI2 is for inserting the recombinant vectors obtained between the Xma I of pGADT7 carrier and Sac I site by the ABI2 shown in sequence in sequence table 7;

PGBKT7-GhPYL9P84S is for inserting the recombinant vectors obtained between the BamH I of pGBKT7 carrier and Pst I site by the DNA in sequence table shown in sequence A; Sequence A for sequence 1 is sported Nucleotide T from 5 ' end the 250th Nucleotide C, the 252nd Nucleotide G sports Nucleotide A, makes sequence 2 the 84th P sport S;

PGBKT7-GhPYL9H111A is for inserting the recombinant vectors obtained between the BamH I of pGBKT7 carrier and Pst I site by the DNA in sequence table shown in sequence B; Sequence B for sequence 1 is sported Nucleotide G from 5 ' end the 331st Nucleotide C, the 332nd Nucleotide A sports Nucleotide C, the 333rd Nucleotide C sports Nucleotide T, makes sequence 2 the 111st H sport A;

PGBKT7-GhPYL9 is for inserting the recombinant vectors obtained between the BamH I of pGBKT7 carrier and Pst I site by the GhPYL9 shown in sequence in sequence table 1;

2, the structure of recombination yeast

PGBKT7-GhPYL9P84S, pGBKT7-GhPYL9H111A and pGBKT7-GhPYL9 are proceeded in yeast Y2HGold respectively, obtains recombinant bacterium Y2HGold/pGBKT7-GhPYL9P84S, Y2HGold/pGBKT7-GhPYL9H111A, Y2HGold/pGBKT7-GhPYL9;

PGADT7-GhPP2C1, pGADT7-GhPP2C2, pGADT7-AtABI1, pGADT7-AtABI2 are proceeded to respectively in yeast Y187 (Clotech.Cat630457), obtain recombinant bacterium Y187/pGADT7-GhPP2C1, Y187/pGADT7-GhPP2C2, Y187/pGADT7-AtABI1, Y187/pGADT7-AtABI2.

3, yeast two-hybrid checking protein-interacting

By Y2HGold/pGBKT7-GhPYL9P84S respectively with Y187/pGADT7-GhPP2C1, Y187/pGADT7-GhPP2C2, Y187/pGADT7-AtABI1, Y187/pGADT7-AtABI2 blending decision liquid, be coated on DDO flat board, provoke after growing mono-clonal be cultured in mono-clonal to DDO liquid nutrient medium saturated after, stoste will be trained and dilute 10 times respectively, 100 times, the bacterium liquid pipettor of 1000 times of different extension rates is respectively drawn 10 μ L and is dropped in DDO (SD/-Leu/-Trp), QDO (SD/-Leu/-Trp/-Ade/-His), on QDO/X/A (SD/-Leu/-Trp/-Ade/-His/X-α-GAL) and QDO/X/A/ABA (SD-Leu/-Trp/-Ade/-His/X-α-GAL/Aba/ABA) flat board, 30 DEG C of constant temperature culture 3-5d.

According to the method described above by Y2HGold/pGBKT7-GhPYL9H111A respectively at Y187/pGADT7-GhPP2C1, Y187/pGADT7-GhPP2C2, Y187/pGADT7-AtABI1, Y187/pGADT7-AtABI2 blending decision liquid coated plate.

According to the method described above by Y2HGold/pGBKT7-GhPYL9 respectively at Y187/pGADT7-GhPP2C1, Y187/pGADT7-GhPP2C2, Y187/pGADT7-AtABI11, Y187/pGADT7-AtABI2 blending decision liquid coated plate.

Positive controls is Y2HGold (pGBKT7-53 (Clotech.Cat630489)) and Y187 (pGADT7-T (Clotech.Cat630489)) negative control group is Y2HGold (pGBKT7-lam (Clotech.Cat630489)) and Y187 (pGADT7-T (Clotech.Cat630489)).

GhPYL9 and GhPP2C1, interaction result between GhPP2C2, AtABI1, AtABI2 as shown in figure 14, A:GhPYL9 and GhPP2C1, interaction between GhPP2C2, AtABI1, AtABI2; B:GhPYL9P84S and GhPP2C1, interaction between GhPP2C2, AtABI1, AtABI2; C:GhPYL9H111A and GhPP2C1, interaction between GhPP2C2, AtABI1, AtABI2; On DDO (SD/-Leu-Trp) substratum, all can grow bacterium colony, illustrate and form Y2HGold (pGBKT7-X) and Y187 (pGADT7-Y) mating type yeast strain.And can grow at QDO and QDO/X/A, illustrate to there is interaction between corresponding albumen.As can be seen from Figure 14A, GhPYL9 and GhPP2C1, all to interact between GhPP2C2, AtABI1, AtABI2, and the interaction between them does not rely on ABA.Simultaneously, analyze GhPYL9P84S, GhPYL9H111A interaction respectively and between GhPP2C1, GhPP2C2, AtABI1, AtABI2, as can be seen from Figure 14 B and C, after carrying out single site amino acid residues sudden change, GhPYL9P84S, GhPYL9H111A still can interact with GhPP2C1, GhPP2C2, AtABI1, AtABI2, and the interaction between them does not rely on ABA.

Claims (10)

1. an albumen is following 1) or 2):

1) protein shown in sequence 2 in sequence table;

2) aminoacid sequence shown in sequence in sequence table 2 is had through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation the protein that identical function derives by sequence 2.

2. protein DNA molecule described in coding claim 1.

3. DNA molecular as claimed in claim 2, is characterized in that: described DNA molecular is following 1)-4) in any one DNA molecular:

1) coding region is the DNA molecular shown in sequence in sequence table 1;

2) coding region is the DNA molecular shown in sequence in sequence table 3;

3) under strict conditions with 1) or 2) DNA sequence dna that limits hybridizes and encode and have identical function protein DNA molecule;

4) with 1) or 2) DNA sequence dna that limits at least has 70%, at least have 75%, at least have 80%, at least have 85%, at least have 90%, at least have 95%, at least have 96%, at least have 97%, at least have 98% or at least have 99% homology and encode and have identical function protein DNA molecule.

4. the recombinant vectors containing DNA molecular described in Claims 2 or 3, expression cassette, transgenic cell line or recombinant bacterium.

5. the primer pair of DNA molecular total length or its any fragment described in Claims 2 or 3 of increasing.

6. recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium described in DNA molecular described in albumen, Claims 2 or 3 described in claim 1 or claim 4 are following 1)-5) in application at least one:

1) under environment stress, regulating plant seed germination;

2) regulating plant is to ABA susceptibility;

3) in regulating plant, ABA response protein is expressed;

4) regulating plant resistance;

5) interact with PP2C family protein.

7. application according to claim 6, is characterized in that:

Described resistance is plant seedling stage stress resistance, is specially plant drought resistance of seedling;

Described plant is monocotyledons or dicotyledons.

8. recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium described in DNA molecular described in albumen, Claims 2 or 3 described in claim 1 or claim 4 have following 1 in cultivation)-4) application in the plant of at least one feature:

1) under environment stress, plant seed germination is delayed;

2) plant is improved ABA susceptibility;

3) in plant, ABA response protein expression amount improves;

4) stress resistance of plant improves.

Described resistance is plant seedling stage stress resistance, is specially plant drought resistance of seedling;

Described plant is monocotyledons or dicotyledons; Described dicotyledons is specially cress; Described cress is specially Arabidopis thaliana.

9. cultivation has following 1)-4) methods of the transgenic plant of at least one feature, be that the DNA molecular of albumen described in coding claim 1 is imported object plant, obtain transgenic plant,

Described transgenic plant have following 1-4) middle at least one feature:

1) under environment stress, described transgenic plant seed is sprouted and is lagged behind described object plant;

2) described transgenic plant to ABA susceptibility higher than described object plant;

3) in described transgenic plant, ABA response protein expression amount is greater than described object plant;

4) described transgenic plant resistance is higher than described object plant.

10. application according to claim 8 or method according to claim 9, is characterized in that:

Described resistance is plant seedling stage stress resistance, is specially plant drought resistance of seedling;

Described plant is monocotyledons or dicotyledons.