CN101864430B - Wheat introgression family gene Tamyb31 for resisting abiotic stress and application thereof - Google Patents

Abstract

The invention discloses a novel wheat introgression family gene Tamyb31 for resisting abiotic stress (salt, drought and the like) and a plant expression vector pStart/Tamyb31 containing the gene Tamyb31; and the invention also discloses application of the gene Tamyb31 and the plant expression vector containing the gene Tamyb31 in the culture of a gene resisting the abiotic stress (the salt, the drought and the like). Experiments prove that the capability of an over-expression transgenic plant resisting the abiotic stress (the salt, the drought and the like) is obviously enhanced.

Description

Wheat introgression family gene Tamyb 31 for resisting abiotic stress and application thereof

Technical field

The invention belongs to technical field of biological genetic engineering, relate in particular to resisting abiotic stress gene Tamyb31 and application thereof.

Background technology

Estimate that according to relevant department world population in 2010 will reach 7,000,000,000,2039 will be above 10,000,000,000.In contrast, can reduce for the speed that tills the land then with annual 38610 sides mile in the world.Salinification is a major reason of land deterioration.According to statistics, China has 10% arable land existence salinification in various degree approximately, and wherein major part is caused by natural condition, as Na in the rock of long-time weathering ⁺, Mg ²⁺Deng the accumulation of salt ion, the salt that rainfall brings grades.Arid also is the important factor of land deterioration.Arid, semiarid region account for 33% of global land area, and China is then even more serious, has accounted for 38% of national land area, reaches 5.7 hundred million mu.

Except traditional breeding way, utilize new technology such as genetic and cell engineering can fast and stable ground to obtain to have the crop new variety of good anti-salt/non-irrigated ability.Utilize transgenic technology that new anti-salt/non-irrigated functional gene is transferred in the crop, with these efficient exploitation resistant transgenic crop new variety, being used in salt marsh/arid area plantation is a technology with broad prospect of application.Its prerequisite is, must systematically understand plant stress-resistance mechanism, separates relevant with degeneration-resistant drought efficiently gene.

For many years, the research of relevant plant stress-resistance mechanism aspect has obtained bigger progress, has cloned decomposing biological and has coerced genes involved, for the molecular mechanism of further illustrating plant stress-resistance provides theoretical clue and foundation.Some experiments show, in gene transferred plant relevant in plant itself and the other biological with drought resisting, its allos transcribe can the render transgenic plant with translation product drought-resistant ability change.The functional gene that is used to transform comprises two classes: a genoid can directly improve the anti-adversity ability of plant after transforming, and this can be by being improved the anti-adversity ability of plant by genetically modified overexpression or inducible expression; Another kind of is the anti-adversity ability that suppresses the constitutive expression raising plant of plant itself by inhibition or induction type.

MYB albumen is the very important transcription factor of a class, and involved in plant is to the response process of multiple abiotic stress.Existing in recent years test shows that the myb gene in the Arabidopis thaliana can improve the anti-adversity ability of Arabidopis thaliana, but the effect of relevant wheat myb gene in the plant drought process do not appear in the newspapers as yet.

Summary of the invention

At the deficiencies in the prior art, the purpose of this invention is to provide a kind of adversity gene---wheat introgression family gene Tamyb 31 for resisting abiotic stress and application thereof.

Technical program of the present invention lies in gradually oozing from wheat somatic hybrid is that the mountain is melted No. 3 to separate and obtained wheat MYB allelic variation gene---Tamyb31, and structure dicotyledons expression vector pSTART/Tamyb31 transformation mode plant Arabidopis thaliana, with the function of identified gene and the most at last this gene be used for the conversions of important farm crop such as wheat, improve the resistance of farm crop.

Wheat provided by the invention gradually ooze be the adversity gene name to be called that wheat somatic hybrid gradually oozes be that myb gene Tamyb31 is melted on the mountain No. 3, the nucleotide sequence of described gene cDNA is shown in SEQ ID No.1.

The present invention also provides the plant expression vector that contains above-mentioned adversity gene Tamyb1 pCAMBIA3301/Tamyb31.

Gene Tamyb31 of the present invention and the application of plant expression vector pCAMBIA3301 (pSTART)/Tamyb1 in cultivating adversity resistant plant that contains described gene Tamyb1.Wherein said plant optimization is common wheat or Arabidopis thaliana.

With gene transfered plant cell of the present invention, make its overexpression in plant just can obtain anti-adversity ability by the render transgenic plant.For the ease of transgenic plant or clone are screened, can the plant expression vector pSTART/Tamyb31 that contain described gene Tamyb31 be processed, as the antibiotic marker thing (Totomycin that can bring Selection In mark (GUS etc.) or have resistance, kantlex, gentamicin etc.) etc.

Gene of the present invention can be widely used in cultivates degeneration-resistant new crop varieties, and can be and deeply illustrate plant stress-resistance mechanism theoretical foundation is provided.

Beneficial effect of the present invention: utilize existing plant gene engineering technology, the present invention clones first and obtained that wheat gradually oozes is that the new gene Tamyb31 of resisting abiotic stress is melted on the mountain No. 3, and the method that mediates by agrobacterium tumefaciens changes this gene over to Arabidopis thaliana, prove that through comparative analysis the anti-adversity ability of transfer-gen plant obviously strengthens.Can pass through the expression strategy exploitation in view of the above and cultivate degeneration-resistant crop new variety.

Description of drawings

The amplification of Fig. 1 Tamyb31 full length gene cDNA sequence

Wherein: Maker:DNA molecular weight standard, λ DNA/EcoRI+HindIII (down together).

The sxemiquantitative RT-PCR that Fig. 2 Tamyb31 goes down the hill to melt in No. 3 in multiple processing analyzes, and different development stage RT-PCR analyzes.

Fig. 3 Tamyb31 transgenic arabidopsis plant qPCR and southern identify.

Wherein: VC: empty carrier contrast (down with), 3-21,4-21,6-10 are that Tamyb31 crosses and expresses system's (down with).

Fig. 4 Tamyb31 transgenic arabidopsis plant is at the various germination rates of seed down of coercing.

Fig. 5 Tamyb31 transgenic arabidopsis plant is coerced phenotype down in salt/drought.

Fig. 6 Tamyb31 transgenic arabidopsis plant is coerced phenotype down at LiCl/KCl/Mannitol

Coerce the qPCR result of marker gene in Fig. 7 Tamyb31 transgenic arabidopsis plant.

Fig. 8 Tamyb31 transgenic wheat plant and detection.

Fig. 9 pCAMBIA3301-ubi carrier figure.

Embodiment

The clone of embodiment 1, Tamyb31

1.1 melting No. 3 RNA, the mountain extracts

(1) organization material that the PEG osmotic stress is handled is put into the mortar of liquid nitrogen precooling, abundant grind into powder in liquid nitrogen;

(2) treat that the liquid nitrogen volatilization is dried, transfer to immediately in the centrifuge tube of 2ml that every 100mg material adds 1ml Trizol extracting solution approximately, thermal agitation makes the abundant cracking of sample, and room temperature was placed 5 minutes;

(3) 4 ℃, centrifugal 15 minutes of 12000rpm;

(4) carefully in the centrifuge tube with upper water phase transition to a new 1.5ml, add 200 μ l chloroforms (chloroform) with pipettor, thermal agitation mixing 15 seconds, room temperature was placed 10 minutes;

Alcohol (1: 1 volume), abundant mixing ,-20 ℃, precipitation 30min or spend the night;

(5) 4 ℃, centrifugal 15 minutes of 12000rpm;

(6) carefully in the centrifuge tube with upper water phase transition to a new 1.5ml, add the Virahol (1: 1 volume) of 500 μ l with pipettor, abundant mixing ,-20 ℃, precipitation 30min or spend the night;

(7) 4 ℃, the centrifugal 10min of 12000rpm, careful abandoning supernatant;

(8) RNA precipitation 75% washing with alcohol of 1ml.4 ℃, the centrifugal 10min collecting precipitation of 8000rpm;

(9) repeat with RNA precipitation of 75% washing with alcohol;

(10) remove supernatant, RNA is deposited in and dries about 10-15 minute on the aseptic technique platform, and it is transparent that RNA shows slightly, and the RNase-free water that adds proper volume (30-50 μ l) fully dissolves (can be placed on-80 ℃ of prolonged preservation);

(11) ultraviolet spectrophotometer and 1%Agrose detected through gel electrophoresis RNA concentration and quality.

Annotate: a) use the output of UV spectrophotometer measuring RNA, the absorbancy at the 260nm place, 1OD=40ug/ml.According to light absorption value, detect the purity of RNA, the OD of pure rna at 260nm and 280nm place ₂₆₀/ OD ₂₈₀Ratio should be near 2.0 (ratio be preferably between 1.9～2.1).

B) use the 1%Agrose gel electrophoresis to examine quality and the size of side RNA.Draw the RNase-free water that 1ul RNA adds 3 μ l, add 65 ℃ of sex change of 1 μ l sample-loading buffer 5 minutes.With EB dyeing, the 1kbDNAMarker that other gets 3 μ l in contrast behind the electrophoresis.

1.2cDNA 3 ' and the rapid amplifying of 5 ' terminal first chain

(Rapid Amplification of cDNAEnds, RACE) the SMART RACE cDNA Amplification Kit operational guidance by Clonetech company carries out the terminal rapid amplifying of 5 ' and 3 ' RACE, the first chain cDNA.1.3 Tamyb315 ' and 3 ' end clone

(1), obtain the partial sequence of Tamyb1 and design two pairs of gene specific primers (sequence is as follows) according to SMART RACE cDNAAmplification Kit operational guidance according to the detected result of gene chip:

Tamyb31-NT3：5′GAACCTCCACTGAGAAACATTACC3′

Tamyb31-NT7:5 ' GTTCCAATCTATGAGGGATACACGC3 ' primer sequence

Tamyb31-As：5′GATCAAGAACGTCTGGCACA?3’

Tamyb31-S：5’GAGGCCATCGAGTAGTCAGC?3’；

(2) according to increase respectively 5 ' and the 3 ' end of Tamyb31 of SMART RACE cDNAAmplification Kit operational guidance;

(3), at initiation codon upstream and termination codon downstream design primer (sequence is as follows), be this full length gene of template amplification respectively with 5 ' or 3 ' RACE product with the splicing of 5 ' and 3 ' terminal sequence.

Primer 1:ATGGTGAGGGCTCCTTGCTGC

Primer 2: TTAAATCTGTGACAAACTCTGCA

1.4Tamyb1 full-length clone

1. primer sequence: see 1.3 parts.

2.PCR reaction system (20 μ L):

10×buffer 2μl

Template (5 ' RACE product) 1 μ l

dNTPs(2.0mM?each) 0.5μl

Primer1(5μM) 1μl

Primer2(5μM) 1μl

High-fidelity Taq enzyme (STRATAGEN, Cat No:600380) 0.5 μ l

ddH ₂O 14μl

3.PCR response procedures is: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 45sec, 57.5 ℃ of renaturation 45sec, 72 ℃ are extended 45sec, circulate 35 times; 72 ℃ are extended 7min.

4. be connected with the T carrier after the recovery of amplified fragments, transformed into escherichia coli, choose positive colony order-checking.The results are shown in Figure 1.

The expression analysis of embodiment 2, Tamyb31

2.1 coerce down the extraction of RNA

Normal seed germination is melted on the mountain No. 3, and (about 3 time-of-weeks) began to carry out arid control water, salt stress (200mM NaCl), ABA, GA, ACC, JA and SA and handle when the Hoagland nutrient solution was cultured to the about 10cm of plant height.After handling different time, the Trizol method is extracted the seedling root, leaf RNA is the same.

2.2 reverse transcription obtains cDNA

Reverse transcription produces cDNA, the by specification operation.

2.3PCR reaction and electrophoresis

(1) is template with cDNA, carries out the PCR reaction.Primer is as follows:

5 ' end primer: GATCAAGAACGTCTGGCACA

3 ' end primer: GAGGCCATCGAGTAGTCAGC

(2) PCR system:

ddH ₂O 12.6μl

10×Taq?bufferr(Mg2+free) 2μl

MgCl ₂(25mM) 1.2μl

Primer1(5μM) 1μl

Primer2(5μM) 1μl

dNTP(2mM?each) 1μl

Taq?polymerase(5U/μl) 0.2μl

Template (reverse transcription cDNA) 1 μ l

ToTal?Volume 20μl

(3) PCR program:

95℃3min，25～30cycles?95℃30s，60℃30s，72℃60s；72℃5min。

Determine the cycle number of PCR according to the amplification situation of confidential reference items Actin, adjust the add-on of cDNA template.

(4) 1.5% agarose gel electrophoresis.The results are shown in Figure 2.

The structure of embodiment 3, plant expression vector (35S promoter)

Plant expression vector pStart is the binary vector that contains 35S promoter and NPT II gene, contains the recognition site of restriction enzyme BamHI and SmaI on its multiple clone site.The primer that contains BamHI and SmaI recognition sequence in view of the above in the design of goal gene initiation codon upstream and termination codon downstream, with high-fidelity Taq enzymatic amplification goal gene, system is with 1.4.

With restriction enzyme BamHI and SmaI carrier pStart and goal gene amplified production segment being carried out enzyme respectively cuts.The carrier of complete degestion reclaims through glue after electrophoretic separation on 0.8% sepharose, links to each other with the goal gene amplified fragments that enzyme is cut then.

Enzyme is cut system,

(1) plasmid BamHI single endonuclease digestion

10×Buffer 1μl

Plasmid 1～2 μ l

BamHI 1μl

SmaI 1μl

Add ddH ₂O is to cumulative volume 20 μ l

Cut more than 2 hours in 37 ℃ of thermostat water bath enzymes.It is electrophoretic buffer with 0.5 * TBE that enzyme is cut the back, enzyme is cut product carry out 0.8% agarose gel electrophoresis.Under ultraviolet transilluminator, downcut big fragment of pStart and goal gene band, reclaim with clean blade.

(2) the big segmental dephosphorization of the carrier of Hui Shouing.

(3) carrier segments of cutting through enzyme and target gene fragment are carried out 16 ℃ with 1: 4 ratio of mol ratio and are connected and spend the night.

(4) connect product heat shock method transformed into escherichia coli DH5a competent cell, transformed bacteria on the LB solid plate that contains Kan 50 μ g/ml 37 ℃ cultivated about 16 hours.

(5) evaluation of recon

1. the carrier special primer is synthetic

In order to identify the direction of insertion of goal gene, according to carrier special primer of 35S promoter sequences Design, sequence is as follows: GTT GGG GTT TCTACA GGA CGT

2. the PCR of recombinant plasmid checking

The single bacterium colony of the resistance of picking on the kan substratum is inoculated in 5ml respectively and contains in the LB liquid nutrient medium of Kan 37 ℃ of shaking culture and spend the night, and alkaline denaturation extracts plasmid, carries out pcr amplification, system same 2.3 with the downstream primer of carrier special primer and gene.The PCR reaction conditions is as follows: pre-94 ℃ of 3min of sex change, and 35 circulations are: 94 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 1min, last, 72 ℃ are extended 10min.The PCR product is identified with 1.0% agarose gel electrophoresis.

3. plasmid enzyme restriction is identified

The upgrading grain carries out BamHI and the SmaI enzyme is cut, and it is the same that enzyme is cut system.0.8% agarose gel electrophoresis detects the fragment that whether contains expection molecular weight size, the correct structure of checking carrier.

Embodiment 4, the competent preparation of Agrobacterium and conversion

4.1 the competent preparation of Agrobacterium AGL1/EHA105

(1) goes up the single bacterium colony of picking agrobacterium tumefaciens from YEP flat board (containing 50 μ g/ml Rifampins), be inoculated in the YEP liquid nutrient medium that contains 50 μ g/ml Rifampins 200rpm/min, 28 ℃ of overnight incubation.

(2) getting 2ml incubated overnight liquid is inoculated in 50ml and contains in the identical antibiotic YEP liquid nutrient medium and be cultured to OD under the same conditions ₆₀₀Reach 0.5.

(3) bacterium liquid ice bath 30min, 4 ℃, the centrifugal 10min of 5000rpm collects thalline.

(4) thalline is resuspended among the NaCl of 10ml 0.15mol/L of ice bath centrifugal collection thalline.

(5) resuspending is divided in bacterium liquid in the 1.5mlEppendorf pipe with 200 μ l/ pipes in the CaCl2 solution of 1ml 20mmol/L ice precooling, puts quick-frozen 1min in the liquid nitrogen, and-70 ℃ of preservations are standby.

4.2 freeze-thaw method transforms agrobacterium tumefaciens AGL1/EHA105

(1) at room temperature melts two pipe Agrobacterium competent cells, add 1 μ g expression vector plasmid DNA and 1 μ g empty carrier respectively, ice bath 30min behind the mixing.

(2) put liquid nitrogen flash freezer 1min, move to 37 ℃ of temperature rapidly and bathe 3min.

(3) the YEP 800 μ l of adding antibiotic-free, 3hr are cultivated in 28 ℃ of concussions.

(4) the centrifugal 30s of 7000rpm collects thalline, is applied on the YEP flat board that contains 50 μ g/ml Rifampins, 50 μ g/ml Kan, is inverted dark the cultivation 2-3 days for 28 ℃.

4.3 thalline PCR identifies

Thalline PCR method and program are the same.

Embodiment 5, Arabidopis thaliana transform and screening

5.1 Arabidopis thaliana plantation

Get Arabidopis thaliana (Colombia's wild-type) seed, place in the plate that is lined with filter paper, with the wetting filter paper of a small amount of distilled water, carry out vernalization treatment in 4 ℃ of refrigerators, be seeded in the seedling pan after 3-5 days, be positioned over (16h illumination in the growth cabinet, 22 ℃/8h dark, 18 ℃), 6-8 is after week in growth, treats to be used for when bolting is bloomed to transform.

5.2 Arabidopis thaliana transforms

(1) transform the day before yesterday, get 2ml activatory Agrobacterium AGL 1 and be added to and contain in the corresponding antibiotic 200ml YEP substratum, incubated overnight is to OD ₆₀₀=1.0-1.2.

(2) centrifugal collection thalline, and be resuspended in the dip-dyeing solution (5% sucrose, 0.04%Silwet L-77), make OD ₆₀₀=0.g.

(3) inflorescence was immersed dip-dyeing solution 30 seconds, the swing inflorescence makes and forms a skim on the inflorescence therebetween.

(4) cover inflorescence with preservative film, secretly cultivate after one day and throw off preservative film, continue to put growth cabinet and make its growth.

(5) contaminated once with identical method again every 5-7 days.

(6) gather in the crops seed after about one month.

(7) conversion of empty carrier is the same

5.3 it is screening that Arabidopis thaliana transforms positive strain

(1) Shou Huo T0 for seed disinfection after (75% ethanol 5min, detergent wash 10-15min, aseptic water washing 3-5 time), be laid on the MS screening culture medium that contains 50 μ g/mL Kan.

(2) 4 ℃ of vernalization 48h move on to culturing room's (16h illumination/8h dark, 22 ℃ of constant temperature) growth 7-10 days.The green seedling of resistance is moved on to continued growth in the soil.

(3) etc. when the most petals of plant have born pods, the plant individual plant has been tied up, so that individual plant is gathered in the crops T1 for seed with marline.

(4) repeating step (1)-(3), the T1 of individual plant results is continued containing that the enterprising row filter of MS substratum of card for seed, the single independent strain system that inserts that selects the resistance ratio and be 3: 1 transplants, and individual plant results seed obtains T2, continue repeating step (1)-(3), no longer separate on that resistance substratum of card for single-strain seed until T2, the T2 that so far obtains isozygotying is used for follow-up further research for plant.The homozygotic screening method of empty carrier is the same.

(5) the CTAB method is extracted the genomic dna of wild-type, empty carrier contrast and different transgenic lines, extracts the total RNA and the synthetic cDNA of reverse transcription of respective material.

(6) pcr amplification: the genomic dna with above-mentioned differing materials is a template, uses gene specific primer, empty carrier to detect special primer (35S promoter sequence), PCR reaction system and reaction conditions such as preceding.

(7) qPCR and Southern checking shows that Tamyb31 is normal expression in transformed plant.The results are shown in Figure 3.

Embodiment 6, commentaries on classics Tamyb1 Arabidopis thaliana stress resistance are analyzed

6.1 germination rate is measured

With the commentaries on classics Tamyb31 Arabidopis thaliana seed of empty carrier contrast, three strain systems after sterilization (method is the same), the shop is gone into to contain in the MS substratum of NaCl, ABA, 25 ℃ of cultivations, observe the sprouting situation, cotyledon opens fully be to be sprouted, germination rate=cotyledon unfolded seed number/be used for seed sum * 100% of sprouting test.The results are shown in Figure 4.

6.2 the plant stress resistance is analyzed

(1) Arabidopis thaliana seed disinfection, sprouting (method is the same);

(2) seedling that will sprout 2 days is transferred to vertical cultivation in the MS substratum that contains Mannitol, NaCl, KCl and LiCl, observes growth of seedling difference.The results are shown in Figure 5,6.

(3) transfer-gen plant and the contrast control water of earth culture about 3 weeks was rewatered and makes it recover growth 3 days in 10 days, observe plant drought resisting situation.The results are shown in Figure 5.

6.3 change the relevant Marker genetic analysis of Tamyb31 Arabidopis thaliana seedling medium drought resistant

(1) Arabidopis thaliana seed disinfection, sprouting, cultivation (method is the same);

(2) contrast and the transgenic line after drought, ABA handle extracts the total RNA of plant, and reverse transcription forms cDNA, carries out RT-PCR and analyzes.Method the results are shown in Figure 7 with embodiment 2.

Embodiment 7, commentaries on classics Tamyb31 wheat plant and detection

7.1TaMYB31-pCAMBIA3301 vector construction

After TaMYB31-ORF increases with TaMYB31-CDS-3301-S (Sac1) and TaMYB31-CDS-3301-As (BamH1), be connected into the Sac1 and the BamH1 site of pCAMBIA3301-ubi carrier.Transformant is identified by order-checking.

PCAMBIA3301-ubi carrier figure such as Fig. 9.

7.2 wheat transforms

Change the carrier that builds over to Agrobacterium EHA105 with embodiment 4.Adopt the patented method of the vegetative point transformed wheat of this laboratory foundation to transform wheat cultivation kind Jimai 21 and Jinan 17.Transform seedling and infect back recovery in strong sprout 1 week of growth, transplant to dixie cup, utilize PCR to identify positive plant, the results are shown in Figure 8 at agricultural bar.

Claims (1)

1. One grow wheat gradually to ooze be anti-salt drought stress gene TAmyb31, it is characterized in that: the nucleotide sequence of described gene cDNA is shown in SEQ ID No.1.

Images