CN104726488A - Method for culturing stress-resistance herbicide-resistance transgenic aerobic rice - Google Patents
Method for culturing stress-resistance herbicide-resistance transgenic aerobic rice Download PDFInfo
- Publication number
- CN104726488A CN104726488A CN201510140056.1A CN201510140056A CN104726488A CN 104726488 A CN104726488 A CN 104726488A CN 201510140056 A CN201510140056 A CN 201510140056A CN 104726488 A CN104726488 A CN 104726488A
- Authority
- CN
- China
- Prior art keywords
- rice
- upland rice
- resistance
- resistant
- transgenosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a method for culturing stress-resistance herbicide-resistance transgenic aerobic rice. The method comprises the following steps: constructing a recombinant expression vector by utilizing stress-resistance 8981 genes, transforming into agrobacterium, infecting embryonic callus of target aerobic rice by using an agrobacterium bacterium solution, and culturing; screening by virtue of a screening culture medium, performing pre-differentiation and differentiation culture on the screened resistant callus, and transforming the regenerated seedling formed in differentiation into a rooting culture medium for culturing; acclimatizing and transplanting after the seedlings take roots to obtain the aerobic rice which is identified to be transgenic positive aerobic rice by means of PCR and RT-PCR detection. T3 generation plant physiological tests prove that the aerobic rice has resistance on drought, salt and alkali and glufosinate-ammonium. The method can be used for culturing a transgenic aerobic rice strain with excellent resistance on adverse situation and herbicide glufosinate-ammonium, and has an excellent application prospect in culturing novel stress-resistance aerobic rice varieties.
Description
Technical field
The invention belongs to gene engineering technique field, be specifically related to the method for cultivation of a kind of transgenosis upland rice of degeneration-resistant, antiweed.
Background technology
Grain security and ecological safety are the matters of utmost importance in China's agricultural sustainable development.Paddy rice is for ensureing that China's grain security has made tremendous contribution.But Rice Production consumes a large amount of Freshwater resources, as important food crop, its water consumption accounts for a big chunk of agricultural water total amount, and therefore the present situation of a lot of regional lack of water of China has become one of major reason affecting rice yield.Nearly more than the 100000000 mu of saltingss of China, are mainly distributed in the coastland of the arid and semi-arid lands such as northeast, North China, northwest and North of Yangtze River.Along with the sharp increase of China's population and the high speed development of industry, arable land sharply declines, and unreasonable irrigation, farming etc. cause the secondary salinization in a large amount of good farmland, particularly by the bottom land that side impregnation is given, the soil salinization is day by day serious, and having the trend increased year by year, the Rice Production of China in serious threat.Except the abiotic stress such as arid, saline and alkaline, weeds in paddy field provides because fighting for light, water, fertilizer etc. with paddy rice the important factor also becoming and affect yield and quality of rice.Weed competition interference causes the paddy rice underproduction more than 15%.Weeds seed adulterates, and affects grain quality, and poisonous weeds also harm humans is healthy.Some weeds are important hosts of crop pest, indirectly add the input of field agrochemical chemical substance.
Therefore, degeneration-resistant extremely urgent with Herbicide Resistant Rice rearing new variety.But the traditional breeding method cycle is long, Breeding Process is complicated, and is difficult to the new variety obtaining the ability having degeneration-resistant and antiweed concurrently.In order to overcome the abiotic stress such as saline and alkaline and arid to the harm of agriculture production, meet the world and China to drought resisting, the demand that salt tolerant rice kind is growing, effectively control weeds in paddy field simultaneously, reduce labour demand, improve increasing production of rice potentiality, the application's application modern biotechnology, clone adversity gene 8981 gene in small liwan moss, after the common construction of expression vector of herbicide resistant bar gene, imported by Agrobacterium infestation method in the cultivated rice and upland rice cultivar being suitable for nonirrigated farmland plantation, formulate a collection of important transgenic material, degeneration-resistant for cultivating, high yield, the new variety of high-quality provide important basis, this technology yet there are no relevant report.
Summary of the invention
For the technological deficiency that prior art exists, the object of the present invention is to provide the method for cultivation of a kind of transgenosis upland rice of degeneration-resistant, antiweed.
The present invention realizes especially by following technical scheme:
A method of cultivation for the transgenosis upland rice of degeneration-resistant, antiweed, comprises the following steps:
1) degeneration-resistant 8981 gene constructed recombinant expression vector pCAMBIA3301-Ubi-8981 are utilized;
2) recombinant expression vector is transformed into Agrobacterium, and utilizes Agrobacterium bacterium liquid to infect the embryo callus of object upland rice, utilize Dual culture base to cultivate;
3) bacterium taken off to the callus after Dual culture and recover, being transferred in the screening culture medium containing careless ammonium phosphine and screening;
4) resistant calli of screening is broken up and differentiation culture through pre-, the regeneration seedling be differentiated to form is proceeded in root media and cultivates, hardening, transplanting after seedling takes root, obtain transgenosis upland rice that is degeneration-resistant, antiweed.
8981 gene orders of the present invention are SEQ ID NO.1.
The construction process of described recombinant expression vector is: cut Ubi-T carrier with EcoR I and BamH I enzyme, obtain the fragment containing Ubiquitin gene; Cut 8981-T carrier with BamH I and Pml I enzyme, obtain the fragment containing 8981 genes; Fragment containing Ubiquitin and 8981 genes is inserted in the multiple clone site of carrier pCAMBIA3301 successively, obtains described recombinant expression vector called after pCAMBIA3301-Ubi-8981.
Further, described Ubi-T carrier is: obtain by Ubiquitin gene is connected pGEM-T vector, described Ubiquitinp gene PCR amplimer is 5 '-CGGAATTCCTGCAGTGCAGCGTGACC-3 ' and 5 '-CGGGATCC CTGCAGAAGTAACACCAAACAAC-3 ', and the Ubiquitin length amplified is 2.0kb.
Further, described described 8981-T carrier is: 8981 genes are connected pGEM-T vector and obtains, 8981 described gene PCR amplimers are 5 '-GGATCC TCTTGTGTATATTGTGCGC-3 ' and 5 '-CACGTG TGCGGTGTCTTATTTACTAT-3 '.
Object upland rice of the present invention is No. 1, enormous legendary fish, which could change into a roc drought.
Described Dual culture base is: NB+2,4-D2mg/L+ sucrose 30g/L+ glucose 10g/L+AS20mg/L+ gel 3.2g/L, and culture condition is: pH5.2,25 DEG C of light culture 3 days.
Described callus recovery media is: NB+ Ticarcillin/Clavulanate Acid 500mg/L+ maltose 30g/L+ gel 0.58%, pH6.0, and culture condition is: 28 DEG C of light culture 7 days.
Described screening culture medium is: NB+ maltose 30g/L+ Ticarcillin/Clavulanate Acid 300mg/L+ grass ammonium phosphine 40mg/L+ gel 3.2g/L, pH6.0,28 DEG C of lucifuge screening three-wheels, 40 days.
Described pre-division culture medium is: NB+NAA1mg/L+6-BA 3mg/L+ABA3mg/L+ maltose 30mg/L+ Ticarcillin/Clavulanate Acid 300mg/L+ grass ammonium phosphine 40mg/L+ gel 3.2g/L, pH6.0, and culture condition is: 28 DEG C of light culture 5 days.
Described division culture medium is: NB+6-BA1mg/L+NAA1mg/L+ maltose 30g/L+ plant gel 3.2g/L, pH5.8, culture condition is: 28 DEG C of light culture.
Described root media is: 1/2MS+ sucrose 30g/L+NAA0.5mg/L+ plant gel 1.6g/L, pH5.8; Culture condition is: illumination cultivation 3-4 week at 28 DEG C.
Beneficial effect of the present invention is: will import in object upland rice containing LEA family 8981 gene recombinant vectors, obtain degeneration-resistant transgenosis upland rice, described transgenosis upland rice to the resistance of arid, saline and alkaline and weedicide higher than object upland rice.Experiment confirms, recombinant vectors of the present invention imports in upland rice, obtains 100 transgenosis upland rice strains.To the T of 100 positive strains
3in generation, has carried out PCR, RT-PCR Screening and Identification and degeneration-resistant experiment successively, obtains transgenosis upland rice strain adverse circumstance and weedicide grass ammonium phosphine to good resistance, in the degeneration-resistant upland rice variety that cultivation is new, has good application prospect.The inventive method also can be applicable in the cultivation of other plant new variety.
Accompanying drawing explanation
Fig. 1 is the T-DNA plot structure sketch of expression vector pCAMBIA3301-Ubi-8981; LB, T-DNA left margin; RB, T-DNA right margin; CaMV 35S, tobacco mosaic virus (TMV) 35S promoter; Nos, Nos terminator; Ubi, corn Ubiquitin promotor; Bar, anti-herbicide gene (PPT acetyl transferase gene); 8981, LEA family adversity gene 8981;
Fig. 2 is the PCR detected result turning 8981 gene upland rice;
Fig. 3 is the RT-PCR detected result turning 8981 gene upland rice;
Fig. 4 is 15%PEG4000 stress transgenic upland rice qualification figure; A is the upland rice of normal growth to tri-leaf period, and c1 is non-transgenic upland rice, and a1, b1, d1, e1 are 4 different transgenosis upland rice strains; B is that 15%PEG4000 coerces upland rice upgrowth situation after 7 days, and c2 is non-transgenic upland rice, and a2, b2, d2, e2 are 4 different transgenosis upland rice strains; C is rehydration upland rice upgrowth situation after 7 days, and c3 is non-transgenic upland rice, and a3, b3, d3, e3 are 4 different transgenosis upland rice strains;
Fig. 5 is 0.75%NaCl process 5 days transgenosis upland rice sprouting figure.A is No. 1, non-transgenic upland rice enormous legendary fish, which could change into a roc drought; B is for turning No. 1,8981 gene upland rice enormous legendary fish, which could change into a roc drought;
Fig. 6 is that 0.8mg/ml grass ammonium phosphine sprays transgenosis upland rice qualification result figure in tri-leaf period; A is upland rice growing state before the careless ammonium phosphine of sprinkling, and wherein a1 is non-transgenic upland rice, and b1 is transgenosis upland rice; B is upland rice growing state after sprinkling 0.8mg/ml grass ammonium phosphine 72h, and wherein a2 is non-transgenic upland rice, and b2 is transgenosis upland rice;
Fig. 7 sprays 500mg/L weedicide effect after 15 days between transgenosis upland rice and non-transgenic dryland paddy; A, D, E are for turning the different strain of 8981 gene upland rice, and B, C are non-transgenic upland rice.
Embodiment
Below in conjunction with embodiment, the present invention is described further, the following stated, only to preferred embodiment of the present invention, not do other forms of restriction to the present invention, any those skilled in the art may utilize the technology contents of above-mentioned announcement to be changed to the Equivalent embodiments of equal change.Everyly do not depart from the present invention program's content, any simple modification done following examples according to technical spirit of the present invention or equivalent variations, all drop in protection scope of the present invention.
The structure of embodiment 1 recombinant vectors
1, the clone of 8981 genes
With small liwan moss cDNA for template, carry out RT-PCR amplification, amplified production is connected on pGEM-T vector, constructs cloning vector 8981-T.The primer is:
5’-GGATCC TCTTGTGTATATTGTGCGC-3’；
5 '-CACGTG TGCGGTGTCTTATTTACTAT-3 ', the 8981 gene fragment length amplified are 0.8kb.
2, the structure of recombinant vectors
1) by the Ubiquitin promotor of pcr amplification pTCK303 (carrier is preserved in this laboratory), primer used is 5 '-CGGAATTC CTGCAGTGCAGCGTGACC-3 ' and 5 '-CGGGATCC CTGCAGAAGTAACACCAAACAAC-3 ', and the Uiquitin promotor length amplified is 2.0kb.This gene is connected pGEM-T vector (purchased from promega company), called after Ubi-T.
2) cut Ubi-T carrier with EcoR I and BamH I enzyme, purifying after obtaining the fragment of 2.0kb is also inserted between the EcoR I of pCAMBIA3301 carrier and BamH I restriction enzyme site and obtains recombinant vectors, by recombinant vectors called after pCAMBIA3301-Ubi.
3) 8981-T carrier is cut with BamH I and Pml I enzyme, purifying after obtaining the fragment of 0.8kb is also inserted between the BamH I of pCAMBIA3301-Ubi carrier and Pml I restriction enzyme site and obtains recombinant vectors, by recombinant vectors called after pCAMBIA3301-Ubi-8981.
The T-DNA plot structure sketch of the expression vector pCAMBIA3301-Ubi-8981 built is as Fig. 1.
The conversion of embodiment 2 recombinant vectors, cultivation and Molecular Identification
1, expression vector transformation Agrobacterium
1) the competent preparation of Agrobacterium
Frozen agrobacterium strains Agl-1 is taken out, respectively at the flat lining out of LB of Amp and Rif resistance, Kan and Rif resistance, Rif resistance from-80 DEG C of refrigerators.Be inverted for 28 DEG C and cultivate 48h, if Amp
+and Kan
+flat board all grow without bacterium colony, this pipe bacterial strain can as preparation competent original strain.Single bacterium colony of the agrobacterium tumefaciens on the LB flat board of picking Rif resistance in 3-5mL containing in the YEB liquid nutrient medium of Rif resistance, 28 DEG C of 200rpm shake overnight incubation.Get the bacterium liquid that spends the night to be inoculated in 50mL by 1:50 and to spread cultivation containing in the YEB substratum of Rif, 28 DEG C are continued to shake and train about 6-7h, take out to OD600=0.4-0.6.Ice is put into, ice bath 30min by shaking the bacterium liquid trained.5000g, 4 DEG C of centrifugal 5min, supernatant discarded reclaims thalline.In the thalline reclaimed, add 10ml 0.15M NaCl, pressure-vaccum gently, thalline is mixed in the solution completely.5000g, 4 DEG C of centrifugal 5min, remove supernatant, the CaCl that thalline 1mL 20mM is ice-cold
2suspend gently.Often pipe 200 μ L packing, adds the sterile glycerol that final concentration is 20%, mixing, and proceeds to-80 DEG C of preservations after putting into liquid nitrogen quick-frozen.
2) expression vector transformation Agrobacterium
From-80 DEG C of refrigerators, take out the competent cell of the Agrobacterium of preparation, and be placed on ice, the plasmid DNA of 10 μ L joins in the Agrobacterium competent cell of 200 μ L after melting by competent cell, and pressure-vaccum mixing gently, is put in ice bath 30min on ice.The EP pipe that competent cell is housed is put into liquid nitrogen quick-frozen 5min, puts into 37 DEG C of thermostat water baths immediately and be incubated 5min.Take out centrifuge tube, add the YEB liquid nutrient medium of 1mL antibiotic-free in pipe, 28 DEG C of 150rpm shake training 3-5h, simultaneously the YEB solid medium of preparation containing (Kan 100mg/L, Rif 125mg/L) resistance.Room temperature 5000rpm, centrifugal 5min, discard part supernatant, with the pressure-vaccum mixing gently of large rifle, thalline is uniformly distributed in the medium, and is coated on containing Kan
+yEB solid medium on, in constant incubator, 28 DEG C be inverted cultivate 24-48h, all visible single bacterium colony.
Agrobacterium is not the bacterial strain of natural preservation plasmid, what plasmid can not highly copy in Agrobacterium copies, the concentration causing plasmid to put forward is very low, thus we adopt the method for recovering to mobilize, plasmid is identified: from Agrobacterium, propose plasmid DNA, subsequently plasmid DNA is rotated back into (DH5 α) in intestinal bacteria, and the colibacillary single bacterium colony of picking, put it in liquid nutrient medium and shake training, extraction plasmid DNA is carried out enzyme and is cut qualification.Result display carrier pCAMBIA3301-Ubi-8981 successfully proceeds in Agrobacterium.
2, upland rice is transformed
1) acquisition of explant
Experiment material is an enormous legendary fish, which could change into a roc drought mature embryo.Aseptically, with 75% alcohol immersion dehusked seeds l.5min, period jiggles Erlenmeyer flask, with distilled water wash 3 times, then steeps 20min with 30%NaC1O, constantly rocks Erlenmeyer flask in immersion process, repeats twice, with distilled water wash 6 times; Blot seed-coat moisture with aseptic filter paper, be inoculated under aseptic condition (NB+2,4-D 2mg/L+ maltose 30g/L+ gel 3.2g/L) on inducing culture, 20, every ware, 28 DEG C of light culture evoked callus; After callus grows, select densification, faint yellow, maize shape size, the good callus of state carries out 7 days succeeding transfer culture, and succeeding transfer culture is identical with callus induction substratum.
2) agrobacterium mediation converted and cultivation
Under aseptic condition, choose the callus of faint yellow densification in subculture medium, be transferred in Erlenmeyer flask, pour the re-suspension liquid containing thalline immediately into, re-suspension liquid OD (600) value 0.2, and make callus be fully immersed in re-suspension liquid, ensure that Agrobacterium contacts completely with callus, soak 20 minutes, re-suspension liquid is poured out, callus is scraped with little spoon, callus is transferred in the culture dish being covered with 10 metafiltration paper, after callus surface is without obvious water mark, callus is transferred to (NB+2 on Dual culture substratum, 4-D 2mg/L+ sucrose 30g/L+ glucose 10g/L+AS20mg/L+ gel 3.2g/L), pH5.2, 25 DEG C of light culture 3 days.
3) the de-bacterium of callus and renewal cultivation
Aseptically, the callus of Dual culture after 3 days is collected in an Erlenmeyer flask, by sterile water wash 4 times, then the sterilized water containing microbiotic Ticarcillin/Clavulanate Acid 500mg/L is poured into, soak 10 minutes, period jiggles, pour out sterilized water, finally pour de-bacterium liquid (the NB+ Ticarcillin/Clavulanate Acid 500mg/L+2 containing Ticarcillin/Clavulanate Acid 500mg/L into, 4-D 2mg/L+ maltose 30g/L, pH6.0), soak 40 minutes, period jiggles, pour out de-bacterium liquid, clean once with aqua sterilisa, callus is transferred in the culture dish being covered with 10 metafiltration paper, blot surface-moisture, callus after blotting is transferred to (NB+ Ticarcillin/Clavulanate Acid 500mg/L+ maltose 30g/L+ gel 0.58% in the recovery media containing Ticarcillin/Clavulanate Acid, pH6.0), 28 DEG C of light culture 7 days.
4) kanamycin-resistant callus tissue screening
After callus recovers one week, transferred to (NB+ maltose 30g/L+ Ticarcillin/Clavulanate Acid 300mg/L+ grass ammonium phosphine 40mg/L+ gel 3.2g/L, pH6.0) in the screening culture medium containing careless ammonium phosphine, screening three-wheel, front two-wheeled often takes turns 15 days, third round 7 days, 28 DEG C of light culture; Often take turns in subculture process, a picking vegetative point place oyster white callus, the old callus of all the other yellowing is given up.
5) differentiation of callus and regeneration
Screen after 37 days, the milky callus of picking, subculture is to (NB+NAA1mg/L+6-BA 3mg/L+ABA3mg/L+ maltose 30mg/L+ Ticarcillin/Clavulanate Acid 300mg/L+ grass ammonium phosphine 40mg/L+ gel 3.2g/L in pre-division culture medium, pH6.0), 28 DEG C of light culture 5 days, callus color through pre-differentiation is white, and color is vivid glossy, picking white callus transfers to (NB+6-BA1mg/L+NAA1mg/L+ maltose 30g/L+ plant gel 3.2g/L on division culture medium, pH5.8), 28 DEG C of light culture, every 15 days subcultures once, experiment finds the callus through pre-differentiation process, on division culture medium, growth is very fast, growing way is better, treat that it occurs green point, when green point grows about 3cm budlet, transfer budlet (1/2MS+ sucrose 30g/L+NAA0.5mg/L+ plant gel 1.6g/L on root media, pH5.8), illumination cultivation 3-4 week at 28 DEG C, then by transplantation of seedlings to greenhouse or land for growing field crops.
3, the detection of transgenosis upland rice
1) detection of DNA level
Extract blade STb gene to be measured by CTAB method, with the genomic dna of each transgenic line for masterplate, plasmid pCAMBIA3301-Ubi-8981 is positive control, and the genomic dna of unconverted upland rice is negative control, carries out PCR detection.The primer sequence is S:AATTTCTTTCTTTTTGGATTA, A:TGCGGTGTCTTATTTACTAT.PCR reaction system (20 μ L): DNA 2 μ L, dNTP Mix 1 μ L, 10xPCR buffer 2 μ L, Taq enzyme 0.2 μ L, S primer 1 μ L, A primer 1 μ L.PCR response procedures: 96 DEG C of denaturation 3min; 94 DEG C of sex change 30s; 58 DEG C of annealing 40s; 72 DEG C extend 50s (35 circulation); 72 DEG C extend 10min.Amplified production detects through 1% agarose gel electrophoresis, and the plant that can amplify special 0.8kb gene fragment is positive plant, and as shown in Figure 2, wherein "-" is negative control; "+" is positive control (taking plasmid as template amplification); 1-22 is the upland rice plant qualification result of different strain; M is Marker, is followed successively by 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp from top to bottom, and most bright wisp band is 750bp.Result is found out thus, detect sample and be transgenic positive plant.
2) detection of rna level
In order to detect 1) in the positive strain of PCR in 8981 genes whether transcribed, carry out RT-PCR detection further.
A. from 1) be accredited as random choose 6 positive upland rice, be that material adopts TRIZOL method to extract total serum IgE separately with blade, get 2 μ g total serum IgE, adopt MMLV (promega) to prepare cDNA, the condition that whole operation is all recommended according to test kit is carried out.With the non-transformed upland rice obtained and the cDNA of transgenosis upland rice plant for template, carry out semiquantitive PCR amplification.
B. according to the paddy rice ACTIN gene order design internal reference primer reported, forward primer ACTIN-S:5 ＇-TCCATCTTGGCATCTCTCAG-3 ＇, reverse primer ACTIN-A:5 ＇-GTACCCGCATCAGGCATCTG-3 ＇, PCR response procedures is: 96 DEG C of denaturation 3min; 94 DEG C of sex change 40s; 55 DEG C of annealing 40s; 72 DEG C extend 30s; 25 circulations; 72 DEG C extend 10min.
C. PCR reaction product is carried out detected through gel electrophoresis, the fragment that electrophoresis obtains 450bp is the fragment of paddy rice ACTIN.Regulating cDNA template concentrations, making non-transformed upland rice consistent with turning 8981 upland rice plant amplified fragments brightness.
D. the non-transformed upland rice determined according to step c and turn 8981 gene upland rice plant cDNA template concentrations, carries out the pcr amplification of 8981 genes.Forward primer BDL-S:5 ＇-AATTTCTTTCTTTTTGGATTA-3 ＇, reverse primer BDL-A:5 ＇-TGCGGTGTCTTATTTACTAT-3 ＇, PCR response procedures is: 96 DEG C of denaturation 3min; 94 DEG C of sex change 40s; 58 DEG C of annealing 40s; 72 DEG C extend 50s; 25 circulations; 72 DEG C extend 10min.
PCR reaction product is carried out detected through gel electrophoresis, as shown in Figure 3, the product that electrophoresis obtains 0.8kb is 8981 gene fragments to electrophoresis result, and in figure, M is Marker, be followed successively by 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp from top to bottom, most bright wisp band is 750bp; 1-6 is in step 1) in 6 of random choose be accredited as positive transgenosis upland rice plant RT-PCR result.Can find out that the foreign gene that different plant proceeds to has expression on rna level, but different plant expression kurtosis is different.
Test example 3 is degeneration-resistant, antiweed Function detection
In order to identify the characteristic of transfer-gen plant, carry out the stress tests of the arid of transfer-gen plant, saline and alkaline and weedicide.
1, transgenosis upland rice drought resisting qualification
By 100 T
35% hypochlorite disinfectant 5min is used respectively for the seed (every strain 30) of the full grains of transgenosis upland rice strain and wild type seeds, clear water rinses 3 times, be laid in the culture dish placing filter paper, on 96 orifice plates cut off bottom being carefully transferred to after showing money or valuables one carries unintentionally for 3-4 days.96 orifice plates are positioned in common plastics square plate, and 10cm bottom plate distance square box, cultivate in growth cabinet, intensity of illumination is 80lux, temperature 25 DEG C, illumination every day 16h.Hogland nutrient solution is used to carry out cultivating (ph6.5), use 15%PEG4000 process after entering tri-leaf period, result as shown in Figure 4, coerce lower rapid wilting at PEG and dry up by nontransgenic plants, and transgenic line allometry is good, plant part is had still to grow vigorous.After rehydration, WT lines is completely withered, and the part of transgenic line turn yellow in coercing wilt plant rejuvenate.This result show anti-drought gene successful conversion and in upland rice stability and high efficiency express.
2, the anti-salt qualification of transgenosis upland rice
Be placed in NaCl solution after the seed of positive plant after PCR qualification and wild type seeds are disinfected and sprout.Experimental result shows that transfer-gen plant saline-alkaline tolerance is higher than WT lines, sprouts difference comparatively obviously (Fig. 5) when 0.75%NaCl Stress treatment.Process after 5 days, the length of transgenosis upland rice bud and root is all better than non-transgenic upland rice.
3, transgenosis upland rice antiweed qualification
Method cultivates transgenosis upland rice and non-transgenic reference material on 96 orifice plates as previously mentioned.When seedling grew to for three one heart stages of leaf, spray concentration is the weedicide basta of 0.8mg/ml, observes after process 3d, as shown in Figure 6, and non-transgenic reference dead transfer-gen plant then continued growth substantially, the just jaundice of plant entirety and tip segment wilting.As can be seen here, transformation seedlings and non-transformed seedling can effectively be distinguished when herbicide concentration is 0.8mg/ml.Experimental result shows that the transgenosis upland rice of this laboratory culture has obvious resistance to weedicide, and exogenous plasmid successful conversion is also expressed.
In order to detect the field antiweed ability of transgenosis upland rice, by the T of 100 transgenic lines
3in generation, is seeded in land for growing field crops, careless ammonium phosphine is sprayed with 500mg/L concentration when 45 days, discovery is observed after 15 days, the whole withered death of non-transgenic reference, and all transgenic line well-growns (Fig. 7), show foreign gene successful conversion and make transgenosis upland rice have the good resistance to weedicide.
Claims (6)
1. a method of cultivation for the transgenosis upland rice of degeneration-resistant, antiweed, is characterized in that comprising the following steps:
1) degeneration-resistant 8981 gene constructed recombinant expression vector pCAMBIA3301-Ubi-8981 are utilized;
2) recombinant expression vector is transformed into Agrobacterium, and utilizes Agrobacterium bacterium liquid to infect the embryo callus of object upland rice, utilize Dual culture base to cultivate;
3) bacterium taken off to the callus after Dual culture and recover, being transferred in the screening culture medium containing careless ammonium phosphine and screening;
4) resistant calli of screening is broken up and differentiation culture through pre-, the regeneration seedling be differentiated to form is proceeded in root media and cultivates, hardening, transplanting after seedling takes root, obtain transgenosis upland rice that is degeneration-resistant, antiweed.
2. the method for cultivation of the transgenosis upland rice of a kind of degeneration-resistant, antiweed according to claim 1, is characterized in that: 8981 described gene orders are SEQ ID NO.1.
3. the method for cultivation of the transgenosis upland rice of a kind of degeneration-resistant, antiweed according to claim 1, it is characterized in that: the construction process of described recombinant expression vector pCAMBIA3301-Ubi-8981 is: cut Ubi-T carrier with EcoR I and BamH I enzyme, obtain the fragment containing Ubiquitin gene; Cut 8981-T carrier with BamH I and Pml I enzyme, obtain the fragment containing 8981 genes; Fragment containing Ubiquitin and 8981 genes is inserted in the multiple clone site of carrier pCAMBIA3301 successively, obtains described recombinant expression vector.
4. the method for cultivation of the transgenosis upland rice of a kind of degeneration-resistant, antiweed according to claim 3, is characterized in that:
Described Ubi-T carrier is: obtain by Ubiquitin gene is connected pGEM-T vector, described Ubiquitinp gene PCR amplimer is as shown in SEQ ID NO.2 and SEQ ID NO.3;
Described described 8981-T carrier is: 8981 genes are connected pGEM-T vector and obtains, 8981 described gene PCR amplimers are as shown in SEQ ID NO.4 and SEQ IDNO.5.
5. the method for cultivation of the transgenosis upland rice of a kind of degeneration-resistant, antiweed according to claim 1, is characterized in that: described object upland rice is No. 1, enormous legendary fish, which could change into a roc drought.
6. the method for cultivation of the transgenosis upland rice of a kind of degeneration-resistant, antiweed according to claim 1, is characterized in that:
Described Dual culture base is: NB+2,4-D2mg/L+ sucrose 30g/L+ glucose 10g/L+AS20mg/L+ gel 3.2g/L, and culture condition is: pH5.2,25 DEG C of light culture 3 days;
Described callus recovery media is: NB+ Ticarcillin/Clavulanate Acid 500mg/L+ maltose 30g/L+ gel 0.58%, pH6.0, and culture condition is: 28 DEG C of light culture 7 days;
Described screening culture medium is: NB+ maltose 30g/L+ Ticarcillin/Clavulanate Acid 300mg/L+ grass ammonium phosphine 40mg/L+ gel 3.2g/L, pH6.0,28 DEG C of lucifuge screening three-wheels;
Described pre-division culture medium is: NB+NAA1mg/L+6-BA 3mg/L+ABA3mg/L+ maltose 30mg/L+ Ticarcillin/Clavulanate Acid 300mg/L+ grass ammonium phosphine 40mg/L+ gel 3.2g/L, pH6.0;
Described division culture medium is: NB+6-BA1mg/L+NAA1mg/L+ maltose 30g/L+ plant gel 3.2g/L, pH5.8;
Described root media is: 1/2MS+ sucrose 30g/L+NAA0.5mg/L+ plant gel 1.6g/L, pH5.8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510140056.1A CN104726488A (en) | 2015-03-29 | 2015-03-29 | Method for culturing stress-resistance herbicide-resistance transgenic aerobic rice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510140056.1A CN104726488A (en) | 2015-03-29 | 2015-03-29 | Method for culturing stress-resistance herbicide-resistance transgenic aerobic rice |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104726488A true CN104726488A (en) | 2015-06-24 |
Family
ID=53450901
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510140056.1A Pending CN104726488A (en) | 2015-03-29 | 2015-03-29 | Method for culturing stress-resistance herbicide-resistance transgenic aerobic rice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104726488A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109182369A (en) * | 2018-08-03 | 2019-01-11 | 浙江大学 | A kind of more antiweed expression vectors, transformant and its application |
| CN111893135A (en) * | 2020-08-14 | 2020-11-06 | 河北科技大学 | Transgenic expression vector and application thereof |
| CN112175991A (en) * | 2020-10-27 | 2021-01-05 | 武汉天问生物科技有限公司 | Genetic transformation method of creeping glumes |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102532287A (en) * | 2010-12-13 | 2012-07-04 | 首都师范大学 | Stress-resistant protein PpLEA3-17 of bryophyte as well as encoding gene and application thereof |
| CN102584965A (en) * | 2011-01-10 | 2012-07-18 | 首都师范大学 | Bryophyte reversal-resistant protein PpLEA3-20 and encoding gene and application thereof |
-
2015
- 2015-03-29 CN CN201510140056.1A patent/CN104726488A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102532287A (en) * | 2010-12-13 | 2012-07-04 | 首都师范大学 | Stress-resistant protein PpLEA3-17 of bryophyte as well as encoding gene and application thereof |
| CN102584965A (en) * | 2011-01-10 | 2012-07-18 | 首都师范大学 | Bryophyte reversal-resistant protein PpLEA3-20 and encoding gene and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 李朝炜 等: "农杆菌介导的旱稻遗传转化主要影响因素", 《湖北农业科学》 * |
| 耿旭珂 等: "植物基因打靶-模式植物小立碗藓的应用", 《生物学通报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109182369A (en) * | 2018-08-03 | 2019-01-11 | 浙江大学 | A kind of more antiweed expression vectors, transformant and its application |
| CN109182369B (en) * | 2018-08-03 | 2021-01-12 | 浙江大学 | Multi-herbicide-resistant expression vector, transformant and application thereof |
| CN111893135A (en) * | 2020-08-14 | 2020-11-06 | 河北科技大学 | Transgenic expression vector and application thereof |
| CN112175991A (en) * | 2020-10-27 | 2021-01-05 | 武汉天问生物科技有限公司 | Genetic transformation method of creeping glumes |
| CN112175991B (en) * | 2020-10-27 | 2023-05-02 | 武汉天问生物科技有限公司 | Genetic transformation method for creeping cut-off glume |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101457235B (en) | Method for converting lucerne by vacuum penetrating aided agrobacterium-mediation | |
| CN100355897C (en) | Method for promoting salt and drought tolerance of maize and wheat by combining betA,NHX1,PPase gene and transgene technology | |
| CN109456982B (en) | Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance | |
| CN103205459A (en) | Agrobacterium-mediated sugarcane genetic transformation method with vacuum infiltration assistance | |
| CN104004781A (en) | Preparation method of glyphosate resistant transgenic rice | |
| CN102732526B (en) | Application of OsSRO1c gene in controlling rice drought resistance | |
| CN101643745B (en) | Thellungiella V-pyrophosphatase gene (TsVPI) promoter sequence and application of deletion mutant thereof | |
| CN105294847A (en) | Stress tolerance-related protein of plants and encoding gene and application of stress tolerance-related protein | |
| CN105349551B (en) | A kind of corn mZmDEP gene and its application of expression inhibiting structure in corn breeding for stress tolerance | |
| CN104726488A (en) | Method for culturing stress-resistance herbicide-resistance transgenic aerobic rice | |
| CN101698854A (en) | Application of transcription thellungiella halophila CBF1 gene in improving drought resistance and salt tolerance of corn and wheat | |
| CN107406844A (en) | The transgenic rice plant of improvement | |
| CN102337295A (en) | Agrobacterium-mediated melon seedling apex transformation method | |
| CN1768575A (en) | Method for improving beet salt-resistance, draught-resistance and anti-herbicide chlorsulfuron characteristics by multi-gene transformation and application | |
| CN103497958B (en) | Rice Os Xrn4 gene and application thereof | |
| CN100413965C (en) | Phosphorus starvation induced gene promoter and its application | |
| CN103145816B (en) | Application of protein elicitor Hripl for improving and perfecting salt tolerance and drought resistance of plants | |
| CN1307312C (en) | Tetraploid transgenic locust and quick cultivation | |
| CN104844702A (en) | Plant stress tolerance related protein GmSTOP1 and application of encoding gene thereof | |
| CN101864430B (en) | Wheat introgression family gene Tamyb31 for resisting abiotic stress and application thereof | |
| CN105802976B (en) | Gene for regulating and controlling drought and saline-alkali tolerance of rice and application thereof | |
| CN102492719B (en) | Method for preparing broad-spectrum plant virus-resistant transgenic plant and application | |
| CN102329817B (en) | Agrobacterium-mediated method for culturing transgenic populus wutunensis plants | |
| CN103820491A (en) | Application of maize northern leaf blight STK1 gene in plant salt resistance | |
| CN110205328B (en) | Plant stress resistance related gene TcAE and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150624 |