CN105349551B - A kind of corn mZmDEP gene and its application of expression inhibiting structure in corn breeding for stress tolerance - Google Patents
A kind of corn mZmDEP gene and its application of expression inhibiting structure in corn breeding for stress tolerance Download PDFInfo
- Publication number
- CN105349551B CN105349551B CN201510916723.0A CN201510916723A CN105349551B CN 105349551 B CN105349551 B CN 105349551B CN 201510916723 A CN201510916723 A CN 201510916723A CN 105349551 B CN105349551 B CN 105349551B
- Authority
- CN
- China
- Prior art keywords
- gene
- corn
- plant
- mzmdep
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention discloses a kind of corn mZmDEP gene and its application of expression inhibiting structure in corn breeding for stress tolerance, wherein the nucleotide sequence of the corn mZmDEP gene is as shown in SEQ ID No.1；The amino acid sequence that it is encoded is as shown in SEQ ID No.2；The expression inhibiting structure of the corn mZmDEP gene refer to nucleotide sequence shown in SEQ ID No.1 antisense expression structure and SEQ ID No.1 shown in nucleotide sequence RNAi structure, wherein the RNAi structure is that segment in preceding 628 nucleotide regions by SEQ ID No.1 is built-up；The degeneration-resistant drought tolerance and salt tolerance for referring to corn of the corn.It is experimentally confirmed that showing to significantly improve drought resistance and salt tolerance using the transgenic line that the present invention obtains, plant is improved to the adaptability of environment and corn yield under the conditions of conventional cultivation, there is good application value in corn breeding.
Description
Technical field
The invention belongs to crop bioengineering breeding fields, specifically, are related to a kind of corn mZmDEP gene and its expression suppression
Application of the structure processed in corn breeding for stress tolerance.
Background technique
DEP1 (dense erect panicle 1) gene is that Fu Xiangdong etc. reports (Fu Xiangdong, Huang first in rice
Liu Zhengbin before Xiang Zhongqian, 2008.06.05, vertical compact panicle gene and its application, application number 200810111529.5, Granted publication
Number 101597610 B of CN), it is related to the vertical compact panicle of rice, it is named as to Dep1.Patent in 2008 is the gene in rice
The application of vertical compact panicle plant type transformation aspect, the rice vertical compact panicle gene sequence and its amino acid of patent requirements protection mutation
Sequence, and other nucleotide sequences and its complementary series with coding phase homopolypeptide；The patent, which is also claimed, utilizes this
Sequence construct expression vectors and method and these polynucleotide sequences and its construct and load for producing genetically modified plants a bit
Body is improving crop plants lodging tolerance, spike number and grain number per spike, photosynthetic efficiency or is improving crop plants productive phase population growth
Purposes in rate or Dry-matter production, wherein the plant is rice.Later, Fu Xiangdong etc. is by qtl analysis, in rice
A nitrogen is detected between Chromosome 9 SSR marker RM3700 and RM7048 and efficiently utilizes relevant main effect QTL, by it
It is named as qNGR9 (a QTL for nitrogen growth responses in chromosome9).Utilize map based cloning
Method, they are by candidate NGR9 gene finely positioning in the section of 14kb.By the way that comparative analysis is sequenced, it is determined that NGR9 is waited
Select gene be known rice high yield gene DEP1,2011 they by result of study application China and the U.S. patent.It should
Patent is the gene in the fertilizer utilization efficiency for improving crops (rice) and photosynthetic efficiency, reduces crops (rice) strain
(Fu is to Wu elder brother money toe-out at big Liu Xueying king's bolt-lock, 2011.01.27, vertical compact panicle for application in terms of height enhancing lodging resistance
Gene improves the new opplication of fertilizer utilization efficiency, application number 201110029759.9,102174527 B of Authorization Notice No. CN).
Claim is that " application of vertical compact panicle gene is used to improve the fertilizer utilization efficiency of crops, improves photosynthesis effect
Rate, reducing crops plant height enhances lodging resistance, and the application is generated by the way that vertical compact panicle gene to be transferred in the crops
Transgenic crop and realize ".In the description, inventor reports the pUbi:dep1 carrier maize transformation of building, obtains
It is overexpressed the corn of dep1 gene.The corn for being overexpressed dep1 gene similarly shows half Dwarfing phenotypes, and leaf color becomes
For bottle green, photosynthetic efficiency improves 25.6% than control corn, and leaf angle becomes smaller, and proposes that vertical compact panicle gene can be used to mention
The planting density and increase Canopy Apparent Photosynthesis of high corn, and then improve yield.In corn, Fu Xiangdong etc. has cloned 2 water
The homologous gene of rice DEP1 gene, that is, corn ZmDEP1-1 and ZmDEP1-2.ZmDEP1-1 is with the similitude of rice DEP1
52.60%, the similitude with rice dep1 only has 37.74%；ZmDEP1-2 is 36.07% with the similitude of rice DEP1, together
The similitude of rice dep1 only has 31.13%.
Phylogenetic analysis obtains, include in the group where the DEP1 of rice 1 paddy gene (Os09T0441900-01,
That is DEP1 gene), 3 corn genes (GRMZM2G001660, GRMZM2G172320 and GRMZM2G028726), 3 wheat-baseds
Cause and 2 sorghum genes.Most similar arabidopsis gene is AT5G20635 AGG3 (ARABIDOPSIS G PROTEIN therewith
GAMMA SUBUNIT 3), an atypical Heterotrimeric G-Protein γ subunit is encoded, the latter participates in guard cell K+Channel tune
Section and morphological development, and Abscisic Acid stimulation is responded, certain effect may have been played in plant stress-resistance mechanism.
According to amino acid sequence, rice DEP1 and corn GRMZM2G001660 T01 (corresponding to ZmDEP1-1) and GRMZM2G172320
The similitude highest of T01 (corresponding to ZmDEP1-2) is high secondly with the similitude of GRMZM2G028726 T02.
GRMZM2G001660 is located on No. 2 chromosomes of corn, and GRMZM2G172320 is located on No. 7 chromosomes of corn,
GRMZM2G028726 is located on No. 1 chromosome of corn.The function of this 3 genes is still unclear at present.
Li Jiansheng in 2014 etc. report based on ZmDEP1 gene kernel traits in maize association analysis (white light is red, Li Lin,
Yang little Hong, Li Qing, Wu Penghao, Li Jiansheng Xinjiang Agricultural Univ journal, 2014,37 (5): 356~361), they pass through homologous gram
Grand method has cloned the homologous gene ZmDEP1 with rice grain yield related gene OsDEP1 from corn, while finding should
Gene two QTL relevant to niblet weight (q300k20 and qgrwt6 are located at 7.02Bin) common location, thus it is speculated that be possible
Candidate gene relevant to corn yield.Using association, group has carried out candidate gene association analysis to the gene, finds the base
Because a SNP site S182 of 3 ' UTR is related to grain weight and seed volume in both environments, thus it is speculated that may be an influence
The functional site of niblet weight, volume.But in the document of retrieval, about corn mZmDEP gene and its expression inhibiting structure
The application of (antisense construct of mZmDEP and its RNAi structure) in corn breeding for stress tolerance has not been reported.
Summary of the invention
For current present Research, the present invention provides a kind of corn mZmDEP gene and its expression inhibiting structure in corn
Application in breeding for stress tolerance.
Corn mZmDEP gene of the present invention and its application of expression inhibiting structure in corn breeding for stress tolerance:
Wherein, the nucleotide sequence of the corn mZmDEP gene is as shown in SEQ ID No.1；Its amino acid sequence encoded
Column are as shown in SEQ ID No.2；The expression inhibiting structure of the corn mZmDEP gene refers to nucleotide shown in SEQ ID No.1
The RNAi structure of nucleotide sequence shown in the antisense expression structure and SEQ ID No.1 of sequence, wherein the RNAi structure be by
Segment in preceding 628 nucleotide regions of SEQ ID No.1 is built-up；The degeneration-resistant drought tolerance for referring to corn of the corn and
Salt tolerance.
Corn mZmDEP gene of the present invention and its expression inhibiting structure are applied substantially square in corn breeding for stress tolerance
Method is: in the plant expression vector respectively be inserted into mZmDEP gene overexpression structure, mZmDEP gene antisense expression structure,
They are directed respectively into maize cell and regeneration plant using transgenic technology, filtered out from its offspring by ZmDEP RNAi structure
The corn variety of drought tolerance and salt tolerance is provided in resistance and high-yielding transgenic corns strain, initiative.
Specifically, corn mZmDEP gene of the present invention and its application of expression inhibiting structure in corn breeding for stress tolerance
Method includes:
The Cloning and sequence analysis of corn mZmDEP gene
Big seed plant of the plant type without significant change is had found from corn inbred line DH4866 group.With its selfing
The seed of 16 days fruit ears of pollination of offspring separates total serum IgE, and reverse transcription generates cDNA.With known relevant to plant seed and yield
Gene order is reference, designs multipair PCR primer for clone gene.Then pcr amplification reaction is carried out by template of cDNA,
In the combination of the 5 ' GCGATATCTCAGCACAAGCAT of GCGATATCATGGGGGAGGAGGTGGC 3 ' and 5 ' CCGG 3 ' of primer,
Amplify the band of about 1200bp (its nucleotide sequence is as shown in SEQ ID No.1).T-easey is arrived in recombination after the latter is recycled
It is sequenced in carrier.It analyzes sequencing result to obtain, institute's clone gene and 442907 keratin- of Zea mays clone
Associated protein 5-4 mRNA is homologous, but has notable difference in sequence.Institute's cloned sequence is translated into polypeptide, peptide
Chain length is significantly less than keratin-associated protein 5-4's.With gene order detection Maize genome sequencing
Data show that the gene may be a mutated gene of GRMZM2G172320.Homologous gene retrieval discovery, in arabidopsis
AT5G20635/AGG3 gene is its homologous gene, and the latter serves in degeneration-resistant mechanism to be had, thus it is speculated that institute's clone gene may also
Participate in response of the corn to adverse circumstance.In patent retrieval, corn ZmDEP1-1 and the ZmDEP1-2 base of the reports such as discovery Fu Xiangdong
Because and the DNA homolog, it is but big with institute clone gene difference in sequence, therefore be mZmDEP gene by the unnamed gene.
Plant expression vector construction
The cDNA sequence of corn mZmDEP gene is recombinated to plant table using fixed point recombination or in vitro digestion recombinant technique
Up in carrier, plant expression structure is formed, with constitutive promoter such as corn Ubiqintin gene promoter or stress induced
The promoter of promoter such as RD29B gene starts, with rouge alkali synthetase gene Tnos sequence in Ti-plasmids or rice GluB5 egg
White TgluB5 sequence ends transcription.MZmDEP gene can just form or anti-sense versions be inserted in gene expression frame.Inhibiting
In expression structure building, mZmDEP genetic fragment is inserted into the plant by transformation based on plasmid pFGC5941 and is expressed
(area carrier T-DNA is inserted into fusion PCaMV35S::mbar-Tnos, and wherein PCaMV35S is Cauliflower Mosaic in carrier
Viral 35S RNA promoter, the glufosinate-resistant Bar gene with the password subsubstitution of corn bias), generate interference ZmDEP base
The RNAi structure ZmDEPRNAi of cause.The two-arm of RNAi structure is that the mZmDEP genetic fragment of complementary equal length (is read open
In the segment of the preceding 631bp of code frame, the segment of 150~628bp long can be chosen).MZmDEP fusion and ZmDEPRNAi structure
It recombinates in plant expression vector and is converted for maize genetic respectively, such as recombination be for Agrobacterium into Mini-Ti plasmid
The maize genetic of Jie converts.
Maize genetic conversion
Different transgenic methods is selected to obtain genetically modified plants according to the characteristics of transgenic acceptor.The present invention uses
The hereditaryization method and particle bombardment of mediated by agriculture bacillus carry out maize genetic conversion.
Using corn inbred line rataria or embryo callus in the genetic transformation of material, to take after pollination self 9~15 days
Corn inbred line fruit ear, peels off bract, is placed in 70% alcohol and impregnates 5min, picking about 1.0~1.5mm size under aseptic condition
Rataria be inoculated in induced medium, Fiber differentiation 2~3 days, the acceptor material as genetic transformation；Or the rataria from cultivation
Induced embryonic callus obtains crisp, flaxen II type callus after that is, IMMATURE EMBRYOS CULTURE 4-6 weeks, and every 10-15 days later
Squamous subculture is primary.II type callus can be used as the acceptor material of genetic transformation.
Particle gun bullet is prepared using conventional method.The bronze for weighing 1.0 μm of sizes is stood after 70% ethanol washing
15 minutes, centrifugation removal supernatant；It is thoroughly cleaned 3 times, is then suspended with 50% sterile glycerol (final concentration of with sterile water again
The micro- bullet of 60mg/ml) storage it is spare.Be vortexed 5 minutes when use break bronze agglutination, sequentially add 5 μ l Plasmid DNA (1 μ g/ μ l),
50μl 12.5M CaCl2, 20 μ l 0.1M spermidines, while sample-adding while vortex.1 minute is stood after vortex 2~3 minutes.Centrifugation is abandoned
After supernatant, 70% ethyl alcohol is added to stand.It is then centrifuged for abandoning supernatant, then is resuspended with dehydrated alcohol, sampling is added on micro- missile-borne body.
Micro- bullet dosage is every bullet 0.5mg.
The culture medium of 0.4cm thickness is poured into the culture dish of diameter 9cm, and callus high density is then put into culture dish
In, every ware bombardment is primary.Bombardment parameters take: can split disk at a distance from carrier is 2.5cm, and carrier is at a distance from blocking net
0.8cm, 6~9cm of micro- bullet flying distance.Other parameters press operation instructions value.Material darkling renewal cultivation 3 after bombardment
Material, is then transferred in the new culture medium of components unchanged and cultivates 3 weeks, give full expression to the target gene being transferred to by it.Again by material
Material be transferred to added with selective agent (such as 0.08% herbicide glufosinate (Hoechst Schering AgrEvo GmbH, contains
Have herbicide glufosinate ammonium) culture medium on screened.Step sizing three generations, 15 days per generations.When subculture
Eliminate the tissue block of browning death.Resistant calli by screening is transferred on the culture medium for be not added selective agent small in illumination 16
When/1 generation of world renewal cultivation after, be transferred on differential medium and break up seedling.The seedling that callus generates is in root media
In take root, move into flowerpot after strong sprout, it is long to about 10cm high when plant to big Tanaka, self-fertility.
Maize bud point is being carried out in genetic transformation using agrobacterium-mediated transformation, the seed of maize elite inbred line is first used
70% ethyl alcohol, which shakes, to be impregnated 8 minutes, then is shaken and impregnated 8~12 minutes with 0.1% mercury chloride, then with sterile water washing 3~5
Time.Seed is placed in sterile triangular flask and sprouts after sterilizing, is put into a small amount of sterile water 1-2 under dark condition (25~28 DEG C) in bottle
It.After Seed sprouting (showing money or valuables one carries unintentionally), places it in modified MS medium and sprouted under dark condition.Stop 3~4 to plumule elongation
Centimetre when, remove plumule and 2~3 spires, emergent stem pointed tip growth cone.With carrying with double base in logarithmic growth phase
Body (Mini-Ti plasmid have herbicide resistance gene bar and mZmDEP mutant gene sequence fusion, including justice or
Antisense gene or ZmDEPRNAi structure) agrobacterium tumefaciens (AGL1 or LBA4404) infection.Bacterium solution at 3000r/min from
The heart 10 minutes, abandon supernatant；Thallus is washed with 1/2MS fluid nutrient medium, is collected by centrifugation.Again by thallus 100 μm of ol/l of addition
The 1/2MS fluid nutrient medium of acetosyringone suspends, and is diluted to OD6000.2~0.4,0.5 × 105It is carried out under Pa atmospheric pressure beautiful
Rice conversion.Bud point after dip dyeing is blotted with aseptic filter paper, and then germination seed is placed in modified MS medium and is trained in dark
It supports 2~3 days (cultivation temperature is 22-24 DEG C), then cultivates 2 days under diffuse light, then aseptic seedling is transplanted to and is covered with upper layer leech
In the flowerpot of stone lower layer loam, and at the top of vermiculite covering plant.Plant grows under natural lighting, and 22~28 DEG C of day temperature, night
Warm 15-21 DEG C, 1/2 modified MS medium inorganic salts are poured every other day.After transformed plant grows 3 leaves, herbicide is sprayed
Aqueous solution, concentration are 9.6ml -10.8mlFalling drop with plant is advisable.Unconverted adjoining tree is generally being sprayed
It stops growing, starts after 7 days dead after 4 days afterwards.After spraying, some individual variations are similar with adjoining tree, separately for transformed plant
Some individual continued propagations, change unobvious.When the plant that survives grows to 5 leaf, it is colonized to field, artificial autocopulation's pollination.
Herbicide screening is continued for plant to T1, resistant plant carries out PCR detection.
The identification of transformed plant
Herbicid resistant seedling leaf DNA is extracted to detect for PCR.According to riddled basins bar and target gene
Primers carry out PCR detection respectively.Bar gene and mZmDEP gene are amplified respectively from transgenic plant
Band.Primer sequence is that transgenosis is special, in transgenic plant the size of pcr amplified fragment respectively with carry these plasmids
The amplified band (positive control) of (carrying target gene) is consistent, and the adjoining tree (negative control) of non-transgenosis does not occur
The purpose band of same size.PCR detection is continued for plant to T2.In some T2 in strain, foreign gene segregation ratio
Meet Mendelian inheritance ratio, is primarily determined the strain for stablizing heredity for transgenosis.Selected transgenic line is carried out
Southern bloting identification and RT-PCR detection.The site for determining transgenosis insertion is identified by Southern bloting
Number primarily determines the expression intensity of transgenosis according to RT-PCR result, selects the insertion of transgenosis list copy and expression intensity higher
Strain carry out subsequent detection.
The transgenic corn plant obtained using particle bombardment, general transgenosis are integrated into corn in the form of multicopy
Genome, offspring is also easy to produce gene silencing phenomenon.In order to obtain the transgenic plant of single copy insertion, by the plant of the PCR positive
Strain is returned with receptor self-mating system, and the plant of transgenosis list copy insertion is selected from backcross progeny.After the latter is selfed homozygosis
For Resistance detecting and yield assessment.
The drought resistance of transgenic plant detects
It is control with receptor self-mating system plant, selects the transgenic homozygous strain from different independent transformants to carry out degeneration-resistant
Property measurement.
Under normal growing conditions, corn turns mZmDEP gene plant, turns ZmDEPRNAi structure plant and receptor self-mating system
Plant slightly has difference in 3 leaf phase phenotypes, and transgenic plant is bigger than normal compared with receptor self-mating system.Biomass analysis obtains, just
Under the conditions of being frequently grown, 3 leaf phase transgenic plant overground parts are more bigger than receptor self-mating system plant, but underground part difference is unobvious.
The transgenic plant of 3 leaf phases and receptor self-mating system seedling are subjected to the lethal experiment of arid simultaneously, after 6 days Stress treatments, by
The small seedling leaf of body self-mating system is seriously wilted, and close to withered, basal part of stem softening, most plant are dead after restoring watering；Cross table
Up to mZmDEP gene seedling, turn mZmDEP antisense gene seedling and turn ZmDEPRNAi structure seedling drought resistance to significantly improve, though
Right drought resisting degree difference due to strain difference is obvious, but the drought resistance of most strains is apparently higher than receptor self-mating system.The arid side of body
Restore watering after compeling, most transgenic lines can comparatively fast restore normal growth.
The influence that drought stress grows transgenic corn plant before blooming for assessment starts in plant length to the 10 leaf phase
Soil moisture content is controlled, maintains soil relative water content in 50%-55% or so, makes plant by drought stress.After processing 8 days
Restore normal watering, plant starts to take out after a week male.Observe stress during drought stress transgenic plant and non-transgenosis pair
According to the character mutation of plant, and respectively, materials measure every physical signs.Under normal growing conditions, turn mZmDEP gene respectively
The strains of justice or anti-sense versions turn the strain of ZmDEPRNAi structure, plant above ground morphological feature and growth and development rate with
Receptor self-mating system is unobvious compared to difference.After by drought stress, more early there is water shortage symptom in receptor self-mating system plant, even
After 5 days, blade turns yellow, is withered continuous arid, and turns the strain of ZmDEP gene justice or anti-sense versions respectively or turn ZmDEPRNAi
The strain of structure, the blade wilting mild degree of plant, leaf color is more emerald green, and some of them turn the strain table of ZmDEPRNAi structure
Now very well.Under normal growing conditions, the mda content and cell membrane Ion leakage of transgenic line and receptor self-mating system without
Significant difference.With the extension of drought stress time, mda content and cell membrane Ion leakage rate are significantly raised, transfer
The elevation amplitude of mZmDEP gene strain is smaller, secondly to turn ZmDEPRNAi structure strain, again to turn mZmDEP antisense
The strain of gene.Stress turned the strain of mZmDEP gene or RNAi structure, their mda content and cell membrane after 8 days
Ion leakage rate is substantially less than receptor self-mating system.After restoring watering 7 days, compared with compareing self-mating system, turn mZmDEP base
Because of strain and turn the mda content of ZmDEPRNAi structure and Ion leakage rate still keeps reduced levels, i.e. cell damage is light.
In order to study drought stress to the photosynthetic influence of plant, transgenic corns strain and receptor are determined certainly
It hands over and ties up to Net Photosynthetic Rate under the conditions of normal growing conditions, drought stress conditions and rehydration, stomatal conductance.Normally watering
Under the conditions of, turn the strain of mZmDEP justice gene, turn the strain of mZmDEP antisense gene, or turns the strain of ZmDEP RNAi structure
System, plant Net Photosynthetic Rate are slightly above receptor self-mating system plant.Drought stress processing in, with stress time extension not
It is gradually increased with the difference between corn strain.In entire stress during drought stress, compared to receptor self-mating system, turn respectively
The strain of mZmDEP justice or antisense gene or ZmDEPRNAi structure, the Decrease in Net Photosynthetic Rate of plant are more slow.Such as dry
At drought stress 6 days, turn 51.9% the or so when Net Photosynthetic Rate of mZmDEP justice gene strain is reduced to Stress treatment 0 day,
Be significantly higher than receptor self-mating system (for 0 day 41.3%).In stress during drought stress, the variation tendency of stomatal conductance is the same as net light
Rate is closed, turns the strain of mZmDEP justice or antisense gene, ZmDEPRNAi structure respectively, the stomatal conductance of plant is significantly high
In receptor self-mating system.Stomatal conductance decline leads to CO2Supply is reduced, this is considered as in stress during drought stress under photosynthesis
One important limiting factor of drop.In addition, the Net Photosynthetic Rate and stomata of all strains lead angle value all after restoring watering 7 days
It increased, in the strain for turning mZmDEP justice or antisense gene or ZmDEPRNAi structure respectively, there is the net of some strains
Photosynthetic rate and stomata lead angle value and are all higher than receptor self-mating system.Under drought stress after stronger photosynthetic capacity and rehydration faster
Regeneration rate shows the strain for turning mZmDEP justice or antisense gene or ZmDEPRNAi structure respectively, and plant drought-resistant ability obtains
To significantly improving.
In drought tests rain-proof shelter, continuous 6 weeks drought stresses are carried out to plant before blooming, then restore normal
Watering, observe during this period transgenic plant with compare character mutation of the self-mating system plant under drought stress, unite after harvest
Count single plant yield and cell production.The result shows that turning the strain of mZmDEP justice or antisense gene or ZmDEPRNAi structure respectively
System, the growth and development of plant is impacted smaller, and grain yield is high.
The salt tolerance of transgenic plant detects
In salt tolerance detection, dry seed is sowed in sand basin of the same size (diameter 10cm, high 15cm), respectively
The aqueous solution for pouring NaCl containing various concentration (0,100mM, 150mM, 200mM), it is constant to pour NaCl concentration after 2 leaf phases respectively
1/2MS culture medium inorganic salt solution.Each every concentration of strain broadcasts 30 seeds, i.e., 6, basin every, 5 repetitions.Between each basin of irrigation amount
It is consistent, observes the uniformity of seed sprouting situation and seedling daily, and avoid drenching with rain.Distinguish at 15 days, 25 days and 35 days
Statistics seeding ratio (1 leaflet exposes sand and thinks to emerge), 3 leaf phase survival rates and 5 leaf phase survival rates.Salt stress processing
In the process, the physical signs of measurement processing plant and untreated (pour and NaCl is not added in liquid filling, is i.e. 0 concentration NaCl processing) plant,
Including photosynthetic parameters, ion concentration, RWC, chlorophyll content, cytosol gesture, soluble sugar and proline content, cell
Film Ion leakage, mda content and biomass.Measurement result shows to turn the strain of mZmDEP justice gene respectively, turn
The strain of mZmDEP antisense gene, the strain for turning ZmDEPRNAi structure, their seed germination rate under condition of salt stress are significant
Higher than wild type, seedling growth is preferable.Part of strain germination rate under the processing of 150mM NaCl concentration is 95% or so,
About 2.5 times of receptor self-mating system, seedling injury is lighter.If carrying out salt stress processing to 5 leaf phase seedlings, NaCl concentration is with daily
50mM is incremented to final concentration 200mM, then pours once daily, salinity is constant.After salt stress is handled 15 days, transgenic plant
Growing way is substantially better than adjoining tree, and the seedling of receptor self-mating system is in damaged condition serious, and about half is dead.
The variation for measuring the physiological parameter of different strain seedlings under condition of salt stress, obtain no matter transgenic plant or by
Body self-mating system plant, the Na in blade and root+Content is all significantly raised, K+Content is first slightly increased and is then reduced.It is selfed with receptor
It is that plant is compared, transgenic plant Na+Incrementss are few, K+Reduction amplitude is small, the Na of part strain+、K+Content and receptor self-mating system
Compared to significant difference, and K+/Na+Ratio is also significantly greater than receptor self-mating system plant.Under condition of salt stress, all strains
Chlorophyll content be first have by a small margin increase then declined with different rates, but turn respectively mZmDEP justice and antisense gene
Strain or turn the strain of ZmDEPRNAi structure, the chlorophyll content of plant is significantly higher than receptor self-mating system in the process phase later period
Plant.Photosynthetic rate, stomatal conductance, intercellular CO2The measurement result of II Photochemical Efficiency of concentration and PS is shown, when longer
Between under NaCl Stress treatment, it is since stomatal conductance reduces and II complex of PS activity is suppressed common that photosynthetic rate, which is greatly lowered,
Caused by.But in salt stress processing, turns the strain of mZmDEP justice or antisense gene respectively or turn ZmDEPRNAi structure
Strain, plant shows significantly higher photosynthetic rate, stomatal conductance and maximal photochemistry efficiency (Fv/Fm), i.e., in salt stress
More carbohydrate can be synthesized in processing.
Under condition of salt stress, leaf cell solute potential is gradually decreased with the increase of stress time, but partial transgenic strain
The solute potential of system is substantially less than receptor self-mating system plant, the i.e. ability with stronger water conservation and absorption moisture.Certainly with receptor
Friendship is that plant is compared, turn respectively mZmDEP justice or antisense gene or ZmDEPRNAi structure strain, plant leaf contain compared with
More soluble sugars and proline.These results indicate that under condition of salt stress transgenic line have accumulated into the cell it is more
Solable matter (including Na+With proline and soluble sugar etc.), so that cell is maintained lower solute potential, it is normal to be conducive to cell
The growth of metabolism and photosynthesis and plant.Under condition of salt stress, turn respectively mZmDEP justice or antisense gene strain,
Or the strain of ZmDEPRNAi structure, plant show lower MDA level and Ion leakage rate, show damaged membrane degree
Less than adjoining tree, this has higher II activity of PS consistent with transgenic plant.
It is shown in the transgenic line of beach saline land plantation and the test result of receptor self-mating system, it is some to turn mZmDEP just
The strain of justice or antisense gene or ZmDEPRNAi structure, survival and growth and development in salt-soda soil are substantially better than receptor selfing
System, single plant plant greenery number is higher than receptor self-mating system, and economic characters such as yield per plant and yield etc. are significantly better than receptor self-mating system,
Show the salt tolerance significantly improved.
Difference under the conditions of comprehensive arid and high-salt stress in the physical signs and yield of different strain plant, obtains and turns
MZmDEP justice or antisense gene or the strain for turning ZmDEPRNAi structure, when plant encounters stress, cytosol content increases
Amplitude is larger, reduces the loss of cell moisture, and cell membrane damage is small, and photosynthetic capacity is stronger, and the growth and development of plant is impacted
It is smaller, therefore grain yield is high, shows the drought resistance being obviously improved and salt tolerance, it can be more compared with receptor self-mating system plant
Adapt to stressful environmental well.
The beneficial effects of the present invention are: the present invention provides a kind of corn mZmDEP genes and its expression inhibiting structure
The application of (the antisense expression structure of mZmDEP and its RNAi structure) in corn breeding for stress tolerance.Though not knowing that mZmDEP gene exists
Effect in corn, gene disclosed by the invention with higher plant constitutive promoter (cauliflower mosaic virus
CAMV35SRNA gene promoter P35S or corn Ubiquitin1 gene promoter Pubi) fusion after, respectively just with mZmDEP
The form of justice and antisense gene form or ZmDEPRNAi structure is transferred to corn, and transgenic line shows the drought resisting significantly improved
Property and salt tolerance, improve plant to the adaptability of environment, the grain yield of corn can be improved under the conditions of conventional cultivation,
There is good application value in corn breeding.
Specific embodiment
Embodiment 1: it is overexpressed corn mZmDEP gene and creates drought-resistant maize self-mating system
1) recombination is arrived entry vector pENTR11's using fixed point recombinant technique by the building of mZmDEP gene overexpression carrier
The cDNA sequence of corn mZmDEP gene is recombinated to plant expression vector pB7WG2.0-P35S::bar-Tnos-Pubi::MCS-
In Tnos, plant conversion carrier pB7WG2.0-P35S::bar-Tnos-Pubi::mZmDEP-Tnos is generated.It will using freeze-thaw method
The latter imports in agrobacterium tumefaciens LBA4404, and is identified using PCR method.
2) foundation of receptor system is using Inbred Lines used in China's agricultural production as material, as Zheng 58, prosperous 7-2,
The selfed seed of 6WC etc..In vitro culture induction stem apex generates the sprout tuber that grows thickly, and carries out genetic transformation as receptor to grow thickly sprout tuber.Institute
Have with culture medium:
A culture medium: it is sprouted for seed, including KNO31900mg/l, NH4NO31650mg/l, CaCl2·2 H2O
440mg/l, MgSO4·7H2O 370mg/l, KH2PO4·H2O 170mg/l, FeSO4·7H2O 27.8mg/l, ZnSO4·7H2O
10mg/l, MnSO4·4H2O 22.3mg/l, H3BO310mg/l, KI 0.83mg/l, Na2MoO4·2H2O 0.5mg/l,
CuSO4·5H2O 0.025mg/l, CoCl2·6H2O 0.025mg/l, thiamine hydrochloride 20.0mg/l, puridoxine hydrochloride
1.0mg/l, niacin 1.0mg/l, inositol 100.0mg/l, sucrose 20g/l, agar powder 7g/l, pH 5.8~6.0.
B culture medium: A culture medium additional bio element 0.05mg/l, casein hydrolysate 500mg/l, proline 200mg/l,
Sucrose 10g/l, 6-BA 4.5~9.0 μm of ol/l and 2,4-1.0~3.0 μm of D ol/l, for inducing in vitro culture bud point to generate
Multiple Buds tissue block and Multiple Buds tissue block squamous subculture.Fluid nutrient medium then removes agar powder.
C culture medium: A culture medium additional bio element 0.05mg/l, casein hydrolysate 500mg/l, proline 200mg/l sugarcane
Sugared 10g/l, 6-BA 1.8 μm of ol/l of 4.5 μm of ol/l and IBA (indolebutyric acid) break up seedling for Multiple Buds tissue block.
D culture medium: A culture medium adds casein hydrolysate 200mg/l, 2.25~4.5 μm of ol/l of sucrose 10g/l, 6-BA
With 3.6~4.5 μm of ol/l of IBA, for growing thickly, budlet develops into seedling.
E culture medium: A culture medium adds 2.8~5.6 μm of ol/l of IBA, is used for the small seedling rooting of unrooted.
Culture medium and plant growth regulating substance pressure sterilizing；Antibiotic and herbicide isoreactivity ingredient filtration sterilization,
It is added after medium sterilization.
Seed sterilization and sprouting: corn seed is impregnated 8 minutes with 70% ethyl alcohol, then impregnates 10~15 with 0.1% mercury chloride
Minute, then with sterile water washing 3~5 times.Seed is placed in sterile triangular flask and sprouts after sterilizing, is put into bottle a small amount of sterile
Water is placed under dark condition (23~28 DEG C) 1--2 days after sealing.Seed afterwards of sprouting and (show money or valuables one carries unintentionally) is placed on A culture medium in dark item
Continue to sprout under part.
Shoot Tip Culture and the induction of Multiple Buds tissue block, subculture, differentiation: when the plumule elongation of germination seed stops 3~5 centimetres,
Plumule and spire are removed, cuts and is about 3 millimeters or so of epicotyl and stem apex, be inoculated on B culture medium under dark (24~
27 DEG C) culture, and cut the plumular axis of elongation in time and peel off spire.After culture 6~10 days, stem apex starts irregularly to expand life
It is long, occur warty or digitation on the separate living tissue expanded.After 20 days, it is indefinite to be formed on the surface of warty or digitation
Bud and embryoid.In squamous subculture, if tissue block is grown thickly, budlet is on the high side, and 2,4-D concentration take 3.0 μm of ol/l；If Multiple Buds group
It is heavier to knit block callusization, surface adventitious bud is few, 2,4-D concentration can be reduced to 1.0 μm of ol/l, continues culture and then produces again
Raw a large amount of wartys or digitation.Multiple Buds tissue block on B culture medium, minority have the generation of adventitious root.There are one with spire
Sample, adventitious root also influence the generation for expanding growth and embryoid and the budlet that grows thickly of tissue block, need to remove early.
3) conversion and plant regeneration
Binary vector (Mini--Ti plasmid pB7WG2.0-P35S::bar-Tnos-Pubi::mZmDEP-Tnos) will be had
Agrobacterium tumefaciens LBA4404 in the YEP culture medium of additional antibiotic, (every liter of culture medium contains: tryptone 10g, yeast are mentioned
Take object 5g, NaCl 5g, pH 7.0, high pressure sterilization) at 28 DEG C shake culture, concussion rate be 110rpm (rev/min), make thin
Bacterium is in logarithmic growth phase.Then it is centrifuged 10 minutes at 3,000 rpm, abandons supernatant.The liquid B culture of 1/2 concentration of thallus
Base washing, is collected by centrifugation.Again by thallus 1/2 concentration of addition acetosyringone (acetosyringone, As) 100 μm of ol/l
Liquid B culture medium suspend, 5~8 times of dilution is for converting.
Taking the Multiple Buds tissue block cultivated 13~20 days after subculture is transgene receptor.With Agrobacterium-mediated transformation 10~
15 minutes.Material darkling carries out renewal cultivation after conversion.Agrobacterium infection grow thickly budlet or Multiple Buds tissue block added with
On the culture medium of cephalosporin (Cefotaxime) 250mg/l or carbenicillin (Carb) 500mg/l in dark culture 7~
12 days, inhibit bacterial growth.Grow thickly budlet or the sprout tuber that grows thickly after renewal cultivation or after micro-organisms is added with selective agent grass fourth
In 3~4 generation of step sizing on the culture medium of phosphine 0.08%, obtains transgenic cell and budlet.Number big absolutely is grown thickly in screening and culturing
Bud tissue block is gradually dead, the tissue block of survival is transferred on the B culture medium for removing 2,4-D of no selective agent and breaks up budlet.
Budlet is placed on seedling culture medium under irradiation and is grown, light intensity 2000-3000lx, 14-15 hours/day of illumination.It is small
Seedling is transferred in root media when growing to 3-4 piece leaf takes root.Culture 15 days or so, about 40% seedling generate new root.For not
Rooted seedling, its base portion of cut wound are transferred on new root media and cultivate, and most of plant generate root system after 10 days.Rooted seedling
After washing away culture medium, it is transplanted to using vermiculite to be grown in the flowerpot of cultivation medium.Plant grows under natural lighting, and day temperature 22~
28 DEG C, 15~21 DEG C of night temperature, the inorganic salts ingredients of the seed germination medium of 1/2 concentration are poured every other day.Growth 2 weeks or so moves
It plants seedlings and generates flourishing root system, be then colonized in field.
4) Resistance detecting of transgenic plant and selection
It takes the blade of transplant survival plant to carry out molecular Biological Detection and determines transgenic plant.Then by transgenic plant
(T0) bagging self-fertility.T1 seed from different T0 plant is broadcast in greenhouse or with the field of protective equipment, after emergence
It takes blade to detect transgenosis using PCR method, and smears 0.2% glufosinate solution and identify Herbicid resistant.By the PCR positive and remove
The plantlet of transplant of careless agent resistance is to field, bagging self-fertility after growing up.
In transgenic plant progeny selection, take T2 of uniform size for transgenic seed and receptor self-mating system seed first
It is seeded in vinyl disc of the same size, the homogeneous loam of equivalent is housed in disk, every disk sows 20, and every strain is at least planted
3 disks.Normal watering, it is long to 3 leaf phases to seedling, it chooses the consistent vinyl disc of growing way and carries out drought resistance observation test.Drought stress
The method of processing is to stop watering after being disposably watered with moisture, and up to the plant leaf of most strains, withered, basal part of stem softens,
Restore to water again, observes upgrowth situation of each strain after restoring watering, filter out drought resistance and significantly improved than receptor self-mating system
Strain.Then drought stress before transgenic plant is bloomed is carried out to handle.
Drought stress test carries out under field conditions (factors) before corn is bloomed, and avoids plant from drenching with rain during Stress treatment.It chooses
T2 is seeded in big flowerpot of the same size for transgenic seed and receptor self-mating system seed, plant it is long to 5 leaf phase when, every basin stays
2 plants of seedling, that is, compare 1 plant, 1 plant of transgenic plant.Plant is long to 10 leaves under the conditions of normal watering, and it is consistent then to choose growing way
Plant is divided into two groups, and one group grows under drought condition, and soil absolute water content is maintained at 15-17% or so, continues
Then processing one week restores normal watering.Another group is maintained under the conditions of sufficient watering and grows, as control.Every group sets 6 weights
It is multiple.Osmotic treatment group is poured early period in control water, and plant is wilted in 9~18 time blade on daytime, and night blade restores stretching, extension；It is controlling
Water pours the later period, and blade is persistently wilted.Restore normal watering after a week, plant starts to take out male.By plant control watering the 1st day
(blade starts to wilt at the morning 8 or so) is denoted as drought stress and handles 0 day, respectively in 0,2,4,6,8 day and recovery of processing
Normal watering samples after a week, and measurement RWC, cell membrane Ion leakage rate, mda content, soluble sugar content, proline contain
Amount and photosynthesis index etc..Plant height and plant greenery number are measured after Osmotic treatment in florescence, statistics was bloomed and between the time of spinning
Every (Anthesis-silking interval, ASI).The measurement of pollen activity uses iodine-potassium iodide decoration method, in low power lens
Lower observation, statistics pollen activity.
The plant of 8 days drought stresses is undergone, restores watering and starts to take out hero after a week, count plant plant height in this period
With hold greenery the piece number.Under the conditions of normal watering, existing phenotype between the growth and development and receptor self-mating system of transgenic plant
Difference is unobvious, and the measurement result of some indexs also demonstrates observation conclusion.Determination of yield shows to be overexpressed mZmDEP gene
Strain cell production is the 105%~116% of receptor self-mating system.After drought stress is handled 8 days before blooming, all strains are averaged
Plant height significantly reduces, but the amplitude reduced between different corn strains is different.Compared to the same strain under the conditions of normal watering
Plant, it is 10% or so that the plant height of transgenic plant, which reduces amplitude, reduces by 15% of amplitude lower than control self-mating system.Experience arid
After stress, greenery the piece number significant difference is held between different strains, the greenery number for turning mZmDEP gene plant is higher than control selfing
System.Drought stress before blooming produces deep effect to the female tassel development of plant.After Osmotic treatment, Suo Youyu
The flowering time of rice strain is postponed, and the normal pollen quantity of plant reduces and pollen sterile quantity increases, and female tassel development is not assisted
It adjusts.Time interval (Anthesis silking interval, ASI) is bloomed-spun to drought stress to mZmDEP gene plant is turned
Influence be less than to receptor self-mating system.After drought stress, receptor self-mating system plant pollen amount is few, and turns mZmDEP gene
Plant pollen amount is more.The anther of different strains is taken to carry out cytological observation using the dyeing of iodine-potassium iodide method, it will be seen that receptor is certainly
Friendship is that only smaller portions are contaminated for blue, most of presentation fawn in the pollen grain of plant.And the hero of transgenic plant
The normal loose powder of fringe energy, most POLLEN MORPHOLOGYs are normal, most of to be contaminated for navy blue, color after pollen grain is dyed by iodine-potassium iodide
It is relatively deep.That is the pollen abortion rate of receptor self-mating system plant is high, and transgenic plant is in its pollen majority after drought stress is handled
Development is normal, and viability is strong.
5) Resistance Identification of transgenic line and utilization
Transgenic corns and receptor self-mating system seed are sowed in drought resistance detection canopy, it is long to 10 leaf phase time controls to plant
Irrigation amount processed, makes soil relative water content be maintained at 50%-55% or so, carries out drought stress to plant, continues 6 weeks, then pour
Sufficient moisture.The growth and development difference of plant during observation Osmotic treatment.After fruit ear is mature, system is observed to Ear Characters
Meter.After drought stress, the blade for turning mZmDEP plant more stretches, leaf color jade green, and small, receptor self-mating system is influenced by drought stress
The leaf rolling of plant is serious, and individual Plant Leaf discolorations are shallow.Different strain Ear Characters and volume analysis show after drought stress
The average spike length for turning mZmDEP strain is significantly greater than receptor self-mating system.From the point of view of grain weight per panicle, single fringe grain of mZmDEP strain
Weight obviously increased with receptor self-mating system compared with, grain weight per panicle respectively than compare self-mating system (50.8 ± 9.0g) increase by 34.1%,
29.9%.From the point of view of 100-grain weight, though it is variant between each transgenic line and receptor self-mating system, significant difference journey is not achieved
Degree.These results indicate that turning mZmDEP gene plant has the resistance significantly improved, reproduction to the drought stress encountered before blooming
Allelotaxis is impacted smaller, so that grain yield be made to be significantly higher than the receptor self-mating system under the conditions of.
Embodiment 2: turn mZmDEP antisense gene and create corn salt-tolerant drought-resistant self-mating system
1) recombination is arrived entry vector pENTR11 using fixed point recombinant technique by the building of mZmDEP gene antisense expression vector
Corn mZmDEP antisense gene recombination to plant expression vector pB7WG2.0-P35S::bar-Tnos-Pubi::MCS-
In Tnos, plant vector pB7WG2.0-P35S::bar-Tnos-Pubi::mZmDEP (antisense)-Tnos is generated.Using freeze-thaw method
The latter is imported in agrobacterium tumefaciens LBA4404 and is used for maize genetic conversion.
2) corn aseptic seedling obtains
The seed of maize elite inbred line Zheng 58 is impregnated 8 minutes with 70% ethyl alcohol, then impregnates 8~12 with 0.1% mercury chloride
Minute, then with sterile water washing 3-5 times.Sterilization period constantly shakes seed, to guarantee that surface sterilizing is thorough.Seed after sterilizing
It is placed in sterile triangular flask and sprouts, be put into a small amount of sterile water in bottle, placed 1~2 day under dark condition (25-28 DEG C).Wait plant
After son sprouts and (shows money or valuables one carries unintentionally), places it in modified MS medium and continue to sprout under dark condition.To only 3~4 lis of plumule elongation
Meter Shi removes plumule and 2~3 spires, exposes stem apex growth cone.
3) culture of Agrobacterium and activation
Binary vector will be had, and (Mini-Ti plasmid is pB7WG2.0-P35S::bar-Tnos-Pubi::mZmDEP (anti-
Justice)-Tnos) agrobacterium tumefaciens LBA4404 in the YEP culture medium of additional antibiotic shake culture at 28 DEG C, shake rate
For 110r/min, bacterium is made to be in logarithmic growth phase.Then it is centrifuged 10 minutes at 3000r/min, abandons supernatant.Thallus is with 1/
The washing of 2MS fluid nutrient medium, is collected by centrifugation.Again by the thallus 1/2MS fluid nutrient medium of 100 μm of ol/l acetosyringones of addition
It suspends, is diluted to OD6000.2~0.4 for converting.
4) corn aseptic seedling converts
Bacterium solution is poured in the culture dish of 4.5 cm diameters, tilts culture dish, impregnates the exposed stem apex growth cone of aseptic seedling
In bacterium solution, 0.5 × 105It is infected 8~12 minutes under Pa atmospheric pressure.Bud point after dip dyeing is blotted with aseptic filter paper, sprouts kind
Son is placed in modified MS medium to be cultivated 2-3 days in dark, and cultivation temperature is 22~24 DEG C.Then aseptic seedling is placed on scattering
It is cultivated 2 days under light.Aseptic seedling after irradiation culture is transplanted in the flowerpot for being covered with upper layer vermiculite lower layer loam, and is covered with vermiculite
At the top of lid plant.Then it allows plant to grow under natural lighting, 22~28 DEG C of day temperature, 15~21 DEG C of night temperature, pours 1/2 every other day and change
Good MS culture medium inorganic salts.
5) transformed plant screening and field planting
After transformed plant grows 3 leaves, herbicide is sprayed(Hoechst Schering AgrEvo GmbH, contains
Have herbicide glufosinate-ammonium glufosinate ammonium) aqueous solution, concentration is 9.6ml~10.8mlWith plant
Falling drop is advisable.Unconverted receptor self-mating system plant stops growing after 4 days after spraying, starts after 9 days dead.Transformed plant exists
After sprinkling, some individual variations are similar to receptor self-mating system plant, other individual continued propagations change unobvious.Wait survive
It when plant grows to 5 leaf, is colonized to field, bagging selfing is set seeds.
6) transgenic plant offspring analysis
T1 grew to for 3 leaf phases for plant and uses 10.8mlAqueous solution processing, observation statistics resistance and sensitive individuals
Ratio；Foreign gene is detected using round pcr, and counts segregation ratio of the foreign gene in progeny plant.The plant that survives moves
It plants to crop field, bagging selfing.T2 in addition to bagging selfing is set seeds, continues to detect foreign gene, positive strain using round pcr for plant
System's progress Southern blotting verifying, and use RT-PCR technology inspection corn GRMZM2G001660 gene,
The variation of the expression intensity of GRMZM2G172320 gene and GRMZM2G028726 gene selects growth and development normal and target gene
The strain of expression decline carries out resistance measurement and determination of yield.
7) the salt tolerance detection of transgenic plant offspring
Since sensitive periods of the corn to salt stress is Their Seed Germinating Period and small seedling stage, plant salt tolerance is opposite after 5 leaf phases
It is relatively strong.Salt tolerance of corn measurement emphasis is in seedling stage and germination period.
Salt resistant test is carried out for plant to T2 and economical character selects.Take T2 for seed first, 60, every fruit ear (divides 3
Secondary repetition, 20 tablets each time), it is sterilized 6 minutes with 70% ethyl alcohol sterilizing 5 minutes, 0.1% mercuric chloride solution respectively, then is used sterile water
Washing 3~4 times, is placed in the filter paper plate of 0.8%NaCl aqueous solution soaking, the latter is placed in enamel tray with cover with 3 centimeter aparts
In, it is control with receptor self-mating system seed then with (4 layers) of the SS saline soaked gauze of 0.8%NaCl coverings.Cover enamel tray
Afterwards, it is put at 25 DEG C and sprouts.Seed sprouting state is observed by day after 3 days, generally continues one week.Count germination rate, plumule and
Kind root long degree, strain salt tolerance is judged according to germination rate and germinating energy, selects the strain that salt tolerance is significantly better than receptor self-mating system
System.Selected strain answers germination rate to be higher than receptor self-mating system, and plumule growth is very fast, and root system development is preferable.
Selected strain seed is broadcast respectively in 12 centimetres of diameter of sand basin, 8 seeds of every basin repeat three times.It is same heavy
Multiple flowerpot random alignment, regularly placing.Flowerpot for salt choosing is in the same size, drainage hole of unified specification, the sand of filling
Homogeneous, no soil, breakthrough rate is almost the same after watering.After planting pour 0.7% or 0.8%NaCl aqueous solution, with by
Body self-mating system seed is control.Different strains show different germination rate and growing way and survival rate under salt water irrigation, wherein
Some strains show the salt tolerance significantly improved than receptor self-mating system.In T2 in strain, 5 leaf phase plant of salt-resistance strain at
Motility rate is generally 75% or more, and receptor self-mating system emergence rate only has 30%~50%, and plant emergence rear lower blade is very
Become withered fastly, dead before and after 3 leaf phases, 5 leaf phase survival rates are less than 1/8.The excellent plantlet of transplant of salt tolerance to crop field bagging is selfed,
Harvest seed.Then seed sowing counts emergence rate (number of emerging/broadcast in the soil that soil salt content is 0.3%~0.5%
Kind of seed number × 100%), planting percent (7 leaf phase plant numbers/number of emerging × 100%), Heading date and plant height, single plant yield and fruit
Fringe character (spike length, tassel row number, row grain number, Ear weight), cell production carry out the assessment of selection of salt tolerance and utility value, will
The strain that these indexs are significantly better than the receptor self-mating system under the conditions of is determined as good salt tolerance and has the breeding material of utility value.
8) the drought resistance measurement of transgenic plant
It is control with receptor self-mating system for the transgenic line that selected salt tolerance is significantly improved, measurement plant exists
Net photosynthetic rate, 3-7 leaf phase seedling growth rate and biomass, list under normal cultivation condition and under drought stress conditions
Strain yield, cell production etc..Yield Traits In Corn is carried out under field cultivating condition after selecting excellent transgenic drought-resistant strain
Observation and compare, select drought resisting high yield strain enter corn breeding experiment.Specific procedure is referring to example 1.
8) application of transgenic plant
Combining ability test is carried out to selected salt-tolerant drought-resistant transgenic line, is another parent preparation with non-salt-tolerant inbred lines
Cross combination, F1 seed are seeded into soil and non-salt-soda soil that soil salt content is 0.3%~0.5%, record plant strain growth
Puberty and Other Main Agronomic Characters, measurement single plant and cell production, 0.01 mu of plot area, if 4 repetitions, planting density are
4500~5000 plants/acre.It is surveyed by the observation of the Comprehensive Traits such as salt-tolerant drought-resistant, disease resistance, lodging resistance, yield index and yield
It is fixed, select corn salt-tolerant drought-resistant the hybrid strain with high yield.
Embodiment 3: it is transferred to ZmDEPRNAi structure and creates corn salt-tolerant drought-resistant self-mating system
1) building of ZmDEPRNAi structure
It is amplified in mZmDEP sequence using PCR method from 150 nucleotide of opening code-reading frame to 628bp nucleotide
Segment, the plant expression vector by transformation recombinated based on the segment to be inserted into plasmid pFGC5941 by 2 times
(area plasmid T-DNA is inserted into fusion to pFGC5941-mbar-P35S::MCS-CHAS intron-MCS-OCSPolyA
PCaMV::mbar-TgluB5, wherein MCS is multiple cloning sites or restriction site, P35S are cauliflower mosaic virus 35S
RNA promoter, the password subsubstitution of mbar corn bias glufosinate-resistant Bar gene, TgluB5 be rice GluB5 albumen
Gene end area) multiple cloning sites at, generate ZmDEPRNAi structure.The two-arm of RNAi structure is complementary equal length
ZmDEP genetic fragment (478bp).
2) selection and utilization of maize genetic conversion and transgenic plant and its offspring
Implementation method is referring to Examples 1 and 2.
Claims (2)
1. a kind of corn mZmDEP gene and its application of expression inhibiting structure in Drought Resistance in Maize and salt tolerance breeding, special
Sign is: the nucleotide sequence of the corn mZmDEP gene is as shown in SEQ ID No.1；The amino acid sequence that it is encoded is such as
Shown in SEQ ID No.2；The expression inhibiting structure of the corn mZmDEP gene refers to nucleotide sequence shown in SEQ ID No.1
Antisense expression structure and SEQ ID No.1 shown in nucleotide sequence RNAi structure, wherein the RNAi structure is by SEQ
Segment in preceding 628 nucleotide regions of ID No.1 is built-up.
2. application as described in claim 1, it is characterised in that: the corn mZmDEP gene and its expression inhibiting structure are in jade
The method applied in rice drought tolerance and salt tolerance breeding is: being inserted into mZmDEP gene overexpression knot respectively in the plant expression vector
They are directed respectively into maize cell using transgenic technology by structure, mZmDEP gene antisense expression structure, ZmDEP RNAi structure
And regeneration plant, resistance and high-yielding transgenic corns strain is filtered out from its offspring, the jade of drought tolerance and salt tolerance is provided in initiative
Rice new varieties.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510916723.0A CN105349551B (en) | 2015-12-10 | 2015-12-10 | A kind of corn mZmDEP gene and its application of expression inhibiting structure in corn breeding for stress tolerance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510916723.0A CN105349551B (en) | 2015-12-10 | 2015-12-10 | A kind of corn mZmDEP gene and its application of expression inhibiting structure in corn breeding for stress tolerance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105349551A CN105349551A (en) | 2016-02-24 |
| CN105349551B true CN105349551B (en) | 2019-07-02 |
Family
ID=55325613
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510916723.0A Expired - Fee Related CN105349551B (en) | 2015-12-10 | 2015-12-10 | A kind of corn mZmDEP gene and its application of expression inhibiting structure in corn breeding for stress tolerance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105349551B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058545B (en) * | 2017-04-27 | 2020-07-24 | 四川农业大学 | SNP molecular marker of corn embryogenic callus induction related gene GRMZM2G020814 and application thereof |
| CN107987141B (en) * | 2018-01-30 | 2022-10-14 | 山东大学 | Application of corn nuclear factor gene ZmNF-YA1 in plant stress resistance modification |
| WO2019213910A1 (en) * | 2018-05-10 | 2019-11-14 | Syngenta Participations Ag | Methods and compositions for targeted editing of polynucleotides |
| CN116162142B (en) * | 2022-09-29 | 2024-02-20 | 华中农业大学 | Application of plant GS3 gene or protein in regulation and control of saline-alkali tolerance of plants |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102174527A (en) * | 2011-01-27 | 2011-09-07 | 中国科学院遗传与发育生物学研究所 | New application of upright dense cluster genes in improvement of utilization efficiency of nitrogen fertilizer |
-
2015
- 2015-12-10 CN CN201510916723.0A patent/CN105349551B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102174527A (en) * | 2011-01-27 | 2011-09-07 | 中国科学院遗传与发育生物学研究所 | New application of upright dense cluster genes in improvement of utilization efficiency of nitrogen fertilizer |
Non-Patent Citations (3)
| Title |
|---|
| Constitutive or seed-specific overexpression of Arabidopsis G-protein γsubunit 3(AGG3) results in increased seed and oil production and improved stress tolerance in Camelina sativa;Roy Choudhury S et al.;《Plant Biotechnol J》;20140131;第12卷(第1期);摘要 * |
| Isolation,in silico characterization,localization and expression analysis of abiotic stress-responsive rice G-protein β subunit(RGB1);Yadav DK et al.;《Plant signal behav》;20141231;第9卷(第5期);e28890 1-12 * |
| 基于ZmDEP1基因的玉米籽粒性状关联分析;白光红等;《新疆农业大学学报》;20141031;第37卷(第5期);第356-361页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105349551A (en) | 2016-02-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107987141B (en) | Application of corn nuclear factor gene ZmNF-YA1 in plant stress resistance modification | |
| CN105349551B (en) | A kind of corn mZmDEP gene and its application of expression inhibiting structure in corn breeding for stress tolerance | |
| CN102459615B (en) | Drought tolerant plants | |
| CN1769463A (en) | Method for promoting salt and drought tolerance of maize and wheat by combining betA,NHX1,PPase gene and transgene technology | |
| CN112322628A (en) | Transcription factor GhWRKY1-like gene for regulating and controlling verticillium wilt and drought resistance of cotton and application thereof | |
| CN105420257A (en) | Application of maize secretory phospholipase A2 gene ZmsPLA2-2 to changes in plant drought resistance properties | |
| CN101643745B (en) | Thellungiella V-pyrophosphatase gene (TsVPI) promoter sequence and application of deletion mutant thereof | |
| CN104388448B (en) | A kind of corn phospholipase A_2 gene ZmsPLA2-1 and its application | |
| CN104611359A (en) | Applications of ZmSPL1 protein and coding gene thereof in corn kernel development regulation | |
| CN106967728A (en) | A kind of pumpkin adversity gene CmNAC1 and its application | |
| CN110358772A (en) | The OsEBP89 gene and preparation method of raising rice abiotic stress resistance and application | |
| CN108486149B (en) | Application of cucumber CsWRKY50 gene in enhancing cucumber downy mildew resistance | |
| CN101698854A (en) | Application of transcription thellungiella halophila CBF1 gene in improving drought resistance and salt tolerance of corn and wheat | |
| CN106834345B (en) | Method for improving comprehensive stress resistance of rape by multi-gene superposition cotransformation | |
| CN104450742B (en) | Maize kernel factor gene ZmNF YB3 and its homologous gene application | |
| CA3038869A1 (en) | Growing strawberry plug plants at low elevation without the need for conditioning | |
| CN103497958B (en) | Rice Os Xrn4 gene and application thereof | |
| CN105400792A (en) | Application of corn kernel factor gene ZmNF-YA3 to changing plant resistance tolerance | |
| CN102296084B (en) | Use of auxin efflux carrier PINFORMED1 (PIN1) family genes in breeding corn and broomcorn | |
| CN104726488A (en) | Method for culturing stress-resistance herbicide-resistance transgenic aerobic rice | |
| CN112410370B (en) | Application of corn 10kDa heat shock protein gene ZmHsp10 in changing stress resistance of plants | |
| CN102492718A (en) | Application of genes of auxin influx carrier AUX1/LAX family in breeding of corns and broomcorns | |
| CN113913456A (en) | Method for improving resistance of tomatoes to meloidogyne incognita | |
| CN102604989B (en) | Methyltransferase gene in betaine synthetic pathway and application thereof | |
| CN1952143A (en) | Cloning of gene against meloidogyne of capsicum and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190702 Termination date: 20191210 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |